Printer Friendly
The Free Library
9,039,317 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Variant Salmonella genomic island 1 antibiotic resistance gene cluster in Salmonella enterica serovar Albany. (Research).


Salmonella genomic island A Genomic island(GI) is part of a genome that used to be mobile and is now fixed. A GI can code for many functions, can be involved in symbiosis or pathogenesis, and may help an organism's adaptation.  1 (SGI (SGI, Sunnyvale, CA, www.sgi.com) A manufacturer of workstations and servers, founded in 1982 by Jim Clark. The company was founded as Silicon Graphics, Inc., but changed to its acronym in 1999. 1) contains an antibiotic resistance antibiotic resistance,
n the ability of certain strains of microorganisms to develop resistance to antibiotics.

antibiotic resistance 
 gene cluster A gene cluster is a set of two or more genes that serve to encode for the same or similar products. Because populations from a common ancestor tend to possess the same varieties of gene clusters, they are useful for tracing back recent evolutionary history.  and has been previously identified in multidrug-resistant Salmonella enterica Salmonella enterica is a rod shaped, flagellated, Gram-negative bacterium, and a member of the genus Salmonella.[1] Serovars
S. enterica has an extraordinarily large number of serovars
 serovars Typhimurium DT104, Agona, and Paratyphi B. We identified a variant SGI1 antibiotic-resistance gene cluster in a multidrug-resistant strain of S. enterica serovar Albany isolated from food fish from Thailand and imported to France. In this strain, the streptomycin streptomycin (strĕp'tōmī`sĭn), antibiotic produced by soil bacteria of the genus Streptomyces and active against both gram-positive and gram-negative bacteria (see Gram's stain), including species resistant to other  resistance aadA2 gene cassette A gene cassette is broadly a modular DNA sequence encoding one or more genes for a single biochemical function.

In genetic engineering, a gene cassette refers to a manipulable fragment of DNA carrying, and capable of expressing, one or more genes of interest between one or
 in one of the SGI1 integrons was replaced by a dfrA1 gene cassette, conferring resistance to trimethoprim trimethoprim /tri·meth·o·prim/ (-meth´o-prim) an antibacterial closely related to pyrimethamine; almost always used in combination with a sulfonamide, primarily for the treatment of urinary tract infections.  and an open reading frame of unknown function. Thus, this serovar Albany strain represents the fourth S. enterica serovar in which SGI1 has been identified and the first SGI1 example where gene cassette replacement took place in one of its integron structures. The antibiotic resistance gene cluster of serovar Albany strain 7205.00 constitutes a new SGI1 variant; we propose a name of SGI1-F.

**********

Multidrug-resistant Salmonella enterica serovar Typhimurium definitive phage phage: see bacteriophage.

phage - A program that modifies other programs or databases in unauthorised ways; especially one that propagates a virus or Trojan horse. See also worm, mockingbird. The analogy, of course, is with phage viruses in biology.
 type 104 (DT104) emerged during the 1980s as a global health problem because of the strain's involvement in diseases in animals and humans (1). Multidrug-resistant strains of this phage type were first identified from exotic birds The Exotic Birds was a pop music group formed in Cleveland, Ohio in 1983 by three Cleveland Institute of Music percussion students, Andy Kubiszewski, Tom Freer and Tim Adams. They wrote their own music and were described as synth pop, techno-pop and techno-dance.  in the United Kingdom in the early 1980s and in cattle and humans in the late 1980s; they have since become common in other animal species such as poultry, swine, and sheep. The DT104 epidemic has now spread worldwide, including several outbreaks since 1996 in the United States United States, officially United States of America, republic (2005 est. pop. 295,734,000), 3,539,227 sq mi (9,166,598 sq km), North America. The United States is the world's third largest country in population and the fourth largest country in area.  and Canada (2-5).

Multidrug-resistant S. enterica serovar Typhimurium DT104 is commonly resistant to ampicillin ampicillin (ăm'pĭsĭl`ĭn), a penicillin-type antibiotic that is effective against both gram-negative microorganisms and gram-positive microorganisms such as Escherichia coli.  (Ap), chloramphenicol/florfenicol (Cm/Ff), streptomycin/ spectinomycin spectinomycin /spec·ti·no·my·cin/ (spek?ti-no-mi´sin) an antibiotic derived from Streptomyces spectabilis, used as the hydrochloride salt in the treatment of gonorrhea.  (Sm/Sp), sulfonamides Sulfonamides Definition

Sulfonamides are medicines that prevent the growth of bacteria in the body.
Purpose

Sulfonamides are used to treat many kinds of infections caused by bacteria and certain other microorganisms.
 (Su), and tetracyclines Tetracyclines Definition

Tetracyclines are medicines that kill certain infection-causing microorganisms.
Purpose

Tetracyclines are called "broad-spectrum" antibiotics, because they can be used to treat a wide variety of
 (Tc). The antibiotic resistance genes are clustered in part of a 43-kb genomic island called Salmonella genomic island 1 (SGI 1), located between the chromosomal thdf and int2 genes (6,7). The int2 gene is part of a retron that has been detected only in serovar Typhimurium (7). Downstream of the retron sequence is the yidY gene, which is also found in the chromosome of other S. enterica serovars (7). The antibiotic resistance gene cluster represents approximately one third of SGI1 and is located at the 3' end of the structure (6,7). All resistance genes are clustered and are bracketed by two integron structures (Figure 1) (6-10). The first integron carries the aadA2 gene, which confers resistance to Sm and Sp, and a truncated sul1 (sul1delta) gene. The second integron contains the [beta]-lactamase gene pse-1 conferring resistance to Ap and a complete sul1 gene conferring resistance to Su. Flanked by these two integron structures are the floR gene (8), also called floSt (11) or cm1A-like (9), which confers cross-resistance to Cm and Ff, and the tetracycline-resistance genes tetR and tet(G).

