Toscana virus in Spain.

Toscana virus (TOSV, Phlebovirus, family Bunyaviridae) infection is one of the most prevalent arboviruses in Spain. Within the objectives of a multidisciplinary network, a study on the epidemiology of TOSV was conducted in Granada, in southern Spain. The overall seroprevalence rate was 24.9%, significantly increasing with age. TOSV was detected in 3 of 103 sandfly pools by viral culture or reverse transcription--polymerase chain reaction from a region of the L gene. Nucleotide sequence homology was 99%-100% in TOSV from vectors and patients and 80%-81% compared to the Italian strain ISS Phi.3. Sequencing of the N gene of TOSV isolates from patients and vectors indicated 87%-88% and 100% homology at the nucleotide and amino acid levels, respectively, compared to the Italian strain. These findings demonstrate the circulation of at least 2 different lineages of TOSV in the Mediterranean basin the Italian lineaqe and the Spanish lineage.

**********

Within the last decade, the emergence and reemergence of arthropodbome virus (arbovirus) infections has been a health problem worldwide. West Nile virus (WNV) infection is a seasonal epidemic in North America (1). In southern Europe, WNV infections (2-4), tickborne encephalitis (5), sandfly fever Sicilian virus (SFSV), sandfly fever Naples virus (SFNV), and Toscana virus (TOSV) infections have been reported in Mediterranean countries (6,7). In Spain, a multidisciplinary network, EVITAR, has been recently created to study arthropod- and rodentborne viral diseases. One of the objectives of the network is to study TOSV infections in Spain.

TOSV (genus Phlebovirus, family Bunyaviridae) is an important agent of acute meningitis and meningoencephalitis in residents and visitors from Mediterranean countries (7-13). Aside from TOSV, other sandfly fever viruses, i.e., SFSV and SFNV, cause a brief, self-limiting febrile illness (6). Although TOSV is not normally associated with mild disease, serologic studies report high seroprevalence rates in areas of confirmed TOSV infections (7,14,15). Furthermore, a case of influenzalike illness caused by TOSV has recently been reported (16). In Spain, the first TOSV infections involving the central nervous system were reported in Granada in 1988 (7). Later, cases of TOSV infections were detected in other areas of Spain (15). Phylogenetic analysis of short polymerase chain reaction (PCR) products from the L segment showed that nucleotide sequences of TOSV isolates from Granada differ significantly from the Italian strain ISS Phl.3 (17).

TOSV was first isolated in Italy from the sandfly Phlebotomus perniciosus and later from P. perfiliewi (8,18). P. perniciosus is the most abundant anthropophilic species of Phlebotomus in Spain (19). The maximum activity of sandfly vectors for TOSV occurs during summer, along with most cases of TOSV infection (7). Vector-based TOSV surveillance is useful in reporting virus activity. It provides predictive indicators of transmission activity level associated with elevated human risk. However, no data are available on detection of TOSV from vectors in Spain.

As part of the study of TOSV infection within the aims of the EVITAR network, this work focused on 3 main objectives. First, a seroprevalence study to detect TOSV immunoglobulin G (IgG) antibodies was conducted. Second, by means of viral culture and reverse transcription (RT)-PCR, we investigated the presence of TOSV in pools ofphlebotomine sandflies. Finally, positive pools and viral isolates were phylogenetically characterized.

Materials and Methods

Prevalence Study of Anti-TOSV IgG Antibodies

Population Study for Selecting Participants

The seroprevalence study was conducted on study participants from the Granada population. Participants were retrospectively selected on the basis of demographic data and estimations of seroprevalence rates to TOSV (7,15). To evaluate differences in seroprevalence rates within Granada, the province was divided into 5 geographic areas: urban, metropolitan, south, west/southwest, and north/ northeast (Figure 1). By age groups, 20% were <18 years, 65% were 1845 years, and 15% were >65 years of age.

