Toscana virus in Spain.Toscana virus (TOSV TOSV Toscana Virus , Phlebovirus, family Bunyaviridae) infection is one of the most prevalent arboviruses arboviruses (ar´bōvī´r n. in Spain. Within the objectives of a multidisciplinary network, a study on the epidemiology of TOSV was conducted in Granada, in southern Spain. The overall seroprevalence seroprevalence Immunology The proportion of a population that is seropositive–ie, has been exposed to a particular pathogen or immunogen; the seropositivity of a population is calculated as the number of individuals who produce a particular antibody divided rate was 24.9%, significantly increasing with age. TOSV was detected in 3 of 103 sandfly sandfly /sand·fly/ (sand´fli) any of various two-winged flies, especially of the genus Phlebotomus. sandfly Phlebotomus spp. Culicoides, Simulium and Austrosimulium spp. pools by viral culture viral culture A test in which a specimen–eg, throat swab, sputum, stool, CSF, urine, from a Pt is placed in live cells; various viruses–eg, adenovirus, enterovirus, herpes simplex, measles, mumps, myxovirus, paramyxovirus, rhinovirus, rubella, or reverse transcription--polymerase chain reaction from a region of the L gene. Nucleotide sequence homology homology (hōmŏl`əjē), in biology, the correspondence between structures of different species that is attributable to their evolutionary descent from a common ancestor. was 99%-100% in TOSV from vectors and patients and 80%-81% compared to the Italian strain ISS ISS See Institutional Shareholder Services (ISS). Phi.3. Sequencing of the N gene of TOSV isolates from patients and vectors indicated 87%-88% and 100% homology at the nucleotide and amino acid amino acid (əmē`nō), any one of a class of simple organic compounds containing carbon, hydrogen, oxygen, nitrogen, and in certain cases sulfur. These compounds are the building blocks of proteins. levels, respectively, compared to the Italian strain. These findings demonstrate the circulation of at least 2 different lineages of TOSV in the Mediterranean basin The Mediterranean Basin refers to the lands around and surrounded by the Mediterranean Sea. In biogeography, the Mediterranean Basin refers to the lands around the Mediterranean Sea that have a Mediterranean climate, with mild, rainy winters and hot, dry summers, which the Italian lineaqe and the Spanish lineage. ********** Within the last decade, the emergence and reemergence of arthropodbome virus (arbovirus arbovirus Any of a large group of viruses that develop in arthropods (chiefly mosquitoes and ticks). The name derives from “arthropod-borne virus.” The spheroidal virus particle is encased in a fatty membrane and contains RNA; it causes no apparent harm to the ) infections has been a health problem worldwide. West Nile virus West Nile virus, microorganism and the infection resulting from it, which typically produces no symptoms or a flulike condition. The virus is a flavivirus and is related to a number of viruses that cause encephalitis. (WNV WNV West Nile Virus WNV World Net Visions ) infection is a seasonal epidemic in North America (1). In southern Europe, WNV infections (2-4), tickborne encephalitis encephalitis (ĕnsĕf'əlī`təs), general term used to describe a diffuse inflammation of the brain and spinal cord, usually of viral origin, often transmitted by mosquitoes, in contrast to a bacterial infection of the meninges (5), sandfly fever sand·fly fever n. See phlebotomus fever. Sicilian virus (SFSV SFSV San Francisco School Volunteers (California) ), sandfly fever Naples virus (SFNV), and Toscana virus (TOSV) infections have been reported in Mediterranean countries (6,7). In Spain, a multidisciplinary network, EVITAR, has been recently created to study arthropod- and rodentborne viral diseases. One of the objectives of the network is to study TOSV infections in Spain. TOSV (genus Phlebovirus, family Bunyaviridae) is an important agent of acute meningitis and meningoencephalitis meningoencephalitis /me·nin·go·en·ceph·a·li·tis/ (me-ning?go-en-sef?ah-li´tis) inflammation of the brain and meninges. toxoplasmic meningoencephalitis in residents and visitors from Mediterranean countries (7-13). Aside from TOSV, other sandfly fever viruses, i.e., SFSV and SFNV, cause a brief, self-limiting febrile febrile /feb·rile/ (feb´ril) pertaining to or characterized by fever. feb·rile adj. Of, relating to, or characterized by fever; feverish. illness (6). Although TOSV is not normally associated with mild disease, serologic se·rol·o·gy n. pl. se·rol·o·gies 1. The science that deals with the properties and reactions of serums, especially blood serum. 