[FIGURE 1 OMITTED]

Recently, SGI1 has also been identified in other serovar Typhimurium phage types (i.e. DT120) and in other S. enterica serovars (i.e. Agona and Paratyphi B), indicating the horizontal transfer potential of SGI1 (6,10,12-15). In serovars Agona and Paratyphi B, SGI1 has the same chromosomal location as in serovar Typhimurium DT104, except that they lack the retron sequence found downstream of SGI1; thus it is located between the thdf gene and the yidY gene of their chromosomes (6,14). Moreover, variant SGI1 antibiotic resistance gene clusters have recently been reported for serovars Typhimurium DT104 and Agona (12,15). These clusters were probably generated after chromosomal recombinational events, resulting in either deletion or inactivation inactivation /in·ac·ti·va·tion/ (in-ak?ti-va´shun) the destruction of biological activity, as of a virus, by the action of heat or other agent.  of some antibiotic resistance genes or in insertion of a new antibiotic resistance gene cassette. In particular, the dfrA10 gene coding for trimethoprim (Tm) resistance was found downstream of the pse-1 integron in two of the SGI1 variant antibiotic resistance gene clusters reported (15). They were accordingly classified in SGI1-A to -E; the resulting antibiotic resistance phenotypes were ApCmFfSmSpSuTcTm, ApSu, SmSpSu, SmSpSuTm, and ApSmSpSuTc, respectively (15).

We examined a strain of S. enterica serovar Albany, isolated from food fish from Thailand and imported in France, that displayed the multidrug-resistance profile ApCmFfSuTcTm. This multidrug-resistance profile suggested the possible occurrence of SGI1 with a new variant antibiotic resistance cluster in this serovar.

Materials and Methods

The S. enterica serovar Albany strain 7205.00 used in this study was isolated from a food fish from Thailand. This strain and control strains S. Typhimurium DT 104 BN9181 (8,13,14), S. Agona 959SA97 (8,13,14), S. Paratyphi B 44 (14), and Escherichia coli Escherichia coli (ĕsh'ərĭk`ēə kō`lī), common bacterium that normally inhabits the intestinal tracts of humans and animals, but can cause infection in other parts of the body, especially the urinary tract.  strain TOP 10 (Invitrogen SARL SARL South African Radio League
SARL Société Anonyme à Responsabilité Limitée (French: limited liability company)
SARL Salem Animal Rescue League (Salem, NH)
SARL Sociedade Anónima de Responsabilidade Limitada
, Cergy-Pontoise, France) used in cloning experiments were grown at 37[degrees]C in brain heart infusion broth Brain heart infusion broth (or BHI broth) is a highly nutritious general-purpose growth medium for fastidious microorganisms, such as streptococci, pneumococci and meningococci.  or agar plates. The strains were tested for their antibiotic susceptibility by the disc-diffusion assay on Mueller-Hinton plates. Susceptibility was tested by using discs containing the following antibiotics: Ap (10 [micro]g), Cm (30 [micro]g), Ff(30 [micro]g), Sm (10 IU), Sp (100 [micro]g), Su (200 [micro]g), Tc (30 IU), and Tm (5 [micro]g). All antibiotic disks except for Ff were purchased from Bio-Rad (Marnes-la-Coquette, France). Ff disks and the drug itself were obtained from Schering-Plough Animal Health (Kenilworth, NJ). MICs of Ff and Cm were determined by using the standard agar doubling dilution method. MIC breakpoints for Cm and Ff were defined by the Comite de l'Antibiogramme de la Societe Francaise de Microbiologie (CASFM) or by the manufacturer (i.e., susceptible [MIC [less than or equal to] 8 [micro]g/mL], intermediate [MIC = 16 [micro]g/mL], or resistant [MIC [greater than or equal to] 32 [micro]g/mL).

Detection of SGI1 and its location were performed by using primers corresponding to left and right (with or without retron) junctions in the chromosome as described (Table; Figure 1) (6,7,14). Polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is  (PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
) mapping of the typical antibiotic resistance genes and integrons associated with SGI1 was performed by using conditions and primers as described (Table; Figure 1) (13-15). The antibiotic resistance gene organization was also assessed by Southern blots of genomic DNA genomic DNA
n.
The full complement of DNA contained in the genome of a cell or organism.
 cut by either XbaI, XhoI, HindIII or EcoRI by using as a probe the XbaI insert from recombinant plasmid pSTF3, comprising nearly the entire DT104 antibiotic resistance gene cluster, as described (13,14). Presence of SGI1 regions outside the antibiotic resistance gene cluster was assessed by Southern blot of genomic DNA cut by XbaI by using probe p1-9 as described (6,14). This probe contains a 2-kb EcoRI insert corresponding to a central region of SGI1, comprising parts of S023 and S024 open reading frames (ORFs), which code for putative helicase and exonuclease exonuclease /exo·nu·cle·ase/ (ek?so-noo´kle-as) any nuclease specifically catalyzing the hydrolysis of terminal bonds of deoxyribonucleotide or ribonucleotide chains, releasing mononucleotides.  proteins (6).