[FIGURE 1 OMITTED]

Serum Samples

Serum samples were collected from September to December 2003. Specimens from adults 18- to 65-years of age were collected from anonymous healthy blood donors. Specimens from persons <18 and >65 years of age were obtained from 2 laboratories in Granada from persons with noninfectious pathologic features. Only data on age, sex, and geographic area of origin were recorded from the study population. Anti-TOSV IgG was detected by a commercial enzymatic immunoassay, EIA Enzywell Toscana virus IgG (Diesse, Italy), following the manufacturer's instructions.

Investigation of TOSV in Vectors

Capture of Phlebotomine Sandflies

Phlebotomine sandflies were captured with CDC light traps (20) from June to October of 2003 and 2004. Traps were placed in 16 areas of the rural environment where the first cases of meningitis by TOSV appeared (21) (Figure 1). Sandflies were trapped after dusk until dawn. Traps were immediately transported to the laboratory to pool the individual vectors by sex and trapping area. In the 2003 season, pools of male sandflies were used for taxonomic classification, and pools of female sand flies were tested for TOSV by RT-PCR. In the 2004 season, up to 10% of individual sandflies were separated for taxonomic classification. The remaining insects were pooled by sex and trapping area and tested for TOSV by viral culture and RTPCR. Taxonomic classification of sandflies was carried out according to Gil-Collado et al. (19).

Viral Culture

Phlebotomines were introduced in vials with sterile crystal beads and 0.5 mL minimal essential medium supplemented with 20% fetal bovine serum and antimicrobial mix (0.4 mg/mL gentamicin, 0.5 mg/mL vancomycin, and 2.5 [micro]g/mL amphotericin B). Vials were vortexed and centrifuged at 13,000 rpm for 5 min. A 200-[micro]L aliquot of the supernatant was injected into tubes with African green monkey kidney cells; the remaining supematant was frozen at -80[degrees]C. The pellet with the phlebotomines was used for RT-PCR. Tube cultures were incubated at 37[degrees]C and examined daily for the appearance of cytopathic effect (CPE). Tubes with positive CPE were tested for TOSV by RT-PCR.

RT-PCR for Testing TOSV in Sandfly Pools

Viral RNA from cell cultures was extracted by using QIAamp viral RNA kit (Qiagen, Hilden, Germany), following the manufacturer's instructions. Viral RNA from sandflies was isolated by using the same kit, with minor modifications. Briefly, 500 [micro]L lysis buffer was added to the tubes containing the phlebotomine sandflies, tubes were vortexed and centrifuged at 13,000 rpm for 10 min, and 250 [micro]L of the supernatant was used for RNA extraction. A generic RT-nested-PCR method was used to detect TOSV RNA as described previously (17), which amplifies a 244-bp fragment of the L gene of phleboviruses. Sequences of the primers are shown in Table 1.

Sequencing Reactions on RT-PCR-Positive Pools

Specific TOSV detection was achieved by sequencing PCR products, as described previously (17). Briefly, PCR products were purified from a 2% low-melting-point agarose gel with the QIAquick PCR purification kit (Qiagen). Sequencing reactions were performed by using the ABI Prism Big Dye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Foster City, CA, USA) and analyzed by an ABI model 377 automated sequencer (Applied Biosystems). Two sequencing reactions were carried out on each PCR product by using the sense and antisense primers of the nested-PCR step. TOSV-specific sequences were confirmed by BLAST (basic local alignment search tool) search against GenBank databases. Sequences of the L gene from positive pools were compared with the corresponding sequence of the Italian strain ISS Phl.3 and with 1 Spanish TOSV isolate (STI) obtained previously (17) with the ClustalW Multiple Sequence Alignment program (1.82 version; European Bioinformatics Institute, Cambridge, UK).