2. studies report high seroprevalence rates seroprevalence rates (sir´ōprev´- n. in areas of confirmed TOSV infections (7,14,15). Furthermore, a case of influenzalike illness caused by TOSV has recently been reported (16). In Spain, the first TOSV infections involving the central nervous system were reported in Granada in 1988 (7). Later, cases of TOSV infections were detected in other areas of Spain (15). Phylogenetic phy·lo·ge·net·ic adj. 1. Of or relating to phylogeny or phylogenetics. 2. Relating to or based on evolutionary development or history. analysis of short polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is (PCR PCR polymerase chain reaction. PCR abbr. polymerase chain reaction Polymerase chain reaction (PCR) ) products from the L segment showed that nucleotide sequences of TOSV isolates from Granada differ significantly from the Italian strain ISS Phl.3 (17). TOSV was first isolated in Italy from the sandfly Phlebotomus perniciosus and later from P. perfiliewi (8,18). P. perniciosus is the most abundant anthropophilic species of Phlebotomus in Spain (19). The maximum activity of sandfly vectors for TOSV occurs during summer, along with most cases of TOSV infection (7). Vector-based TOSV surveillance is useful in reporting virus activity. It provides predictive indicators of transmission activity level associated with elevated human risk. However, no data are available on detection of TOSV from vectors in Spain. As part of the study of TOSV infection within the aims of the EVITAR network, this work focused on 3 main objectives. First, a seroprevalence study to detect TOSV immunoglobulin G immunoglobulin G n. Abbr. IgG The most abundant class of antibodies found in blood serum and lymph and active against bacteria, fungi, viruses, and foreign particles. Immunoglobulin G antibodies trigger action of the complement system. (IgG) antibodies was conducted. Second, by means of viral culture and reverse transcription reverse transcription n. The process by which DNA is synthesized from an RNA template. (RT)-PCR, we investigated the presence of TOSV in pools ofphlebotomine sandflies. Finally, positive pools and viral isolates were phylogenetically phy·lo·ge·net·ic adj. 1. Of or relating to phylogeny or phylogenetics. 2. Relating to or based on evolutionary development or history: a phylogenetic classification of species. characterized. Materials and Methods Prevalence Study of Anti-TOSV IgG Antibodies Population Study for Selecting Participants The seroprevalence study was conducted on study participants from the Granada population. Participants were retrospectively selected on the basis of demographic data and estimations of seroprevalence rates to TOSV (7,15). To evaluate differences in seroprevalence rates within Granada, the province was divided into 5 geographic areas: urban, metropolitan, south, west/southwest, and north/ northeast (Figure 1). By age groups, 20% were <18 years, 65% were 1845 years, and 15% were >65 years of age. [FIGURE 1 OMITTED] Serum Samples Serum samples were collected from September to December 2003. Specimens from adults 18- to 65-years of age were collected from anonymous healthy blood donors. Specimens from persons <18 and >65 years of age were obtained from 2 laboratories in Granada from persons with noninfectious pathologic features. Only data on age, sex, and geographic area of origin were recorded from the study population. Anti-TOSV IgG was detected by a commercial enzymatic immunoassay Immunoassay An assay that quantifies antigen or antibody by immunochemical means. The antigen can be a relatively simple substance such as a drug, or a complex one such as a protein or a virus. , EIA (Electronic Industries Alliance, Arlington, VA, www.eia.org) A membership organization founded in 1924 as the Radio Manufacturing Association. It sets standards for consumer products and electronic components. Enzywell Toscana virus IgG (Diesse, Italy), following the manufacturer's instructions. Investigation of TOSV in Vectors Capture of Phlebotomine Sandflies Phlebotomine sandflies were captured with CDC See Control Data, century date change and Back Orifice. CDC - Control Data Corporation light traps (20) from June to October of 2003 and 2004. Traps were placed in 16 areas of the rural environment where the first cases of meningitis by TOSV appeared (21) (Figure 1). Sandflies were trapped after dusk until dawn. Traps were immediately transported to the laboratory to pool the individual vectors by sex and trapping area. In the 2003 season, pools of male sandflies were used for taxonomic classification, and pools of female sand flies were tested for TOSV by RT-PCR RT-PCR reverse transcriptase-polymerase chain reaction. See PCR1. . In the 2004 season, up to 10% of individual sandflies were separated for taxonomic classification. The remaining insects were pooled by sex and trapping area and tested for TOSV by viral culture and RTPCR RTPCR Reverse Transcriptase Polymerase Chain Reaction . Taxonomic classification of sandflies was carried