PCR amplification of the first integron was also performed by using primer int1 of PCRA PCRA Petroleum Conservation Research Association
PCRA Personal Choice Retirement Account (Schwab)
PCRA Post-Conviction Relief Act (Pennsylvania)
pcrA pyrroline-5-carboxylate reductase
 and primer F3 of PCR B (Figure 1). Cloning of this PCR product in plasmid pCR2.1-TOPO was performed by using the TOPO TOPO Tri-N-Octylphosphine Oxide
TOPO Topographic/Topography
TOPO Trioctyl-Phosphine Oxide
ToPo Torposten (German Military Gate Post)
TOPO Tunable Optical Parametric Oscillator
 TA cloning kit (Invitrogen). We used Genome Express (Meylan, France) for nucleotide sequencing of the insert.

Genomic DNA, contained in agarose agarose

more highly purified form of agar with similar uses to agar and widely used in the separation of nucleic acid fragments.
 plugs, was digested with BlnI or XbaI and fragments separated by pulsed-field gel electrophoresis gel electrophoresis
n.
Electrophoresis performed in a gel composed of agarose, polyacrylamide, or starch.
 (PFGE PFGE Pulsed-Field Gel Electrophoresis ) performed by using the CHEF-DR III system (Bio-Rad, Hemel Hempstead Hemel Hempstead (hĕm`əl), town (1991 pop. 80,110), Hertfordshire, SE England. Hemel Hempstead was designated one of the new towns in 1946 to alleviate overpopulation in London. It is a market town and London suburb. , U.K.) at 6 V/cm for 24 h with pulse times of 10-30 sec. The nucleotide sequence of the S. Albany strain 7205.00 integron fragment harboring the Tm resistance gene has been deposited in GenBank under accession number Accession number may mean:
  • Accession number (bioinformatics), a unique identifier given to a biological polymer sequence (DNA, protein) when it is submitted to a sequence database.
 AY 146989.

Results

Multidrug-Resistant Phenotype

S. Albany strain 7205.00 showed a multidrug-resistant phenotype similar to SGI1 carrying S. enterica serovars Typhimurium DT104, Agona, or Paratyphi B, (i.e., Ap, Cm/Ff, Su, Tc). The strain was susceptible to Sp and Sm but showed additional resistance to Tm. The strain showed the same level of resistance to Ff as S. enterica serovars Typhimurium DT 104, Agona, or Paratyphi B with a Ff MIC of 64 [micro]g/mL. No plasmids were detected in the S. Albany strain, suggesting a chromosomal location of antibiotic-resistance genes and possibly the presence of SGI1.

Identification of SGI1

To assess the presence of SGI1 and its location in the chromosome of the S. Albany strain 7205.00, PCR was performed by using primers corresponding to the left and right junctions of SGI1 in the Salmonella chromosome (Figure 1). We also used PCR to detect the presence or absence of the int2-retron sequence, which is located downstream of SGI1 in serovar Typhimurium DT 104 but not in serovars Agona and Paratyphi B (6,14). PCR results were positive for the left junction of SGI1, as for the other serovars. If a sequence of the int2 gene of the retron was used as reverse primer, the PCR results were negative for the right junction of SGI1 but positive if the sequence of the yidY gene was used. PCR products showed the expected sizes of approximately 500 bp for both the left junction and right junction PCR without the retron sequence, as indicated in Figure 1. These data thus indicate that the serovar Albany strain 7205.00 contains SGI1 at the same chromosomal location as in serovars Typhimurium DT104, Agona, or Paratyphi B (i.e., between the thdf and yidY genes) but lacks the retron sequence found in DT104 and other serovar Typhimurium strains (6,7).

The nucleotide sequences of the left and right junction PCR products were determined, allowing an analysis of the imperfect 18-bp direct repeats flanking SGI1 (6,7). This direct repeat appeared to be a duplication of the last 18 bp of the thdf gene. The right junction direct repeat sequence (DR-R) was previously shown to be identical to the sequence from the respective thdf sequences from sensitive serovar Typhimurium or Agona strains, suggesting the origin of the DR-R is actually the end of thdF (Figure 2) (6). These sequences are slightly divergent between serovars Typhimurium and Agona, with a C located at position 9 of the direct repeat in serovar Typhimurium as opposed to a T at this position in Agona. The left junction direct repeat sequence (DR-L) is identical in both serovars, suggesting the origin of this sequence may be from the donor DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 and not the result of a duplication event. As shown in Figure 2, DR-L and DR-R sequences in the serovar Paratyphi B strain, which were not investigated in a previous study (14), and in the serovar Albany strain 7205.00 are identical to those found in serovar Agona strains carrying SGI1 (Figure 2). These results reinforce the hypothesis that the SGI1 insertions in serovar Typhimurium DT104 and in the other serovars were separate events and not a result of genetic exchange between serovar Typhimurium DT104 and the other serovars.