Molecular Characterization of Spanish TOSV

To achieve a better characterization of STIs, the N gene was targeted. Sequences of the N gene of different phleboviruses were identified by BLAST search and aligned. GenBank accession numbers of the sequences were TOSV ISS Phl.3: X53794; Rift Valley fever virus (RVFV): NC 002045; SFSV: J04418; Punta Toro virus: K02736; and Uukuniemi virus (UUKV): NC 005221. Subsequently, different combinations of primers were selected to amplify 1 STI. Finally, the obtained sequence and the 1 from the Italian strain ISS Phl.3 were aligned, and specific primers were redesigned to amplify STIs recovered from sandflies and previous STIs from patients (17) (Table 1). RT-PCR conditions are available on request. Sequences were obtained and compared with the Italian strain as described above.

Phylogenetic Analysis

Phylogenetic analysis of the sequences from the partial L gene and the complete N gene was carried out with MEGA 3 program (22) by using the Kimura2-parameter model for nucleotides and amino model with Poisson correction for amino acids to calculate distances between sequences with confidence values of 1,000 bootstrapping trials. Phylogenetic trees of the L gene were constructed from TOSV obtained from sandflies and previous STIs and from different phleboviruses. Available GenBank accession numbers of the phleboviruses sequences were TOSV ISS Phl.3: X68414; RVFV: X56464; UUKV: D10759; and phlebovirus Chios-A (Chios): AY293623. Phylogenetic trees of the N gene were constructed from STI sequences obtained from sandflies and patients and from the phleboviruses sequences described above.

Statistical Analyses

To calculate the sample size for the seroprevalence study, we applied the estimation of proportions model for infinite populations. We made the following assumptions: an estimated seroprevalence of 10% in our area based on previous studies (7,15), 95% confidence level, and 5% precision level. With these premises, the minimum sample size was 139. Results were statistically analyzed with the SPSS 12.0.1. Program (SPSS, Chicago, IL, USA). Along with descriptive statistics, univariate analysis was conducted on the results obtained from the seroprevalence study by [chi square] test. A p value <0.05 was considered significant. TOSV infection rate in phlebotomine sandflies by means of RT-PCR was calculated with Pool Screen 2.0 program (23).

Results

Prevalence Study of Anti-TOSV IgG Antibodies

Anti-TOSV IgG was analyzed in 979 human serum samples. The study population was distributed by geographic area proportional to Granada's population (Table 2). By sex, 472 (48.2%) were males, and 507 (51.8%) were females. By age groups, 183 (18.7%) were <18 years, 662 (67.6%) were aged 18-65, years and 134 (13.7%) were >65 years (see Materials and Methods).

The overall prevalence of anti-TOSV IgG was 24.9% (range 9.4% in persons <15 years to 60.4% in those >65 years, p<0.001) (Table 3). No statistical differences were observed by geographic area or sex. However, when the urban area was compared with rural areas, seroprevalence rate was statistically higher in the latter group (20.6% in the urban area vs 26.7% in the rural areas; p = 0.042).

Vectors for TOSV

For taxonomic classification, 1,431 sandflies were studied, 1,286 males and 145 females. The most abundant species was P. perniciosus (68.7%), followed by Sergentomyia minuta (16.4%), P. sergenti (7.1%), P papatasi (5.7%), and P. ariasi (0.5%); 1.6% of the sandflies were classified as Phlebotomus spp.

The presence of TOSV was investigated in 103 sandfly pools, 22 pools of females in 2003 and 81 pools in 2004 (42 pools of males and 39 pools of females). Three of the 81 pools obtained in 2004 were positive for TOSV by RT-PCR (2 female and 1 male pool); 2 were also positive by cell culture. The infection rate for TOSV in phlebotomine sandflies was 0.05% (95% confidence interval 0.1-0.009).