out according to Gil-Collado et al. (19). Viral Culture Phlebotomines were introduced in vials with sterile crystal beads and 0.5 mL minimal essential medium supplemented with 20% fetal bovine serum Fetal bovine serum ( or foetal bovine serum) is serum taken from the fetuses of cows. Fetal Bovine Serum (or FBS) is the most widely used serum in the culturing of cells. In some papers the expression foetal calf serum is used. and antimicrobial mix (0.4 mg/mL gentamicin gentamicin /gen·ta·mi·cin/ (jen?tah-mi´sin) an aminoglycoside antibiotic complex isolated from bacteria of the genus Micromonospora, , 0.5 mg/mL vancomycin vancomycin (văn'kōmī`sĭn), antibiotic resembling penicillin in the way it acts. It is derived from the bacterium Streptomyces orientalis, which was isolated from soil of India and Indonesia. , and 2.5 [micro]g/mL amphotericin B amphotericin B (ăm'fətĕr`ĭsĭn), antibiotic that halts the growth of several disease-causing fungi. Discovered in 1956, it is produced by bacteria of the genus Streptomyces. ). Vials were vortexed and centrifuged at 13,000 rpm for 5 min. A 200-[micro]L aliquot aliquot (al-ee-kwoh) adj. a definite fractional share, usually applied when dividing and distributing a dead person's estate or trust assets. (See: share) of the supernatant supernatant /su·per·na·tant/ (-na´tant) the liquid lying above a layer of precipitated insoluble material. supernatant the liquid lying above a layer of precipitated insoluble material. was injected into tubes with African green monkey kidney cells; the remaining supematant was frozen at -80[degrees]C. The pellet with the phlebotomines was used for RT-PCR. Tube cultures were incubated at 37[degrees]C and examined daily for the appearance of cytopathic effect (CPE (Customer Premises Equipment) Communications equipment that resides on the customer's premises. CPE - Customer Premises Equipment ). Tubes with positive CPE were tested for TOSV by RT-PCR. RT-PCR for Testing TOSV in Sandfly Pools Viral RNA RNA: see nucleic acid. RNA in full ribonucleic acid One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic from cell cultures was extracted by using QIAamp viral RNA kit (Qiagen, Hilden, Germany), following the manufacturer's instructions. Viral RNA from sandflies was isolated by using the same kit, with minor modifications. Briefly, 500 [micro]L lysis buffer was added to the tubes containing the phlebotomine sandflies, tubes were vortexed and centrifuged at 13,000 rpm for 10 min, and 250 [micro]L of the supernatant was used for RNA extraction. A generic RT-nested-PCR method was used to detect TOSV RNA as described previously (17), which amplifies a 244-bp fragment of the L gene of phleboviruses. Sequences of the primers are shown in Table 1. Sequencing Reactions on RT-PCR-Positive Pools Specific TOSV detection was achieved by sequencing PCR products, as described previously (17). Briefly, PCR products were purified from a 2% low-melting-point agarose agarose more highly purified form of agar with similar uses to agar and widely used in the separation of nucleic acid fragments. gel with the QIAquick PCR purification kit (Qiagen). Sequencing reactions were performed by using the ABI Abi (ā`bī) [short for Abijah], in the Bible, King Hezekiah's mother. (Application Binary Interface) A specification for a specific hardware platform combined with the operating system. Prism Big Dye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Foster City, CA, USA) and analyzed by an ABI model 377 automated sequencer See MIDI sequencer. (music) sequencer - Any system for recording and/or playback of music via a programmable memory which stores music not as audio data, but as some representation of notes. (Applied Biosystems). Two sequencing reactions were carried out on each PCR product by using the sense and antisense antisense, DNA or RNA manipulated in a laboratory so that its components (nucleotides) form a complementary copy of normal, or "sense," messenger RNA (mRNA; see nucleic acid). primers of the nested-PCR step. TOSV-specific sequences were confirmed by BLAST (basic local alignment search tool) search against GenBank databases. Sequences of the L gene from positive pools were compared with the corresponding sequence of the Italian strain ISS Phl.3 and with 1 Spanish TOSV isolate (STI STI systolic time intervals. ) obtained previously (17) with the ClustalW Multiple Sequence Alignment A multiple sequence alignment (MSA) is a sequence alignment of three or more biological sequences, generally protein, DNA, or RNA. In general, the input set of query sequences are assumed to have an evolutionary relationship by which they share a lineage and are descended from a program (1.82 version; European Bioinformatics Institute The European Bioinformatics Institute (EBI) is a centre for research and services in bioinformatics, and