[FIGURE 2 OMITTED]

Aside from the antibiotic resistance genes presented below, the presence of the entire SGI1 in the serovar Albany strain 7205.00 was confirmed by Southern blot of XbaI-digested genomic DNA with the p1-9 probe, as described previously. This probe showed XbaI fragments of the expected 4- and 9-kb sizes as in control serovar Typhimurium DT 104, Agona, and Paratyphi B strains carrying SGI1 (Figure 3A).

[FIGURE 3 OMITTED]

New Variant Antibiotic Resistance Gene Cluster

PCR mapping of the typical antibiotic resistance genes and integrons associated with SGI1 is schematized in Figure 1. PCR amplifications on genomic DNA extracted from serovar Albany strain 7205.00 yielded fragments B, C, D, E, F, and partial floR of the sizes expected from DNA of serovar Typhimurium DT 104 control strain BN9181 (data not shown). However, fragment A specific for the aadA2 integron was not obtained. Thus, these PCR mapping results indicated the presence of floR, tetR, and tet(G) genes and the second integron carrying the pse-1 gene. A positive PCR result for fragment B, representing the link between the aadA2 integron and floR, would nevertheless suggest the presence of at least a partial aadA2 integron. These data are in accordance with the antibiotic resistance phenotype of serovar Albany strain 7205.00 (i.e., ApCmFfSuTc with lack of resistance to Sm and Sp) and indicate the presence of a SGI1 variant antibiotic resistance gene cluster at the level of the aadA2 integron.

These results were confirmed by Southern blot of genomic DNA digested by XbaI, XhoI, HindIII, or EcoRI with the pSTF3 probe containing nearly the entire antibiotic resistance gene cluster of serovar Typhimurium DT104 strain BN9181 (see XbaI fragment in Figure 1). XbaI and XhoI Southern blot profiles of the serovar Albany strain were similar to those obtained for the control strains of serovar Typhimurium DT104, Agona, and Paratyphi B harboring SGI1 (Figure 3B). However, the HindIII and EcoRI Southern blot profiles of the serovar Albany strain were clearly distinct from those of the control strains, confirming the presence of a variant antibiotic resistance gene cluster in the serovar Albany strain.

The genetic variation at the level of the aadA2 integron in the serovar Albany strain was further assessed by PCR with a forward primer of fragment A and reverse primer of fragment B (Figure 1). This PCR result was positive and yielded a fragment approximately 300 bp larger than with DNA from serovar Typhimurium DT104 control strain BN9181 (data not shown). This PCR product was cloned in plasmid pCR2.1-TOPO and sequenced. E. coli E. coli: see Escherichia coli.
E. coli
 in full Escherichia coli

Species of bacterium that inhabits the stomach and intestines. E. coli can be transmitted by water, milk, food, or flies and other insects.
 carrying this plasmid were resistant to Tm, indicating the presence of a Tm resistance gene in the fragment. Sequence analysis (done by using BLAST [available from: URL URL
 in full Uniform Resource Locator

Address of a resource on the Internet. The resource can be any type of file stored on a server, such as a Web page, a text file, a graphics file, or an application program.
: http://www.ncbi.nlm.nih.gov:80/BLAST/]) showed, in addition to the corresponding nucleotide sequence of the DT104 antibiotic resistance gene cluster, two gene cassettes (dfrA1 coding for Tm resistance and an ORF of unknown function), described in class 1 integrons of Vibrio cholerae Vibrio chol·er·ae
n.
A bacterium that causes Asiatic cholera in humans; Koch's bacillus.


Vibrio cholerae Infectious disease The Vibrio
 strains isolated in Thailand and India (99% nucleotide identity; GenBank accession nos. AF221901 and AF455254) (16,17). Thus, instead of the aadA2 gene classically found in the first integron of the SGI1 antibiotic resistance gene cluster, dfrA1 and an ORF of unknown function were found in the corresponding integron of serovar Albany strain 7205.00. The conserved regions of this integron were 100% identical to those found in serovar Typhimurium DT104 with a truncated sull n. 1. A plow.  gene (Figure 1). The distinct serovar Albany strain 7205.00 HindIII and EcoRI Southern blot profiles with probe pSTF3 described above are in accordance with the nucleotide sequence of the variable region containing dfrA1 of this integron (Figure 1). The antibiotic resistance gene cluster of serovar Albany strain 7205.00 constitutes a new SGI1 variant; we propose a name of SGI1-F, according to according to
prep.
1. As stated or indicated by; on the authority of: according to historians.

2. In keeping with: according to instructions.

3.
 previously proposed nomenclature (15).

Evidence for Horizontal Transfer

Macrorestriction analysis by PFGE of the serovar Albany strain DNA cut by XbaI or BlnI showed that the strain is genetically distinct from serovars Typhimurium DT 104, Agona, and Paratyphi B in which SGI1 has been identified (Figure 4). This distinction further indicates at the molecular level that the occurrence of SGI1 in the serovar Albany strain probably results from horizontal transfer and not seroconversion seroconversion /se·ro·con·ver·sion/ (-con-ver´zhun) the change of a seronegative test from negative to positive, indicating the development of antibodies in response to immunization or infection.  of known S. enterica serovars harboring SGI1.