Molecular Characterization of Spanish TOSV

Genetic Analysis of the L Gene

TOSV sequences of the L (partial) gene from vectors and that from a human STI were almost identical. At the nucleotide level, 19%-20% diversity was observed between sequences obtained from Spanish samples and those of the Italian strain, whereas the homology at the amino acid level was almost 100% (Table 4). Phylogenetic analysis yielded the same results (Figure 2). The phylogenetic tree of nucleotide sequences show 1 group containing all TOSV, in which the Spanish ones form, with a bootstrap value of 100, a different cluster. This diversity is not reflected in the amino acid sequences since both the Spanish and Italian TOSV group into a unique cluster.

[FIGURE 2 OMITTED]

Genetic Analysis of the N Gene

Nucleotide and amino acid sequence homology within the N gene was [approximately equal to] 98%-100% among STIs from vectors and patients. Compared with the Italian strain, a 100% homology at the amino acid level was observed between STIs and the Italian strain. However, nucleotide sequences showed a 12%-13% difference between the strains (Table 4). The phylogenetic tree of nucleotide sequences shows that, within the TOSV group, STIs form a different cluster. However, at the amino acid level, both STIs and Italian TOSV strain group into a unique cluster (Figure 3).

[FIGURE 3 OMITTED]

Discussion

The overall 25% seroprevalence rate found in this study is similar to the rates reported in Mediterranean areas (14,24). Other seroprevalence studies carried out in northern Europe report lower rates (13), which demonstrates that TOSV infection is endemic in Mediterranean countries. The high seroprevalence rates suggest that the diagnosis of TOSV infection is frequently missed since most cases are mild, as occurs with SFSV and SFNV infections (6), a severe illness involving the central nervous system develops in only a few patients. The increasing seroprevalence rates concurrent with age demonstrate that the Granada population is exposed to TOSV throughout life. Thus, a study on outpatients attending primary care services is necessary to assess the role of TOSV in human disease.

TOSV was first isolated from P perniciosus in Italy (8). Although, the sandflies used in this study for detecting TOSV were not used for taxonomic classification, [approximately equal to] 70% of captured insects were P perniciosus, which suggests that this species is the main vector for TOSV in our area. Furthermore, P perniciosus accounted for 50%-90% of the sandflies captured in the area where TOSV-positive pools were detected. The rest were classified as S. minuta, P. sergenti, and P papatasi, none of which are known vectors for TOSV.

TOSV was detected in 3 of 103 pools. By using the Pool Screen 2.0 program (23), an infection rate of 0.05% was obtained in the sandflies, which is much lower than the infection rate of 0.2% reported in Italy (25), where more cases of TOSV infection have been recorded (11,26). The fact that the seroprevalence rate is similar to the rates reported in Italy, another endemic area, and that the virus infection rate in sandflies is much lower, could be due to increased exposure to the vector, as occurs in our area, which is mainly rural.

To investigate the genetic relationship of TOSV detected in sandfly pools with the Italian strain and STIs recovered previously, sequence analysis of a fragment of the L gene and the complete N gene was performed. Similar results were obtained with both regions of the genome. Nucleotide and amino acid sequence homology of TOSV from vectors and patients was [approximately equal to] 100%. The differences between TOSV (from vectors and patients) and the Italian strain within the nucleotide sequences indicate that at least 2 lineages of TOSV, Italian and Spanish, are circulating. These changes are synonymous because almost identical amino acid sequences were found in all analyzed TOSV. This finding suggests that, at least within these regions of TOSV genome, constraints against amino acid changes exist. This fact has already been described with RVFV isolates from different areas (27).

Despite the high seroprevalence rates found in this study, fewer cases of severe disease caused by TOSV occur in our area (21) than in other countries (11). A possible explanation for this could be that Spanish TOSV are less neurovirulent than the Italian. Whether changes in other parts of the genome, such as the noncoding regions, affect the neurovirulence of this virus, as described for tickborne encephalitis virus (28), needs to be investigated.