is part of European Molecular Biology Laboratory (EMBL). It is a pioneer of novel and developmental bioinformatics research. , Cambridge, UK). Molecular Characterization of Spanish TOSV To achieve a better characterization of STIs, the N gene was targeted. Sequences of the N gene of different phleboviruses were identified by BLAST search and aligned. GenBank accession numbers of the sequences were TOSV ISS Phl.3: X53794; Rift Valley fever Rift Valley fever An arthropod-borne (primarily mosquito), acute, febrile, viral disease of humans and numerous species of animals. Rift Valley fever is caused by a ribonucleic acid (RNA) virus in the genus Phlebovirus of the family Bunyaviridae. virus (RVFV RVFV Rift Valley Fever Virus ): NC 002045; SFSV: J04418; Punta Toro Toro may refer to:
Phylogenetic Analysis Phylogenetic analysis of the sequences from the partial L gene and the complete N gene was carried out with MEGA 3 program (22) by using the Kimura2-parameter model for nucleotides and amino model with Poisson correction for amino acids to calculate distances between sequences with confidence values of 1,000 bootstrapping Bootstrapping A procedure used to calculate the zero coupon yield curve from market figures. Notes: Since the T-bills offered by the government are not available for every time period, the bootstrapping method is used to fill in the missing figures in order to derive the trials. Phylogenetic trees of the L gene were constructed from TOSV obtained from sandflies and previous STIs and from different phleboviruses. Available GenBank accession numbers of the phleboviruses sequences were TOSV ISS Phl.3: X68414; RVFV: X56464; UUKV: D10759; and phlebovirus Chios-A (Chios): AY293623. Phylogenetic trees of the N gene were constructed from STI sequences obtained from sandflies and patients and from the phleboviruses sequences described above. Statistical Analyses To calculate the sample size for the seroprevalence study, we applied the estimation of proportions model for infinite populations. We made the following assumptions: an estimated seroprevalence of 10% in our area based on previous studies (7,15), 95% confidence level, and 5% precision level. With these premises, the minimum sample size was 139. Results were statistically analyzed with the SPSS A statistical package from SPSS, Inc., Chicago (www.spss.com) that runs on PCs, most mainframes and minis and is used extensively in marketing research. It provides over 50 statistical processes, including regression analysis, correlation and analysis of variance. 12.0.1. Program (SPSS, Chicago, IL, USA). Along with descriptive statistics descriptive statistics see statistics. , univariate analysis was conducted on the results obtained from the seroprevalence study by [chi square chi square (kī), n a nonparametric statistic used with discrete data in the form of frequency count (nominal data) or percentages or proportions that can be reduced to frequencies. ] test. A p value <0.05 was considered significant. TOSV infection rate in phlebotomine sandflies by means of RT-PCR was calculated with Pool Screen 2.0 program (23). Results Prevalence Study of Anti-TOSV IgG Antibodies Anti-TOSV IgG was analyzed in 979 human serum samples. The study population was distributed by geographic area proportional to Granada's population (Table 2). By sex, 472 (48.2%) were males, and 507 (51.8%) were females. By age groups, 183 (18.7%) were <18 years, 662 (67.6%) were aged 18-65, years and 134 (13.7%) were >65 years (see Materials and Methods). The overall prevalence of anti-TOSV IgG was 24.9% (range 9.4% in persons <15 years to 60.4% in those >65 years, p<0.001) (Table 3). No statistical differences were observed by geographic area or sex. However, when the urban area was compared with rural areas, seroprevalence rate was statistically higher in the latter group (20.6% in the urban area vs 26.7% in the rural areas; p = 0.042). Vectors for TOSV For taxonomic classification, 1,431 sandflies were studied, 1,286 males and 145 females. The most abundant species was P. perniciosus (68.7%), followed by Sergentomyia minuta (16.4%), P. sergenti (7.1%), P papatasi (5.7%), and P. ariasi (0.5%); 1.6% of the sandflies were classified as Phlebotomus spp. The presence of TOSV was investigated in 103 sandfly pools, 22 pools of females in 2003 and 81 pools in 2004 (42 pools of males and 39 pools of females). Three of the 81 pools obtained in 2004 were positive for TOSV by RT-PCR (2 female and 1 male pool); 2 were also positive by cell culture. The infection rate for TOSV in phlebotomine sandflies was 0.05% (95% confidence interval confidence interval, n a statistical device used to determine the range within which an acceptable datum would fall. Confidence intervals are usually expressed in percentages, typically 95% or 99%. 