[FIGURE 4 OMITTED]

Discussion

SGI1 is the first genomic island containing an antibiotic resistance gene cluster identified in S. enterica; its acquisition in S. Typhimurium phage type DT104 was possibly an important trait in the worldwide epidemic of the resulting multidrug-resistant clone causing disease in animals as well as in humans. SGI1 has been further identified in other S. enterica serovars, such as in serovar Agona strains isolated from poultry in Belgium and in a serovar Paratyphi B strain isolated from a tropical fish tropical fish

Any of various small fishes of tropical origin often kept in aquariums. They are interesting for their behaviour or showiness or both. Popular varieties include the angelfish, guppy, kissing gourami, sea horse, Siamese fighting fish, and tetra.
 in Singapore (6,13,14). The serovar Albany fish isolate from Thailand in this study represents the fourth S. enterica serovar in which SGI1 has been identified. The identification of SGI1 in several S. enterica serovars, shown by PFGE to be genetically distinct, suggests horizontal transfer of this region. That SGI1 has the same chromosomal location in the different serovars suggests that its insertion occured through site-specific recombination Site-specific recombination
In site-specific-recombination, DNA strand exchange takes place between segments possessing only a limited degree of sequence homology (Kolb 2002; Coates et al., 2005).
. Genes such as the tandemly arranged int and xis genes found adjacent to the DR-L of SGI1 may play a role in this recombination recombination, process of "shuffling" of genes by which new combinations can be generated. In recombination through sexual reproduction, the offspring's complete set of genes differs from that of either parent, being rather a combination of genes from both parents.  event because they encode a putative integrase and excisionase, respectively (6). Sequence analysis of the left and right junctions of SGI1 to the Salmonella chromosome provides additional clues about these recombination events in the different serovars. The right junction 18-bp DR-R direct repeat sequence found at the 3' end of SGI1 appears to be a duplication of the last 18 bp of the thdf gene found upstream of SGI1. The left junction SGI1 18-bp DR-L direct repeat sequence is slightly different from the 3'-end of thdf in sensitive S. enterica serovars lacking SGI1 (Figure 2) but identical in all serovars carrying SGI1. This finding suggests that the origin of this sequence may be from the donor DNA. When SGI1 insertion takes place in a sensitive S. enterica serovar, the last 18 bp of its thdf gene would be duplicated and found at the 3' end of SGI1 and replaced by the 18 bp of the donor DNA at the 5' end of SGI1. In other words Adv. 1. in other words - otherwise stated; "in other words, we are broke"
put differently
, the last 18 bp of thdf in sensitive S. enterica serovars may constitute a hotspot for homologous recombination Homologous recombination is a type of genetic recombination, a process of physical rearrangement occurring between two strands of DNA. Homologous recombination involves the alignment of similar sequences, a crossover between the aligned DNA strands, and breaking and repair of the  with an 18-bp similar sequence of the SGI1 donor DNA. These DR-R and DR-L minor sequence differences also support the hypothesis that the SGI1 insertions in serovar Typhimurium DT104 and other serovars were separate events and not a result of genetic exchange between serovar Typhimurium DT104 and the other serovars (6). Yet, the origin of SGI1 remains to be determined.

A similar situation has been reported for an approximately 100-kb genomic island in V. cholerae called SXT SXT Soft X-Ray Telescope
SXT Sensient Technologies Corp (stock symbol)
SXT Sulfamethoxazole-Trimethoprim
SXT Solar X-Ray Telescope (Launched in 1991 as a part of the Japanese Yokoh satellite) 
 conjugative, self-transmissible, integrating (constin) element. It carries multiple antibiotic resistance genes, including flor as in SGI1 (18,19). Integration of the element has been experimentally shown to occur through site-specific recombination in a 17-bp sequence found in the circular form of the SXT element and a similar 17-bp sequence of prfC of the V. cholerae and E. coli chromosomes (20). Chromosomal integration and excision of the SXT element required an element-encoded int gene that is found as first gene of the SXT element, as is the int gene of SGI1 (18,20). SGI1 may also exist in an intermediate circular form, but this remains to be demonstrated.

Most of the time, the antibiotic resistance gene cluster of SGI1 contains five antibiotic resistance genes (6-15). Variant SGI1 antibiotic resistance gene clusters have been recently reported in serovars Typhimurium DT104 and Agona containing part of the antibiotic resistance genes or an additional resistance gene (i.e., dfrA10 coding for Tm resistance) (12,15). These variant antibiotic resistance gene clusters were probably generated by recombinational events such as deletions and insertions. The serovar Albany strain of our study represents the first SGI1 example in which gene replacement took place in one of the integron structures. The dfrA1 and ORF gene cassettes found instead of aadA2 may have been introduced by homologous recombination with a class 1 integron containing the same array of gene cassettes from another bacterium (21). Another possibility is the exchange between aadA2 and the two gene cassettes, which would imply excision, mediated by the integron-encoded integrase, of aadA2 and its replacement by the other gene cassettes (22). The array of gene cassettes found in the integron of the serovar Albany strain were the same as those recently reported in integrons of V. cholerae isolated in Thailand and India (16,17). Considering the origin of the serovar Albany strain (i.e., fish exported from Thailand), a possible explanation could be the exchange of antibiotic resistance gene cassettes between epidemic multidrug-resistant V. cholerae strains and Salmonella strains from Thailand. Moreover, during the cholera-like epidemic among the Khmers in 1982, children and pregnant women were reportedly treated with trimethoprim-sulfamethoxazole (16,23). A high percentage of Khmer outbreak V. cholerae strains showed resistance to trimethoprim-sulfamethoxazole; the strains that acquired the dfrA1 gene cassette likely became predominant through selective pressure (16,24).