The finding of this new lineage of TOSV was not an isolated event. Nucleotide sequences of TOSV from sandflies collected during 2003-2004 were almost identical to those obtained from patients from 1988 to 2002. The genetic diversity between STIs and the Italian strain could be partially explained by vector characteristics. Two lineages of P. perniciosus have been reported (29), the typical lineage found in Morocco, Tunisia, Malta, and Italy, and the Iberian lineage. These lineages remain isolated because sandflies move in short hops, flying no more than a few hundred meters from their resting places.

As occurs with WNV, for which several lineages have been reported, the last in central Europe (30), more lineages of TOSV may circulate in other areas. To assess this possibility, further investigation would be necessary. Moreover, sequencing of the S segment of a TOSV isolate recently described in southern France showed 87% and 100% homology with the reference strain within nucleotide and peptide sequences, respectively (31). Although GenBank accession for this sequence is not yet available, this isolate could belong to the Spanish TOSV lineage since differences between this isolate and the Italian strain are similar to the differences that we found in our isolates.

In conclusion, the study and surveillance of arbovirus infections should be considered worldwide since they may cause emergent diseases, many of which may be life-threatening. One part of this study should focus on the vectors and host spectrum of these viruses to control transmission to humans.

Acknowledgments

We thank Maria del Mar Rodriguez del Aguila for helping in the statistical analysis of data, Joaquina Martin Sanchez for her participation in the study of vectors, and Charles R. Katholi for providing the Pool Screen 2.0 program to detect TOSV infection rate in phlebotomine sandflies.

Grant sponsor was Red EVITAR, Fondo de Investigaciones Sanitarias, Spanish Ministry of Health, grant no. G03/059. Ximena Collao has a research grant from Valparaiso University (MECESUP project, Chile). The study of vectors, i.e., capture of phlebotomines and taxonomic classification, was supported by the Junta de Andalucia, research grant CVI 176.

References

(1.) West Nile virus. Division of vector-borne infectious diseases. Centers for Disease Control and Prevention, 2005 [cited 2005 Feb 3]. Available from http://www.cdc.gov/ncidod/dvbid/westnile

(2.) Hubalek Z, Halouzka J. West Nile fever--a reemerging mosquitoborne viral disease in Europe. Emerg Infect Dis. 1999;5:643-50.

(3.) Mailles A, Dellamonica P, Zeller H, Durand JP, Zientara S, Goffette R, et al. Human and equine West Nile virus infections in France, August-September 2003. Eurosurveillance Weekly 2003; 7 [cited 2005 Mar 22]. Available from http://www.eurosurveillance.org/ ew/2003/031023.asp

(4.) Connell J, McKeown P, Garvey P, Cotter S, Conway A, O'Flanagan D, et al. Two linked cases of West Nile virus (WNV) acquired by Irish tourists in the Algarve, Portugal. Eurosurveillance Weekly 2004; 8 [cited 2005 Mar 22]. Available from http://www.eurosurveillanee. org/ew/2004/040805.asp

(5.) Stefanoff P, Eidson M, Morse DL, Ziellinski A. Evaluation of tickborne encephalitis classification in Polland. Eurosurveillance Weekly 2005; 10 [cited 2005 Mar 22]. Available from http://www.eurosurveillance, org/em/v10n01/1001-225.asp

(6.) Nicoletti L, Ciufolini MG, Verani P. Sandfly fever viruses in Italy. Arch Virol. 1996;11:41-7.

(7.) Mendoza-Montero J, Gamez-Rueda MI, Navarro-Mari JM, Rosa-Fraile M, Oyonarte-Gomez S. Infections due to sandfly fever virus serotype Toscana in Spain. Clin Infect Dis. 1998;27:434-6.

(8.) Verani P, Nicoletti L, Ciufolini MG. Antigenic and biological characterization of Toscana virus, a new Phlebotomus fever group virus isolated in Italy. Acta Virol. 1984;28:39-47.

(9.) Ehrnst A, Peters C J, Niklasson B, Svedmyr A, Holmgren B. Neurovirulent Toscana virus (a sandfly fever virus) in Swedish man after a visit to Portugal. Lancet. 1985;1:1212-3.