0.1-0.009). Molecular Characterization of Spanish TOSV Genetic Analysis of the L Gene TOSV sequences of the L (partial) gene from vectors and that from a human STI were almost identical. At the nucleotide level, 19%-20% diversity was observed between sequences obtained from Spanish samples and those of the Italian strain, whereas the homology at the amino acid level was almost 100% (Table 4). Phylogenetic analysis yielded the same results (Figure 2). The phylogenetic tree of nucleotide sequences show 1 group containing all TOSV, in which the Spanish ones form, with a bootstrap See boot. (operating system, compiler) bootstrap - To load and initialise the operating system on a computer. Normally abbreviated to "boot". From the curious expression "to pull oneself up by one's bootstraps", one of the legendary feats of Baron von Munchhausen. value of 100, a different cluster. This diversity is not reflected in the amino acid sequences since both the Spanish and Italian TOSV group into a unique cluster. [FIGURE 2 OMITTED] Genetic Analysis of the N Gene Nucleotide and amino acid sequence homology within the N gene was [approximately equal to] 98%-100% among STIs from vectors and patients. Compared with the Italian strain, a 100% homology at the amino acid level was observed between STIs and the Italian strain. However, nucleotide sequences showed a 12%-13% difference between the strains (Table 4). The phylogenetic tree of nucleotide sequences shows that, within the TOSV group, STIs form a different cluster. However, at the amino acid level, both STIs and Italian TOSV strain group into a unique cluster (Figure 3). [FIGURE 3 OMITTED] Discussion The overall 25% seroprevalence rate found in this study is similar to the rates reported in Mediterranean areas (14,24). Other seroprevalence studies carried out in northern Europe report lower rates (13), which demonstrates that TOSV infection is endemic in Mediterranean countries. The high seroprevalence rates suggest that the diagnosis of TOSV infection is frequently missed since most cases are mild, as occurs with SFSV and SFNV infections (6), a severe illness involving the central nervous system develops in only a few patients. The increasing seroprevalence rates concurrent with age demonstrate that the Granada population is exposed to TOSV throughout life. Thus, a study on outpatients attending primary care services is necessary to assess the role of TOSV in human disease. TOSV was first isolated from P perniciosus in Italy (8). Although, the sandflies used in this study for detecting TOSV were not used for taxonomic classification, [approximately equal to] 70% of captured insects were P perniciosus, which suggests that this species is the main vector for TOSV in our area. Furthermore, P perniciosus accounted for 50%-90% of the sandflies captured in the area where TOSV-positive pools were detected. The rest were classified as S. minuta, P. sergenti, and P papatasi, none of which are known vectors for TOSV. TOSV was detected in 3 of 103 pools. By using the Pool Screen 2.0 program (23), an infection rate of 0.05% was obtained in the sandflies, which is much lower than the infection rate of 0.2% reported in Italy (25), where more cases of TOSV infection have been recorded (11,26). The fact that the seroprevalence rate is similar to the rates reported in Italy, another endemic area Endemic area A geographical region where a particular disease is prevalent. Mentioned in: Leprosy, Scrub Typhus , and that the virus infection rate in sandflies is much lower, could be due to increased exposure to the vector, as occurs in our area, which is mainly rural. To investigate the genetic relationship of TOSV detected in sandfly pools with the Italian strain and STIs recovered previously, sequence analysis of a fragment of the L gene and the complete N gene was performed. Similar results were obtained with both regions of the genome. Nucleotide and amino acid sequence homology of TOSV from vectors and patients was [approximately equal to] 100%. The differences between TOSV (from vectors and patients) and the Italian strain within the nucleotide sequences indicate that at least 2 lineages of TOSV, Italian and Spanish, are circulating. These changes are synonymous because almost identical amino acid sequences were found in all analyzed TOSV. This finding suggests that, at least within these regions of TOSV genome, constraints against amino acid changes exist. This fact has already been described with RVFV isolates from different areas (27). Despite the high seroprevalence rates found in this study, fewer cases of severe disease caused by TOSV occur in our area (21) than in other countries (11). A possible explanation for this could be that Spanish TOSV are less neurovirulent than the Italian. Whether changes in other parts of the genome, such as the noncoding