The multidrug-resistant V. cholerae epidemics in humans in Asia might be largely responsible for spread of antibiotic resistance genes. Recent reports describe that human colonization by V. cholerae creates a hyperinfectious bacterial state, which is perpetuated even after purging into natural aquatic reservoirs and may contribute to epidemic spread of cholera (25). These aquatic reservoirs may be an ecologic niche where antibiotic resistance gene exchange takes place between different enterobacterial pathogens. In various seawater seawater

Water that makes up the oceans and seas. Seawater is a complex mixture of 96.5% water, 2.5% salts, and small amounts of other substances. Much of the world's magnesium is recovered from seawater, as are large quantities of bromine.
 places around Hong Kong Hong Kong (hŏng kŏng), Mandarin Xianggang, special administrative region of China, formerly a British crown colony (2005 est. pop. 6,899,000), land area 422 sq mi (1,092 sq km), adjacent to Guangdong prov.  where untreated sewage is discharged, several enterobacterial pathogens were simultaneously detected such as Salmonella and V. cholerae (26).

As shown in the present study, gene replacement in the integron structures is another way to contribute to variability of the antibiotic resistance gene cluster of SGI1. SGI1 may thus serve as a vehicle of various antibiotic resistance genes in different S. enterica serovars, a situation somewhat similar to that reported for SXT constins and integrons of multidrug-resistant V. cholerae strains (16-20).
Table. Primers used for polymerase chain reaction

Primer       Gene       Amplification (a)   Size (bp)

U7-L12       thdf         Left junction        500
LJ-R1         iht
104-RJ       S044        Right junction
C9-L2        int2                              515
104-D        yidY                              500
cml01        floR             floR             494
cml15        floR
int1         intI1              A            1,135
aad          aadA2
sulTER     sul1delta            B              942
F3           floR
F4           floR               C              598
F6           tetR
tetR         tetR               D            1,559
tetA         tetA
int2      groEL-intI1           E            1,338
pse1         pse-1
pse-L        pse-1              F            4,400
MDR-B        S044

Primer   Nucleotide sequence (5'-3')

U7-L12       ACACCTTGAGCAGGGCAAG
LJ-R1       AGTTCTAAAGGTTCGTAGTCG
104-RJ      TGACGAGCTGAAGCGAATTG
C9-L2       AGCAAGTGTGCGTAATTTGG
104-D       ACCAGGGCAAAACTACACAG
cml01        TTTGGWCCGCTMTCRGAC
cml15        SGAGAARAAGACGAAGAAG
int1        GCTCTCGGGTAACATCAAGG
aad         GACCTACCAAGGCAACGCTA
sulTER       AAGGATTTCCTGACCCTG
F3          AAAGGAGCCATCAGCAGCAG
F4          TTCCTCACCTTCATCCTACC
F6           TTGGAACAGACGGCATGG
tetR        GCCGTCCCGATAAGAGAGCA
tetA        GAAGTTGCGAATGGTCTGCG
int2        TTCTGGTCTTCGTTGATGCC
pse1        CATCATTTCGCTCTGCCATT
pse-L       AATGGCAATCAGCGCTTCCC
MDR-B       GAATCCGACAGCCAACGTTCC

(a) See Figure 1.


Acknowledgments

We thank C. Mouline for expert technical assistance.

References

(1.) Hancock D, Besser T, Gay J, Rice D, Davis M, Gay C. The global epidemiology of multiresistant Salmonella enterica serovar Typhimurium DT104. In: Brown C, Bolin C, editors. Emerging diseases of animals. Washington: ASM (1) (Association for Systems Management) An international membership organization based in Cleveland, Ohio. Founded in 1947 and disbanded in 1996, it sponsored conferences in all phases of administrative systems and management.  Press; 2000. p. 217-43.

(2.) Besser TE, Goldoft M, Pritchett LC, Khakhria R, Hancock DD, Rice DH, et al. Multiresistant Salmonella Typhimurium Salmonella ty·phi·mu·ri·um
n.
A bacterium that causes food poisoning.
 DT104 infections of humans and domestic animals in the Pacific Northwest of the United States. Epidemiol Infect 2000; 124:193-200.

(3.) Davis MA, Hancock DD, Besser TE, Rice DH, Gay JM, Gay C, et al. Changes in antimicrobial resistance among Salmonella enterica serovar Typhimurium isolates from humans and cattle in the Northwestern United States Noun 1. northwestern United States - the northwestern region of the United States
Northwest

western United States, West - the region of the United States lying to the west of the Mississippi River
, 1982-1997. Emerg Infect Dis 1999;5:802-6.

(4.) Glynn MK, Bopp C, Dewitt W, Dabney P, Mokhtar M, Angulo FJ. Emergence of multidrug-resistant Salmonella enterica serotype serotype /se·ro·type/ (ser´o-tip) the type of a microorganism determined by its constituent antigens; a taxonomic subdivision based thereon.

se·ro·type
n.
See serovar.

v.
 Typhimurium DT104 infections in the United States. N Engl J Med 1998;338:1333-8.