(10.) Calisher CH, Weinberg A, Muth D J, Lazuick JS. Toscana virus infection in United States citizen returning from Italy. Lancet. 1987;17:165-6.

(11.) Nicoletti L, Verani P, Cacioli S, Ciufolini MG, Renzi A, Bartolozzi D, et al. Central nervous system involvement during infection by Phlebovirus Toscana of residents in natural foci in central Italy (1977-1988). Am J Trop Med Hyg. 1991;45:429-34.

(12.) Eitrem R, Niklasson B, Weiland O. Sandfly fever among Swedish tourists. Scand J Infect Dis. 1991;23:451-7.

(13.) Schwarz TF, Jager S, Gilch S, Pauli C. Serosurvey and laboratory diagnosis of imported sandfly fever virus, serotype Toscana, infection in Germany. Epidemiol Infect. 1995;114:501-10.

(14.) Valassina M, Valentini M, Pugliese A, Valensin PE, Cusi MG. Serological survey of Toscana virus infections in a high-risk population in Italy. Clin Diagn Lab Immunol. 2003; 10:483-4.

(15.) Echevarria JM, de Ory F, Guisasola ME, Sanchez-Seco MP, Tenorio A, Lozano A, et al. Acute meningitis due to Toscana virus infection among patients from the Spanish Mediterranean region and the region of Madrid. J Clin Virol. 2003;26:79-84.

(16.) Hemmersbach-Miller M, Parola P, Charrel RN, Durand P, Brouqui P. Sandfly fever due to Toscana virus: an emerging infection in southern France. Eur J Intern Med. 2004;15:316-7.

(17.) Sanchez-Seco MP, Echevarria JM, Hernandez L, Estevez D, Navarro-Marl JM, Tenorio A. Detection and identification of Toscana and other Phleboviruses by RT-nested-PCR assays with degenerated primers. J Meal Virol. 2003;71:140-9.

(18.) Verani P, Lopes MC, Nicoletti L, Balducci M. Studies on phlebotomus-transmitted viruses in Italy. Isolation and characterization of a sandfly fever Naples-like virus. In: Vesenjak-Hirjan J, Porterfield JS, Arslanagic E, editors. Arboviruses in the Mediterranean countries. Stuttgart: Gustav Fischer Verlag; 1980. p. 195-201.

(19.) Gil-Collado J, Morillas-Marquez F, Sanchis-Marin MC. Los flebotomos en Espana. Revista de Sanidad e Higiene Publica. 1989;63:15-34.

(20.) McNelly JR. The CDC trap as a special monitoring tool. Proceedings 76th meeting. NJ Mosquito Control Association, Inc. 1989:26-33. [cited 2005 Jan 12]. Available from http://www.rci.rutgers.edu/~insects/cdctrap.htm

(21.) Navarro JM, Fernandez-Roldan C, Perez-Ruiz M, Sanbonmatsu S, de la Rosa M, Sanchez-Seco MP. Meningitis by Toscana virus in Spain: clinical description of 17 cases. Med Clin (Barc). 2004; 122:420-2.

(22.) Kumar K, Tamura K, Nei M. MEGA 3: Integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Brief Bioinform. 2004;5:150-63.

(23.) Katholi CR, Toe L, Merriweather A, Unnasch TR. Determining the prevalence of Onchocerca volvulus infection in vector populations by polymerase chain reaction screening of pools of black flies. J Infect Dis. 1995;172:1414-7.

(24.) Eitrem R, Stylianou M, Niklasson B. High prevalence rates of antibody to three sandfly fever viruses (Sicilian, Naples and Toscana) among Cypriots. Epidemiol Infect. 1991;107:685-91.

(25.) Verani P, Ciufolini MG, Caciolli S, Renzi A, Nicoletti L, Sabatinelli G, et al. Ecology of viruses isolated from sand flies in Italy and characterized of a new Phlebovirus (Arbia virus). Am J Trop Med Hyg. 1988;38:433-9.