regions, affect the neurovirulence of this virus, as described for tickborne encephalitis virus (28), needs to be investigated. The finding of this new lineage of TOSV was not an isolated event. Nucleotide sequences of TOSV from sandflies collected during 2003-2004 were almost identical to those obtained from patients from 1988 to 2002. The genetic diversity between STIs and the Italian strain could be partially explained by vector characteristics. Two lineages of P. perniciosus have been reported (29), the typical lineage found in Morocco, Tunisia, Malta, and Italy, and the Iberian lineage. These lineages remain isolated because sandflies move in short hops, flying no more than a few hundred meters from their resting places. As occurs with WNV, for which several lineages have been reported, the last in central Europe (30), more lineages of TOSV may circulate in other areas. To assess this possibility, further investigation would be necessary. Moreover, sequencing of the S segment of a TOSV isolate recently described in southern France showed 87% and 100% homology with the reference strain within nucleotide and peptide sequences, respectively (31). Although GenBank accession for this sequence is not yet available, this isolate could belong to the Spanish TOSV lineage since differences between this isolate and the Italian strain are similar to the differences that we found in our isolates. In conclusion, the study and surveillance of arbovirus infections should be considered worldwide since they may cause emergent diseases, many of which may be life-threatening. One part of this study should focus on the vectors and host spectrum of these viruses to control transmission to humans. Acknowledgments We thank Maria del Mar Maria del Mar is the name of two Canadian entertainment personalities, who are sometimes confused with each other. Maria del Mar (rock singer) was the lead singer of goth rock band National Velvet in the late 1980s and early 1990s. Rodriguez del Aguila for helping in the statistical analysis of data, Joaquina Martin Sanchez for her participation in the study of vectors, and Charles R. Katholi for providing the Pool Screen 2.0 program to detect TOSV infection rate in phlebotomine sandflies. Grant sponsor was Red EVITAR, Fondo de Investigaciones Sanitarias, Spanish Ministry of Health, grant no. G03/059. Ximena Collao has a research grant from Valparaiso University (MECESUP project, Chile). The study of vectors, i.e., capture of phlebotomines and taxonomic classification, was supported by the Junta de Andalucia, research grant CVI CVI C (Language) Virtual Instrument CVI Clinical and Vaccine Immunology (journal) CVI Chronic Venous Insufficiency CVI Coastal Vulnerability Index CVI Canaan Valley Institute 176. References (1.) West Nile virus. Division of vector-borne infectious diseases. Centers for Disease Control and Prevention Centers for Disease Control and Prevention (CDC), agency of the U.S. Public Health Service since 1973, with headquarters in Atlanta; it was established in 1946 as the Communicable Disease Center. , 2005 [cited 2005 Feb 3]. Available from http://www.cdc.gov/ncidod/dvbid/westnile (2.) Hubalek Z, Halouzka J. West Nile fever--a reemerging mosquitoborne viral disease in Europe. Emerg Infect Dis. 1999;5:643-50. (3.) Mailles A, Dellamonica P, Zeller H, Durand JP, Zientara S, Goffette R, et al. Human and equine West Nile virus infections in France, August-September 2003. Eurosurveillance Weekly 2003; 7 [cited 2005 Mar 22]. Available from http://www.eurosurveillance.org/ ew/2003/031023.asp (4.) Connell J, McKeown P, Garvey P, Cotter S, Conway A, O'Flanagan D, et al. Two linked cases of West Nile virus (WNV) acquired by Irish tourists in the Algarve, Portugal. Eurosurveillance Weekly 2004; 8 [cited 2005 Mar 22]. Available from http://www.eurosurveillanee. org/ew/2004/040805.asp (5.) Stefanoff P, Eidson M, Morse DL, Ziellinski A. Evaluation of tickborne encephalitis classification in Polland. Eurosurveillance Weekly 2005; 10 [cited 2005 Mar 22]. Available from http://www.eurosurveillance, org/em/v10n01/1001-225.asp (6.) Nicoletti L, Ciufolini MG, Verani P. Sandfly fever viruses in Italy. Arch Virol. 1996;11:41-7. (7.) Mendoza-Montero J, Gamez-Rueda MI, Navarro-Mari JM, Rosa-Fraile M, Oyonarte-Gomez S. Infections due to sandfly fever virus serotype serotype /se·ro·type/ (ser´o-tip) the type of a microorganism determined by its constituent antigens; a taxonomic subdivision based thereon. se·ro·type n. See serovar. v. Toscana in Spain. Clin Infect Dis. 1998;27:434-6. (8.) Verani P, Nicoletti L, Ciufolini MG. Antigenic and biological characterization of Toscana virus, a new Phlebotomus fever phlebotomus fever n. An infectious but not contagious denguelike disease occurring in the Balkan Peninsula and other parts of southern Europe, caused by an arbovirus introduced by the bite of the sand fly Phlebotomus papatasi. group virus isolated in Italy. Acta Virol. 