(5.) Poppe Poppe is a surname, and may refer to:
  • Erik Poppe
  • Nils Poppe
  • Ulrike Poppe
  • Walter Poppe

This page or section lists people with the surname Poppe.
 C, Smart N, Khakhria R, Johnson W, Spika J, Prescott J. Salmonella Typhimurium DT104: a virulent and drug-resistant pathogen. Can Vet J 1998;39:559-65.

(6.) Boyd D, Peters GA, Cloeckaert A, Sidi Boumedine K, Chaslus-Dancla E, Imberechts H, et al. Complete nucleotide sequence of a 43-kilobase genomic island associated with the multidrug resistance multidrug resistance,
n the adaptation of tumor cells or infectious agents to resist chemotherapeutic agents.
 region of Salmonella enterica serovar Typhimurium DT104 and its identification in phage type DT120 and serovar Agona. J Bacteriol 2001; 183:5725-32.

(7.) Boyd DA, Peters GA, Ng LK, Mulvey MR. Partial characterization of a genomic island associated with the multidrug resistance region of Salmonella enterica Typhimurium DT104. FEMS FEMS Federation of European Microbiological Societies
FEMS Federation of European Materials Societies
FEMS Fabrication Engineering Management System
FEMS Facility Equipment Maintenance System (PMEL/TMDE) 
 Microbiol Lett 2000; 189:285-91.

(8.) Arcangioli MA, Leroy-Setrin S, Martel JL, Chaslus-Dancla E. A new chloramphenicol chloramphenicol (klōr'ămfĕn`əkŏl'), antibiotic effective against a wide range of gram-negative and gram-positive bacteria (see Gram's stain). It was originally isolated from a species of Streptomyces bacteria.  and florfenicol resistance gene flanked by two integron structures in Salmonella Typhimurium DT104. FEMS Microbiol Lett 1999; 174:327-32.

(9.) Briggs CE, Fratamico PM. Molecular characterization of an antibiotic resistance gene cluster of Salmonella Typhimurium DT104. Antimicrob Agents Chemother 1999;43:846-9.

(10.) Cloeckaert A, Schwarz S. Molecular characterization, spread and evolution of multidrug resistance in Salmonella enterica Typhimurium DT104. Vet Res 2001;32:301-10.

(11.) Bolton LF, Kelley LC, Lee MD, Fedorka-Cray P J, Maurer JJ. Detection of multi-drug resistant Salmonella enterica serotype typhimurium DT104 based on a gene which confers cross-resistance to florfenicol and chloramphenicol. J Clin Microbiol 1999;37:1348-51.

(12.) Carattoli A, Filetici E, Villa L, Dionisi AM, Ricci A, Luzzi I. Antibiotic resistance genes and Salmonella genomic island 1 in Salmonella enterica serovar Typhimurium isolated in Italy. Antimicrob Agents Chemother 2002;46:2821-8.

(13.) Cloeckaert A, Sidi Boumedine K, Flaujac G, Imberechts H, D'Hooghe I, Chaslus-Dancla E. Occurrence of a Salmonella enterica serovar Typhimurium DT104-like antibiotic resistance gene cluster including the flor gene in S. enterica serovar Agona. Antimicrob Agents Chemother 2000;44:1359-61.

(14.) Meunier D, Boyd D, Mulvey MR, Baucheron S, Mammina C, Nastasi A, et al. Salmonella enterica serotype Typhimurium DT 104 antibiotic resistance genomic island 1 in serotype Paratyphi B. Emerg Infect Dis 2002;8:430-3.

(15.) Boyd D, Cloeckaert A, Chaslus-Dancla E, Mulvey MR. Characterization of variant Salmonella genomic island 1 multidrug resistance regions from serovars Typhimurium DT104 and Agona. Antimicrob Agents Chemother 2002;46:1714-22.

(16.) Dalsgaard A, Forslund A, Serichantalergs O, Sandvang D. Distribution and content of class 1 integrons in different Vibrio cholerae O-serotype strains isolated in Thailand. Antimicrob Agents Chemother 2000;44:1315-21.

(17.) Thungapathra M, Amita, Sinha KK, Ray Chaudhuri S, Garg P, Ramamurthy T, et al. Occurrence of antibiotic resistance gene cassettes aac(6')-1b, dfrA5, dfrA12, and ereA2 in class I integrons in nonO1, non-O139 Vibrio cholerae strains in India. Antimicrob Agents Chemother 2002;46:2948-55.

(18.) Beaber JW, Hochhut B, Waldor MK. Genomic and functional analyses of SXT, an integrating antibiotic resistance gene transfer element derived from Vibrio cholerae. J Bacteriol 2002; 184:4259-69.

(19.) Hochhut B, Lofti Y, Mazel D, Faruque SM, Woodgate R, Waldor MK. Molecular analysis of antibiotic resistance gene clusters in Vibrio cholerae O139 and O1 SXT constins. Antimicrob Agents Chemother 2001;45:2991-3000.

(20.) Hochhut B, Waldor MK. Site-specific integration of the conjugal Pertaining or relating to marriage; suitable or applicable to married people.

Conjugal rights are those that are considered to be part and parcel of the state of matrimony, such as love, sex, companionship, and support.
 Vibrio cholerae SXT element into prfC. Mol Microbiol 1999;32:99-110.

(21.) Partridge SR, Collis CM, Hall RM. Class I integron containing a new gene cassette, aadA10, associated with Tn1404 from R151. Antimicrob Agents Chemother 2002;46:2400-8.