(26.) Valassina M, Cuppone AM, Bianchi S, Santini L, Cusi MG. Evidence of Toscana virus variants circulating in Tuscany, Italy, during the summers of 1995 to 1997. J Clin Microbiol. 1998;36:2103-4.

(27.) Shoemaker T, Boulianne C, Vincent MJ, Pezzanite L, Al-Qahtani MM, Al-Mazrou et al. Genetic analysis of viruses associated with emergence of Rift Valley fever in Saudi Arabia and Yemen, 2000-01. Emerg Infect Dis. 2002; 12:1415-20.

(28.) Mandl CW. Steps of the tick-borne encephalitis virus replication cycle that affect neuropathogenesis. Virus Res. 2005; 111:161-74.

(29.) Pesson B, Ready JS, Benabdennbi I, Martin Sanchez J, Esseghir S, Cadi-Soussi M, et al. Sandflies of the Phlebotomus perniciosus complex: mitochondrial introgression and a new sibling species of P. longicuspis in the Moroccan Rif. Med Vet Entomol. 2004;18:25-37.

(30.) Bakonyi T, Hubalek Z, Rudolf I, Nowotny N. Novel flavivirus or new lineage of West Nile virus, central Europe. Emerg Infect Dis. 2005; 11:225-31.

(31.) Peyrefitte CN, Devetakov I, Pastorino B, Villeneuve L, Bessaud M, Stolidi P, et al. Toscana virus and acute meningitis, France. Emerg Infect Dis. 2005;11:778-80.

Sara Sanbonmatsu-Gamez, * (1) Mercedes Perez-Ruiz, * (1) Ximena Collao, ([dagger]) Maria Paz Sanchez-Seco, ([dagger]) Francisco Morillas-Marquez, ([double dagger]) Manuel de la Rosa-Fraile, * Jose Maria Navarro-Mari, * and Antonio Tenorio ([dagger])

* Hospital Universitario Virgen de las Nieves, Granada, Spain; ([dagger]) Instituto de Salud Carlos III, Madrid, Spain; and ([double dagger]) Universidad de Granada, Granada, Spain

(1) Contributed equally to this work.

Dr Sanbonmatsu-Gamez is a microbiologist on a fellowship from the EVITAR network (Fondo de Investigaciones Sanitarias, Spanish Ministry of Health; grant no. G03/059). Her research interest focuses on viral infectious diseases, especially arthropodborne viral diseases.

Address for correspondence: Mercedes Perez Ruiz, Servicio de Microbiologia, Hospital Universitario Virgen de las Nieves, Avda. Fuerzas Armadas, s/n 18014-Granada, Spain; fax: [phone]; email: [e-mail]

Table 1. Primers used for RT-PCR amplification of the L (partial) gene
and the N gene of TOSV *

Primer                         Sequence

NPhlebo1+    5' [sub.2047]ATGGARGGITTTGTIWSICIIC[C.sub.2069] 3'
NPhlebo1-   5' [sub.2600]AARTTRCTIGWIGCYTTIARIGTIG[C.sub.2575] 3'
NPhlebo2+     5' [sub.2074]WTICCIAAICCIYMSAARAT[G.sub.2094] 3'
NPhlebo2-     5' [sub.2318]TCYTCYTTRTTYTTRARRTARC[C.sub.2296] 3'
TosS1+          5' [sub.4]CAGAGATTCCCGTGTATTAAA[C.sub.25] 3'
TosS1-        5' [sub.1052]GAGTGCTGCCAAGTCTTATGA[C.sub.1031] 3'
TosS2+        5' [sub.4]CAGAGATTCCCGTGTATTAAACAAAAG[C.sub.31] 3'
TosS2-        5' [sub.1004]TAGAGAAACTGCTCTTTCCAC[C.sub.983] 3'

Primer          PCR

NPhlebo1+   L gene-1st
NPhlebo1-   L gene-1st
NPhlebo2+   L gene-2nd
NPhlebo2-   L gene-2nd
TosS1+      N gene-1st
TosS1-      N gene-1st
TosS2+      N gene-2nd
TosS2-      N gene-2nd

* RT-PCR, reverse transcription-polymerase chain reaction;
TOSV, Toscana virus.

Table 2. Demographic data of Granada population and distribution of
the study population by geographic areas

                           Granada population

Area                Total, n (%)            Males, n (%)

Urban              240,522 (29.2)           111,774 (46)
Metropolitan       227,994 (27.6)           114,836 (50)
South              157,803 (19.1)            78,871 (50
West/Southwest      70,397 (8.5)             35,429 (50)
North/Northeast    128,299 (15.6)            64,214 (50)
Total              825,015 (100)            405,124 (49)

                           Granada population

Area               Females, n (%)      Study population, n (%)

Urban               128,748 (54)             287 (29.3)
Metropolitan        113,158 (50)             282 (28.8)
South                78,932 (50)             146 (14.9)
West/Southwest       34,968 (50)              72 (7.4)
North/Northeast      64,085 (50)             192 (19.6)
Total               419,891 (51)             979 (100)

Table 3. Results of prevalence study of anti-TOSV immunoglobulin
G, Granada

Area               <15 y, no. (pos)     15-40 y, no. (pos)

Urban                   52 (2)               141 (22)
Metropolitan            51 (7)               127 (24)
South                   34 (3)                76 (14)
West/Southwest           3 (0)                40 (7)
North/Northeast         19 (3)                71 (15)
Total               159 (15, 9.4%)         455 (82, 18%)

Area              41-65 y, no. (pos)     >65 y, no. (pos)

Urban                   60 (20)               34 (15)
Metropolitan            62 (18)               42 (28)
South                   54 (12)               28 (19)
West/Southwest          20 (10)                9 (6)
North/Northeast         35 (6)                21 (13)
Total               231 (66, 28.6%)       134 (81, 60.4%)

Area                      No                  Pos (%)

Urban                     287                59 (20.6)
Metropolitan              282                77 (27.3)
South                     192                48 (25.0)
West/Southwest            72                 23 (31.9)
North/Northeast           146                37 (25.3)
Total                     979               244 (24.9)

* TOSV, Toscana virus; pos, positives.

Table 4. Homology of nucleotide and deduced amino acid sequences of
L (partial) gene and complete N gene in Toscana viruses from Spain and
the Italian strain ISS Phl.3 *

L gene         STI1    ISS Phl.3     GR40      GR41

nt
  ISS Phl.3    0.199
  GR40         0.010     0.199
  GR41         0.015     0.185       0.026
  GR79         0.010     0.205       0.020     0.015
aa
  ISS Phl.3    0.015
  GR40         0.015     0.030
  GR41         0.000     0.015       0.015
  GR79         0.000     0.015       0.015     0.000

N gene         STI1      STI2      ISS Phl.3   STI6    GR40

nt
  STI2         0.020
  ISS Phl.3    0.116     0.123
  ST16         0.005     0.017       0.118
  GR40         0.015     0.016       0.123     0.012
  GR41         0.020     0.021       0.130     0.017
aa
  STI2         0.000
  ISS Phl.3    0.000     0.000
  STI6         0.000     0.000       0.000
  GR40         0.000     0.000       0.000     0.000
  GR41         0.000     0.000       0.000     0.000   0.000

* GR40, GR41, and GR79: TOSV obtained from pools of sandflies, STI1,
STI2, and STI6: Spanish Toscana virus isolates recovered from patients
in previous studies (17), ISS Phl.3: Italian TOSV strain (GenBank
accession no. X68414 [L gene] and X5379 4 [N gene]); nt, nucleotides;
aa, amino acids.