1984;28:39-47. (9.) Ehrnst A, Peters C J, Niklasson B, Svedmyr A, Holmgren B. Neurovirulent Toscana virus (a sandfly fever virus) in Swedish man after a visit to Portugal. Lancet. 1985;1:1212-3. (10.) Calisher CH, Weinberg A, Muth D J, Lazuick JS. Toscana virus infection in United States citizen returning from Italy. Lancet. 1987;17:165-6. (11.) Nicoletti L, Verani P, Cacioli S, Ciufolini MG, Renzi A, Bartolozzi D, et al. Central nervous system involvement during infection by Phlebovirus Toscana of residents in natural foci in central Italy (1977-1988). Am J Trop Med Hyg. 1991;45:429-34. (12.) Eitrem R, Niklasson B, Weiland O. Sandfly fever among Swedish tourists. Scand J Infect Dis. 1991;23:451-7. (13.) Schwarz TF, Jager S, Gilch S, Pauli C. Serosurvey and laboratory diagnosis of imported sandfly fever virus, serotype Toscana, infection in Germany. Epidemiol Infect. 1995;114:501-10. (14.) Valassina M, Valentini M, Pugliese A, Valensin PE, Cusi MG. Serological serological pertaining to or emanating from serology. serological test one involving examination of blood serum usually for antibody. survey of Toscana virus infections in a high-risk population in Italy. Clin Diagn Lab Immunol. 2003; 10:483-4. (15.) Echevarria JM, de Ory F, Guisasola ME, Sanchez-Seco MP, Tenorio A, Lozano A, et al. Acute meningitis due to Toscana virus infection among patients from the Spanish Mediterranean region and the region of Madrid. J Clin Virol. 2003;26:79-84. (16.) Hemmersbach-Miller M, Parola P, Charrel RN, Durand P, Brouqui P. Sandfly fever due to Toscana virus: an emerging infection in southern France. Eur J Intern Med. 2004;15:316-7. (17.) Sanchez-Seco MP, Echevarria JM, Hernandez L, Estevez D, Navarro-Marl JM, Tenorio A. Detection and identification of Toscana and other Phleboviruses by RT-nested-PCR assays with degenerated primers. J Meal Virol. 2003;71:140-9. (18.) Verani P, Lopes MC, Nicoletti L, Balducci M. Studies on phlebotomus-transmitted viruses in Italy. Isolation and characterization of a sandfly fever Naples-like virus. In: Vesenjak-Hirjan J, Porterfield JS, Arslanagic E, editors. Arboviruses in the Mediterranean countries. Stuttgart: Gustav Fischer Verlag; 1980. p. 195-201. (19.) Gil-Collado J, Morillas-Marquez F, Sanchis-Marin MC. Los flebotomos en Espana. Revista de Sanidad e Higiene Publica. 1989;63:15-34. (20.) McNelly JR. The CDC trap as a special monitoring tool. Proceedings 76th meeting. NJ Mosquito Control Association, Inc. 1989:26-33. [cited 2005 Jan 12]. Available from http://www.rci.rutgers.edu/~insects/cdctrap.htm (21.) Navarro JM, Fernandez-Roldan C, Perez-Ruiz M, Sanbonmatsu S, de la Rosa De La Rosa is a surname in the Spanish language meaning of the Rose
(22.) Kumar K, Tamura K, Nei M. MEGA 3: Integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Brief Bioinform. 2004;5:150-63. (23.) Katholi CR, Toe L, Merriweather A, Unnasch TR. Determining the prevalence of Onchocerca volvulus volvulus /vol·vu·lus/ (vol´vu-lus) [L.] torsion of a loop of intestine, causing obstruction. vol·vu·lus n. Abnormal twisting of the intestine causing obstruction. infection in vector populations by polymerase chain reaction screening of pools of black flies. J Infect Dis. 1995;172:1414-7. (24.) Eitrem R, Stylianou M, Niklasson B. High prevalence rates of antibody to three sandfly fever viruses (Sicilian, Naples and Toscana) among Cypriots. Epidemiol Infect. 1991;107:685-91. (25.) Verani P, Ciufolini MG, Caciolli S, Renzi A, Nicoletti L, Sabatinelli G, et al. Ecology of viruses isolated from sand flies in Italy and characterized of a new Phlebovirus (Arbia virus). Am J Trop Med Hyg. 1988;38:433-9. (26.) Valassina M, Cuppone AM, Bianchi S, Santini L, Cusi MG. Evidence of Toscana virus variants circulating in Tuscany, Italy, during the summers of 1995 to 1997. J Clin Microbiol. 1998;36:2103-4. (27.) Shoemaker T, Boulianne C, Vincent MJ, Pezzanite L, Al-Qahtani MM, Al-Mazrou et al. Genetic analysis of viruses associated with emergence of Rift Valley fever in Saudi Arabia and Yemen, 2000-01. Emerg Infect Dis. 2002; 12:1415-20. (28.) Mandl CW. Steps of the tick-borne encephalitis virus tick-borne encephalitis virus n. An arbovirus of the genus Flavivirus that occurs in two subtypes, Central European and Eastern, causing two forms of encephalitis; it is transmitted by ticks. replication cycle that affect neuropathogenesis. Virus Res. 2005; 111:161-74. (29.) Pesson B, Ready JS, Benabdennbi I, Martin Sanchez J, Esseghir S, Cadi-Soussi M, et al. Sandflies of the Phlebotomus perniciosus complex: mitochondrial mitochondrial pertaining to mitochondria. mitochondrial RNAs a unique set of tRNAs, mRNAs, rRNAs, transcribed from mitochondrial DNA by a mitochondrial-specific RNA polymerase, that account for about 4% of the total cell RNA that introgression in·tro·gres·sion n. Infiltration of the genes of one species into the gene pool of another through repeated backcrossing of an interspecific hybrid with one of its parents. and a new sibling species of P. longicuspis in the Moroccan Rif. Med Vet Entomol. 2004;18:25-37. (30.) Bakonyi T, Hubalek Z, Rudolf I, Nowotny N. Novel flavivirus or new lineage of West Nile virus, central Europe. Emerg Infect Dis. 2005; 11:225-31. (31.) Peyrefitte CN, Devetakov I, Pastorino B, Villeneuve L, Bessaud M, Stolidi P, et al. Toscana virus and acute meningitis, France. Emerg Infect Dis. 2005;11:778-80. Sara Sanbonmatsu-Gamez, * (1) Mercedes Perez-Ruiz, * (1) Ximena Collao, ([dagger]) Maria Paz Sanchez-Seco, ([dagger]) Francisco Morillas-Marquez, ([double dagger]) Manuel de la Rosa-Fraile, * Jose Maria Navarro-Mari, * and Antonio Tenorio ([dagger]) * Hospital Universitario Virgen de las Nieves, Granada, Spain; ([dagger]) Instituto de Salud Carlos III, Madrid, Spain; and ([double dagger]) Universidad de Granada, Granada, Spain (1) Contributed equally to this work. Dr Sanbonmatsu-Gamez is a microbiologist on a fellowship from the EVITAR network (Fondo de Investigaciones Sanitarias, Spanish Ministry of Health; grant no. G03/059). Her research interest focuses on viral infectious diseases, especially arthropodborne viral diseases. Address for correspondence: Mercedes Perez Ruiz, Servicio de Microbiologia, Hospital Universitario Virgen de las Nieves, Avda. Fuerzas Armadas, s/n 18014-Granada, Spain; fax: 34-958-020-169; email: mercedes.perez.ruiz.sspa@juntadeandalucia.es
Table 1. Primers used for RT-PCR amplification of the L (partial) gene
and the N gene of TOSV *
Primer Sequence
NPhlebo1+ 5' [sub.2047]ATGGARGGITTTGTIWSICIIC[C.sub.2069] 3'
NPhlebo1- 5' [sub.2600]AARTTRCTIGWIGCYTTIARIGTIG[C.sub.2575] 3'
NPhlebo2+ 5' [sub.2074]WTICCIAAICCIYMSAARAT[G.sub.2094] 3'
NPhlebo2- 5' [sub.2318]TCYTCYTTRTTYTTRARRTARC[C.sub.2296] 3'
TosS1+ 5' [sub.4]CAGAGATTCCCGTGTATTAAA[C.sub.25] 3'
TosS1- 5' [sub.1052]GAGTGCTGCCAAGTCTTATGA[C.sub.1031] 3'
TosS2+ 5' [sub.4]CAGAGATTCCCGTGTATTAAACAAAAG[C.sub.31] 3'
TosS2- 5' [sub.1004]TAGAGAAACTGCTCTTTCCAC[C.sub.983] 3'
Primer PCR
NPhlebo1+ L gene-1st
NPhlebo1- L gene-1st
NPhlebo2+ L gene-2nd
NPhlebo2- L gene-2nd
TosS1+ N gene-1st
TosS1- N gene-1st
TosS2+ N gene-2nd
TosS2- N gene-2nd
* RT-PCR, reverse transcription-polymerase chain reaction;
TOSV, Toscana virus.
Table 2. Demographic data of Granada population and distribution of
the study population by geographic areas
Granada population
Area Total, n (%) Males, n (%)
Urban 240,522 (29.2) 111,774 (46)
Metropolitan 227,994 (27.6) 114,836 (50)
South 157,803 (19.1) 78,871 (50
West/Southwest 70,397 (8.5) 35,429 (50)
North/Northeast 128,299 (15.6) 64,214 (50)
Total 825,015 (100) 405,124 (49)
Granada population
Area Females, n (%) Study population, n (%)
Urban 128,748 (54) 287 (29.3)
Metropolitan 113,158 (50) 282 (28.8)
South 78,932 (50) 146 (14.9)
West/Southwest 34,968 (50) 72 (7.4)
North/Northeast 64,085 (50) 192 (19.6)
Total 419,891 (51) 979 (100)
Table 3. Results of prevalence study of anti-TOSV immunoglobulin
G, Granada
Area <15 y, no. (pos) 15-40 y, no. (pos)
Urban 52 (2) 141 (22)
Metropolitan 51 (7) 127 (24)
South 34 (3) 76 (14)
West/Southwest 3 (0) 40 (7)
North/Northeast 19 (3) 71 (15)
Total 159 (15, 9.4%) 455 (82, 18%)
Area 41-65 y, no. (pos) >65 y, no. (pos)
Urban 60 (20) 34 (15)
Metropolitan 62 (18) 42 (28)
South 54 (12) 28 (19)
West/Southwest 20 (10) 9 (6)
North/Northeast 35 (6) 21 (13)
Total 231 (66, 28.6%) 134 (81, 60.4%)
Area No Pos (%)
Urban 287 59 (20.6)
Metropolitan 282 77 (27.3)
South 192 48 (25.0)
West/Southwest 72 23 (31.9)
North/Northeast 146 37 (25.3)
Total 979 244 (24.9)
* TOSV, Toscana virus; pos, positives.
Table 4. Homology of nucleotide and deduced amino acid sequences of
L (partial) gene and complete N gene in Toscana viruses from Spain and
the Italian strain ISS Phl.3 *
L gene STI1 ISS Phl.3 GR40 GR41
nt
ISS Phl.3 0.199
GR40 0.010 0.199
GR41 0.015 0.185 0.026
GR79 0.010 0.205 0.020 0.015
aa
ISS Phl.3 0.015
GR40 0.015 0.030
GR41 0.000 0.015 0.015
GR79 0.000 0.015 0.015 0.000
N gene STI1 STI2 ISS Phl.3 STI6 GR40
nt
STI2 0.020
ISS Phl.3 0.116 0.123
ST16 0.005 0.017 0.118
GR40 0.015 0.016 0.123 0.012
GR41 0.020 0.021 0.130 0.017
aa
STI2 0.000
ISS Phl.3 0.000 0.000
STI6 0.000 0.000 0.000
GR40 0.000 0.000 0.000 0.000
GR41 0.000 0.000 0.000 0.000 0.000
* GR40, GR41, and GR79: TOSV obtained from pools of sandflies, STI1,
STI2, and STI6: Spanish Toscana virus isolates recovered from patients
in previous studies (17), ISS Phl.3: Italian TOSV strain (GenBank
accession no. X68414 [L gene] and X5379 4 [N gene]); nt, nucleotides;
aa, amino acids.
|
|
||||||||||||||||||||

Printer friendly
Cite/link
Email
Feedback
Reader Opinion