(22.) Hall RM, Collis CM. Mobile gene cassettes and integrons: capture and spread of genes by site-specific recombination. Mol Microbiol 1995; 15:593-600.

(23.) Bagchi K, Echeverria P, Arthur JD, Sethabutr O, Serichantalergs O, Hoge CW. Epidemic of diarrhea caused by Vibrio cholerae non-O1 that produced heat-stable toxin heat-stable toxin

one of two plasmid-encoded toxins produced by Escherichia coli.
 among Khmers in a camp in Thailand. J Clin Microbiol 1993;31:1315-7.

(24.) Dalsgaard A, Serichantalergs O, Pitarangsi C, Echeverria P. Molecular characterization and antibiotic susceptibility patterns of Vibrio cholerae non-O1. Epidemiol Infect 1995; 114:51-63.

(25.) Merrell DS, Butler SM, Qadri F, Dolganov NA, Alam A, Cohen cohen
 or kohen

(Hebrew: “priest”) Jewish priest descended from Zadok (a descendant of Aaron), priest at the First Temple of Jerusalem. The biblical priesthood was hereditary and male.
 MB, et al. Host-induced epidemic spread of the cholera bacterium. Nature 2002;417:642-5.

(26.) Kong RYC RYC Returned Your Call
RYC Regarding Your Comment
RYC Rainier Yacht Club (Seattle, WA) 
, Lee SKY, Law TWF TWF Television Without Frontiers
TWF Tiger Woods Foundation
TWF Two-Weapon Fighting (gaming)
TWF Test of Word Finding
TWF Twin Falls, ID, USA (Airport Code)
TWF Third World Forum
, Law SHW SHW Sherwin-Williams Company (stock symbol)
SHW Slide Show (file extension)
SHW Super Heavy Weight
SHW System High Workstation
SHW Shortest Hop Win (throughput scheme) 
, Wu RSS (Really Simple Syndication) A syndication format that was developed by Netscape in 1999 and became very popular for aggregating updates to blogs and the news sites. RSS has also stood for "Rich Site Summary" and "RDF Site Summary. . Rapid detection of six types of bacterial pathogens in marine waters by multiplex PCR. Water Res 2002;36:2802-12.

Address for correspondence: Axel Cloeckaert, Unite BioAgresseurs, Sante, Environnement, Institut National de la Recherche Agronomique “INRA” redirects here. For other uses, see INRA (disambiguation).

The Institut National de la Recherche Agronomique (INRA) is a French public research institute dedicated to scientific studies surrounding the problems of agriculture.
, 37380 Nouzilly, France; fax: (33) 2 47 42 77 74; email: cloeckae@ tours.inra.fr

Benoit Doublet dou·blet
n.
A pairing of two lenses to optically correct a chromatic and spherical aberration.
, * Renaud Lailler, ([dagger]) Daniele Meunier,* Anne Brisabois, ([dagger]) David Boyd David Boyd may refer to:
  • David Boyd (author), Canadian children's author
  • David Boyd (artist), Australian artist
  • David Boyd (cinematographer), cinematographer
, ([double dagger]) Michael R. Mulvey, ([double dagger]) Elisabeth Chaslus-Dancla, * and Axel Cloeckaert *

* Institut National de la Recherche Agronomique, Nouzilly, France; ([dagger]) Agence Francaise de Securite Sanitaire des Aliments ALIMENTS. In the Roman and French law this word signifies the food and other things necessary to the support of life, as clothing and the like. The same name is given to the money allowed for aliments. Dig. 50, 16, 43.
     2.
, Maisons-Alfort, France; and ([double dagger]) Health Canada Winnipeg, Manitoba, Canada

Mr. Doublet is a doctoral student at the Institut National de la Recherche Agronomique in France. His main interests are antibiotic resistance mechanisms and the spread of antibiotic-resistance genes in enterobacterial pathogens.
COPYRIGHT 2003 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2003, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Author:Cloeckaert, Axel
Publication:Emerging Infectious Diseases
Geographic Code:1CANA
Date:May 1, 2003
Words:4526
Previous Article:Entamoeba moshkovskii infections in children in Bangladesh. (Research).
Next Article:Emerging rickettsioses of the Thai-Myanmar border. (Dispatches).
Topics:



Related Articles
Drug-Resistant Salmonella enterica Serotype Paratyphi A in India.(Statistical Data Included)
Changes in Antimicrobial Resistance in Salmonella enterica Serovar Typhimurium.(Letter to the Editor)
Trends in Antimicrobial-Drug Resistance in Japan.
Genotypic Analysis of Multidrug-Resistant Salmonella enterica Serovar Typhi, Kenya.
Presence of Class I Integrons in Multidrug-Resistant, Low-Prevalence Salmonella Serotypes, Italy.(Statistical Data Included)
Comparative antibiotic resistance of diarrheal pathogens from Vietnam and Thailand, 1996-1999. (Research).(Statistical Data Included)
Salmonella enterica serotype Typhimurium DT104 isolated from humans, United States, 1985, 1990, and 1995. (Research).(Statistical Data Included)
Salmonella enterica serotype Typhimurium DT 104 antibiotic resistance genomic Island I in serotype Paratyphi B.
Household contamination with Salmonella enterica (1). (Dispatches).
Integrons in Salmonella Keurmassar, Senegal.(Letter to the Editor)

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles