Printer Friendly
The Free Library
14,457,069 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Tickborne relapsing fever diagnosis obscured by Malaria, Togo.


Given the prevalence of relapsing fever relapsing fever

Infectious disease with recurring fever, caused by several spirochetes of the genus Borrelia, transmitted by lice, ticks, and bedbugs. Onset is sudden, with high fever, which breaks within a week with profuse sweating. Symptoms return about a week later.
 (RF) in Senegal, this disease may cause illness and death in other areas of West Africa West Africa

A region of western Africa between the Sahara Desert and the Gulf of Guinea. It was largely controlled by colonial powers until the 20th century.



West African adj. & n.
. We performed a cross-sectional, clinic-based study to investigate the presence of RF in Togo during 2002-2004. Blood samples from patients with fever were examined for RF spirochetes by microscopy, PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
, and DNA sequencing DNA sequencing

The determination of the sequence of nucleotides in a sample of DNA.
 of amplicons and for antibodies to the glycerophosphodiester phosphodiesterase phosphodiesterase /phos·pho·di·es·ter·ase/ (-di-es´ter-as) any of a group of enzymes that catalyze the hydrolytic cleavage of an ester linkage in a phosphoric acid compound containing two such ester linkages.  antigen. Although no spirochetes were seen in blood smears, [approximately equal to] 10% of the patients were positive by PCR and [approximately equal to] 13% were seropositive seropositive /se·ro·pos·i·tive/ (-poz´i-tiv) showing positive results on serological examination; showing a high level of antibody.

se·ro·pos·i·tive
adj.
 for spirochetes. DNA sequencing demonstrated that Borrelia Borrelia

A genus of spirochetes that have a unique genome composed of a linear chromosome and numerous linear and circular plasmids. Borreliae are motile, helical organisms with 4–30 uneven, irregular coils, and are 5–25 micrometers long and 0.
 crocidurae and B. duttonfi were present. Most patients were treated for malaria whether or not plasmodia were observed. Thus, many RF patients originally had a misdiagnosis mis·di·ag·no·sis
n. pl. mis·di·ag·no·ses
An incorrect diagnosis.



mis·diag·nose
 of malaria, which resulted in ineffective treatment. The inability of microscopic analysis to detect spirochetes compared with PCR demonstrates the need for tests with greater sensitivit.

**********

Spirochetes of the genus Borrelia Noun 1. genus Borrelia - small flexible parasitic spirochetes having three to five wavy spirals
bacteria genus - a genus of bacteria

family Treponemataceae, Treponemataceae - small spirochetes some parasitic or pathogenic

borrelia - cause of e.g.
 are known to cause 2 major types of human disease, Lyme disease Lyme disease, a nonfatal bacterial infection that causes symptoms ranging from fever and headache to a painful swelling of the joints. The first American case of Lyme's characteristic rash was documented in 1970 and the disease was first identified in a cluster at , which occurs primarily in temperate regions, and relapsing fever (RF), which occurs in both temperate and tropical regions. Many vertebrates serve as enzootic en·zo·ot·ic
adj.
Prevalent among or restricted to animals of a specific geographic area. Used of a disease.

n.
An enzootic disease.



enzootic

peculiar to or present constantly in a location. See also endemic.
 hosts for the bacteria, and borreliosis is related to climatic and other environmental parameters required for the vectors and reservoir hosts (1,2). Borrelia-related disease is endemic in tropical and subtropical sub·trop·i·cal  
adj.
Of, relating to, or being the geographic areas adjacent to the Tropics.


subtropical
Adjective

of the region lying between the tropics and temperate lands

 regions; B. hermsii and B. turicatae cause tick-borne RF (TBRF) in North America North America, third largest continent (1990 est. pop. 365,000,000), c.9,400,000 sq mi (24,346,000 sq km), the northern of the two continents of the Western Hemisphere. . In Europe, TBRF is uncommon; B. hispanica is the causative agent in Spain, Portugal, Greece, and Cyprus (3,4).

TBRF in Africa is caused primarily by B. duttonii, which is transmitted by Ornithodoros moubata ticks in East and Central Africa, and by B. crocidurae, which is transmitted by O. sonrai in West Africa. Humans are the only known vertebrate host for B. duttonii. B. crocidurae is maintained in enzootic cycles in rodents and other small mammals. African TBRF is associated with proximity to tick-infested burrows and huts (4-6).

The primary clinical manifestations of RF are recurrent high fever interrupted by afebrile afebrile /afe·brile/ (a-feb´ril) without fever.

a·feb·rile
adj.
Apyretic.



afebrile

without fever.

afebrile adjective Feverless
 periods, hepatomegaly hepatomegaly /hep·a·to·meg·a·ly/ (hep?ah-to-meg´ah-le) enlargement of the liver.

hep·a·to·meg·a·ly
n.
The abnormal enlargement of the liver. Also called megalohepatia.
, splenomegaly splenomegaly /sple·no·meg·a·ly/ (-meg´ah-le) enlargement of the spleen.

congestive splenomegaly  Banti's disease; splenomegaly secondary to portal hypertension.
, and anemia. These signs are similar to those of malaria. The fever peaks are associated with high spirochetemias, and antigenic variation Antigenic variation is the process by which an infectious organism alters its surface proteins in order to evade a host immune response. This change in antigenic profile may occur as the pathogen passes through a host population (also called "antigenic diversity") or may take place  leads to new antigenic variants of a major surface protein and the recurrence of high numbers of borreliae in the blood (7-10). When patients have high fever, spirochetes may achieve sufficiently high cell densities in the blood to be observed directly by microscopy when wet mounts of blood or Giemsa-stained blood smears are examined. Between peaks, the bacteria are too scarce to be visualized in the blood. Treatment with various antimicrobial drugs is effective (5,6); however, borreliae may rapidly invade the brain, and infection of the central nervous system may persist if not treated or if treated with antimicrobial drugs that do not readily penetrate the blood-brain barrier blood-brain barrier
n. Abbr. BBB
A physiological mechanism that alters the permeability of brain capillaries so that some substances, such as certain drugs, are prevented from entering brain tissue, while other substances are allowed to
 (5).

Research on RF in Africa has been limited, and little is known regarding the presence and geographic distribution of the spirochetes and tick vectors. Studies in Senegal indicate that RF is widely distributed Adj. 1. widely distributed - growing or occurring in many parts of the world; "a cosmopolitan herb"; "cosmopolitan in distribution"
cosmopolitan

bionomics, environmental science, ecology - the branch of biology concerned with the relations between organisms
 and prevalent in this country; investigators speculate that RF may cause illness in rural areas throughout much of West Africa (11). A 2-year prospective investigation in a rural community in the Senegalese savanna savanna or savannah (both: səvăn`ə), tropical or subtropical grassland lying on the margin of the trade wind belts.  showed that 10% of the study population became infected during the study period, resulting in an incidence of 5.1% (12). A recent 14-year longitudinal study longitudinal study

a chronological study in epidemiology which attempts to establish a relationship between an antecedent cause and a subsequent effect. See also cohort study.
 demonstrated an average TBRF incidence of 11/100 person-years in Delmo, Senegal, and suggested that TBRF is a common cause of fever in most rural areas of Senegal as well as in some regions of Mauritania Mauritania is divided into 12 regions (capitals in parentheses) and one capital district:
  1. Adrar (Atar)
  2. Assaba (Kiffa)
  3. Brakna (Aleg)
  4. Dakhlet Nouadhibou (Nouadhibou)
  5. Gorgol (Kaédi)
  6. Guidimaka (Sélibaby)
  7. Hodh Ech Chargui (Néma)
 and Mali (13). In other areas of West Africa, where RF has not been identified, the disease is generally not considered in the diagnosis when patients have a fever.

We hypothesized that RF caused by B. crocidurae may be present in other areas of West Africa where the climate and environment are similar to that of Senegal. However, because of the lack of knowledge, diagnostics, and the high prevalence of malaria in these areas, RF remains undetected (14). Therefore, we conducted a study in Togo to determine if patients with fever might have RF. The study included examination of blood by direct microscopy, molecular methods, and serologic se·rol·o·gy  
n. pl. se·rol·o·gies
1. The science that deals with the properties and reactions of serums, especially blood serum.

2.
 analysis.

Methods

Setting

Clinics participating in the study were located in the northern dry savannah Savannah, city, United States
Savannah, city (1990 pop. 137,560), seat of Chatham co., SE Ga., a port of entry on the Savannah River near its mouth; inc. 1789.
 and the southern tropical high plateau of Togo. The clinics were at the children's hospital, Hopital d'Enfants, in Dapaong (urban/semiurban) in northern Togo and rural clinics in southern Togo, including the Centre Medico-Social de Sodo in Sodo, Hopital Bethesda, Agou Clinic in the Agou area, and the general hospital in Kpalime, a town with [approximately equal to] 50,000 inhabitants
:This article is about the video game. For Inhabitants of housing, see Residency
Inhabitants is an independently developed commercial puzzle game created by S+F Software. Details
The game is based loosely on the concepts from SameGame.
 (Figure).

[FIGURE OMITTED]

Participants

Interviews and sampling were conducted from March 2002 through September 2004; sampling was performed from August through October in 2003 and 2004 in northern and southern Togo, respectively. Trained laboratory personnel in various clinics obtained blood samples, conducted interviews, and performed microscopic analyses. A total of 244 persons with fever were randomly selected; 14 persons without fever were included as controls.

Procedures

A questionnaire that contained information on demography, living conditions such as building materials that may be favorable for nesting ticks and rodents, and occupation was used in interviews. Axillary ax·il·lar·y
n.
Relating to the axilla.


Axillary
Located in or near the armpit.

Mentioned in: Mastectomy


axillary

of or pertaining to the armpit.
 temperature of each patient with fever was measured. Blood was collected from the arm by venipuncture venipuncture /veni·punc·ture/ (ven?i-pungk´chur) surgical puncture of a vein.

ve·ni·punc·ture or ve·ne·punc·ture
n.
 or from a finger by lancet stick and applied to glass microscope slides. Thick and thin blood smears were stained with Giemsa and analyzed by microscopy at a magnification of 1,000x for plasmodia and at 400x for spirochetes. Microscopic examination for spirochetes was used at the clinics to enable diagnosis on site by the method routinely used in Senegal (14,15). Approximately 300 fields were examined to detect malaria parasites and borreliae. For malaria diagnosis, samples were examined for trophozoites and gametocytes. Blood and serum samples were stored at -20[degrees]C and shipped frozen to Sweden for further testing.

Plasmid Cloning and Protein Expression

Genomic DNA from B. crocidurae was used as a template for amplification of the glycerophosphodiester phosphodiesterase (glpQ) gene and subsequent sequence analysis (Table 1). The PCR amplification product was digested with BamHI and XhoI and cloned into the pET15b vector (Novagen, Madison, WI, USA) as previously described (16). The resulting recombinant plasmid was transformed into the Rosetta strain of Escherichia coli Escherichia coli (ĕsh'ərĭk`ēə kō`lī), common bacterium that normally inhabits the intestinal tracts of humans and animals, but can cause infection in other parts of the body, especially the urinary tract. . The heterologously produced histidine histidine (hĭs`tĭdēn), organic compound, one of the 22 α-amino acids commonly found in animal proteins. Only the l-stereoisomer appears in mammalian protein.  (His)--tagged GlpQ fusion protein was purified by using Ni-NTA spin columns (Qiagen, Valencia, CA, USA), and the protein concentration was determined with Bradford assay (Bio-Rad Laboratories, Hercules, CA, USA).

ELISA ELISA (e-li´sah) Enzyme-Linked Immuno-Sorbent Assay; any enzyme immunoassay using an enzyme-labeled immunoreactant and an immunosorbent.

ELISA
n.
 with Recombinant GIpQ Protein

An ELISA was used to detect anti-GlpQ immunoglobulin G immunoglobulin G
n. Abbr. IgG
The most abundant class of antibodies found in blood serum and lymph and active against bacteria, fungi, viruses, and foreign particles. Immunoglobulin G antibodies trigger action of the complement system.
 (IgG) antibodies in patient sera and was performed as described by Porcella et al. (16). Briefly, His-GlpQ protein was adsorbed onto microtiter well surfaces of Ni-NTA HisSorb plates (Qiagen). Wells were blocked with diluent diluent /dil·u·ent/ (dil´oo-int)
1. causing dilution.

2. an agent that dilutes or renders less potent or irritant.


dil·u·ent
adj.
Serving to dilute.

n.
 to inhibit nonspecific nonspecific /non·spe·cif·ic/ (non?spi-sif´ik)
1. not due to any single known cause.

2. not directed against a particular agent, but rather having a general effect.


nonspecific

1.
 binding and washed. Serum samples were tested at a 1:100 dilution by incubating 100 [micro]L/well for 1 h at room temperature. After 3 washes, 100 [micro]L of a 1:2,500 dilution of goat anti-human IgG (heavy and light chains) conjugated conjugated
adj.
Conjugate.


estrogens, conjugated Warning - Hazardous drug!

C.E.S.
 to horseradish peroxidase horse·rad·ish peroxidase
n.
An enzyme used in immunohistochemistry to label the antigen-antibody complex.
 (Kirkegaard and Perry Laboratories, Gaithersburg, MD, USA) was added to each well and incubated for 1 h. After 3 washes, 50% 2,2'-azino-di-(3-ethyl-benzthiazoline sulfonate sul·fo·nate
n.
A salt or ester of sulfonic acid.

v.
1. To introduce one or more sulfonic acid groups into an organic compound.

2. To treat with sulfonic acid.
) substrate was added and incubated for 25 min before analysis at 405 nm with a Multiskan microtiter plate reader (Labsystems, Vantaa, Finland). Each serum sample was tested in triplicate, and the mean absorbance absorbance /ab·sor·bance/ (-sor´bans)
1. in analytical chemistry, a measure of the light that a solution does not transmit compared to a pure solution. Symbol .

2.
 value was determined. Samples were considered positive if their mean absorbance was greater than the mean plus 3 standard deviations of the absorbance of control sera tested at the same dilution. Serum samples from Ethiopian patients with RF were included as positive controls (16).

Blood Screening by Nested PCR

Blood samples that were positive or borderline positive by ELISA were tested by a nested PCR for Borrelia DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
. DNA was purified from the blood samples and 4 primers (Table 1) were used for detection of the 16S rRNA gene of borreliae. The first PCR amplified a 584-bp region of the gene with the primers Nested_1_F--Nested_1_R. The second PCR amplified a 498-bp region with the primers Nested_2_F--Nested_2_R. The amplicons obtained from the nested PCRs were sequenced to identify the Borrelia species because the primers were not able to amplify DNA from specific species of RF spirochetes.

PCR and Sequencing

For amplification of the complete coding sequence cod·ing sequence
n.
See exon.
 of glpQ gene from B. duttonii, 2 primers were designed by using B. hermsii noncoding sequences flanking the glpQ gene and 4 primers were designed by using sequences within the gene (Table 1). Nested PCR primers (Table 1) were designed to target the 16S rRNA gene. The PCR product for the B. duttonii glpQ gene was sequenced, and data were deposited in GenBank (accession no. DQ909058).

Ethics

The study was approved by the Ethics Committee ethics committee A multidisciplinary hospital body composed of a broad spectrum of personnel–eg, physicians, nurses, social workers, priests, and others, which addresses the moral and ethical issues within the hospital. See DNR, Institutional review board.  at Umea University (Dnr 04-050 M). Informed consent was obtained at clinics from all patients or from the accompanying parent if the patient was a child.

Statistical Analysis

Proportions were compared with a 2-tailed [chi square chi square (kī),
n a nonparametric statistic used with discrete data in the form of frequency count (nominal data) or percentages or proportions that can be reduced to frequencies.
]-corrected (Yates) analysis and Fisher exact test. p values <0.05 were considered significant.

Results

No patients were positive for borreliae by microscopic examination of Giemsa-stained blood smears. Among patients with fever, 9 (10%) of 90 children in northern Togo, and 5 (9.8%) of 51 children and 16 (16.3%) of 98 adults in southern Togo were seropositive by ELISA. A total of 12.6% of patients with fever were positive by ELISA (Table 2). For those patients without fever, 2 (14.3%) of 14 were seropositive. Because the glpQ gene is present in RF spirochetes but not in Lyme disease spirochetes, the positive serologic results strongly suggest that patients were infected with RF spirochetes (11). However, this serologic test serologic test Lab medicine A test that measures components–eg, antibodies, complement, and reactions–eg, complement fixation, agglutination, precipitation, etc, that reflect immune status, especially antibody titers. Cf Seroconversion.  is not species specific and cannot distinguish current from past infections.

Current Borrelia infections were detected by PCR and 16S rRNA gene sequence analysis in blood samples of patients from both northern and southern Togo. DNA sequencing identified both B. crocidurae and B. duttonii, but B. duttonii was found only in patients from northern Togo (Table 2). All 81 patients from northern Togo who were seronegative seronegative /se·ro·neg·a·tive/ (-neg´ah-tiv) showing negative results on serological examination; showing a lack of antibody.

se·ro·neg·a·tive
adj.
 were also negative by PCR. In contrast, 8 (88.9%) of 9 patients who were positive by ELISA were also positive by PCR (p<0.05). All patients who were positive by PCR had a fever when their blood samples were collected.

A total of 28 patients from southern Togo were tested for current spirochetemias and included all ELISA-positive and some ELISA-negative patients. The negative samples chosen were those with the highest values below the cut-off value as well as randomly chosen samples with lower values. The 13 PCR-positive patients included 11 (55%) of 20 ELISA-positive patients and 2 (25%) of 8 ELISA-negative patients. Two samples from ELISA-positive patients could not be tested by PCR because the DNA was degraded. Both patient samples that were PCR positive and ELISA negative had ELISA values just below cutoff value used in the study.

All patients from northern Togo were children (age range < 1-14 years). For children [less than or equal to] 4 years of age, 6 (10%) of 60 were seropositive. Of these children, 5 had a fever and 4 had an active Borrelia infection detected by PCR. DNA sequence DNA sequence Genetics The precise order of bases–A,T,G,C–in a segment of DNA, gene, chromosome, or an entire genome. See Base pair, Base sequence analysis, Chromosome, Gene, Genome.  analysis showed that 3 children were infected with B. crocidurae and 1 with B. duttonii. In southern Togo, 1 (9.1%) of 11 children <1-4 years of age were seropositive. The overall male-to-female ratio among study patients was 1.3:1. Serologic and PCR results did not differ by sex, ethnic background, or profession, with the exception of cow herders. The prevalence of seropositive adults was 62.5% (5/8) among cow herders compared with 12.2% (11/90) among those in other professions (p<0.05); 11 (78.6%) of 14 adults in the Peuhl ethnic group were cow herders (95% confidence interval confidence interval,
n a statistical device used to determine the range within which an acceptable datum would fall. Confidence intervals are usually expressed in percentages, typically 95% or 99%.
 [CI] 49.2%-95.3%), and 4 of 5 ELISA-positive Peuhl were cow herders. A total of 10.8% (95% CI 5.9%-17.8%) of all adults studied were cow herders. More Borrelia-infected patients lived in houses made of mud rather than cement than persons without RF infection (p = 0.008, data not shown).

The prevalence of malaria among patients with fever was 63.1%. Of 21 patients with PCR-confirmed Borrelia infections, malaria was diagnosed for 7 on the basis of a positive blood smear. Therefore, 7 (4.5%) of 154 patients were coinfected with malaria parasites and Borrelia (Table 3). In the youngest children ([less than or equal to] 4 years of age), 4 of 5 Borrelia-infected children also had malaria.

In northern Togo, patients infected with malaria and Borrelia were treated primarily with chloroquine chloroquine /chlo·ro·quine/ (klor´o-kwin) an antiamebic and anti-inflammatory used in the treatment of malaria, giardiasis, extraintestinal amebiasis, lupus erythematosus, and rheumatoid arthritis; used also as the hydrochloride and , artemether, quinine quinine (kwī`nīn', kwĭnēn`), white crystalline alkaloid with a bitter taste. Before the development of more effective synthetic drugs such as quinacrine, chloroquine, and primaquine, quinine was the specific agent in the treatment of , and amoxicillin amoxicillin /amox·i·cil·lin/ (ah-mok?si-sil´in) a semisynthetic derivative of ampicillin effective against a broad spectrum of gram-positive and gram-negative bacteria.

a·mox·i·cil·lin
n.
. Borrelia-infected, malaria-negative patients were treated primarily with chloroquine, quinine, or amoxicillin. In southern Togo, patients with malaria and Borrelia infections were treated primarily with quinine and chloramphenicol chloramphenicol (klōr'ămfĕn`əkŏl'), antibiotic effective against a wide range of gram-negative and gram-positive bacteria (see Gram's stain). It was originally isolated from a species of Streptomyces bacteria.  for typhoid fever typhoid fever acute, generalized infection caused by Salmonella typhi. The main sources of infection are contaminated water or milk and, especially in urban communities, food handlers who are carriers. , metronidazole metronidazole /met·ro·ni·da·zole/ (-ni´dah-zol) an antiprotozoal and antibacterial effective against obligate anaerobes; used as the base or the hydrochloride salt. It is also used as a topical treatment for rosacea.  for amebiasis amebiasis: see dysentery. , and albendazole for digestive parasitosis par·a·si·to·sis
n. pl. par·a·si·to·ses
Infestation with parasites.



parasitosis

a disease caused by a parasitic infestation. See also helminthiasis.
. Borrelia-infected, malaria-negative patients were treated with chloroquine and antimicrobial drugs, such as amoxicillin, which are ineffective against RF Borrelia (Table 3) (14).

Discussion

Although microscopic analysis of Giemsa-stained blood smears for Borrelia showed negative results, current infections were demonstrated by PCR and gene sequencing in 8.8% of patients with fever. Therefore, no RF infections would have been detected if only microscopic examination of stained blood smears had been performed. Our results emphasize the low sensitivity of microscopy in the diagnosis of RF, as has demonstrated by others (11,14,17). Another problem in diagnosis is that the borreliae are detectable only during the short peaks of fever (18). Microscopy might have shown positive results if dark-field or fluorescent microscopy fluorescent microscopy (fl·reˑ·s  had been used, but this was not possible in the clinics in this study. However, 1 of the primary objectives of this study was to improve the diagnosis of RF borreliosis by using molecular and serologic techniques.

A study of rodents in Senegal showed that 57.7% of Borrelia infections were false negative by microscopy (11). Microscopy is the method routinely used to diagnose B. crocidurae infections in Senegal, where the disease is common (14,15). Thus, methods that provide greater sensitivity are needed to determine more accurately the presence of RF throughout West Africa. Since the GlpQ antigen is present in RF Borrelia but absent in Lyme disease Borrelia, positive antibody test results strongly indicated that infections with RF Borrelia were occurring or had occurred (16). However, the infecting species and the time of infection could not be determined by this method. Positive serologic test results correlated with current infection, as demonstrated by PCR and sequence analysis. Thus, serologic tests may be more adequate for diagnosis, although ELISA procedures would have to be modified for use in small rural clinics.

Our finding of TBRF in Togo demonstrates that the geographic distribution of this disease in West Africa is greater than previously thought. Trape et al. suggested that RF caused by B. crocidurae might be spreading to new areas because of the sub-Saharan drought, which might allow vector ticks to colonize col·o·nize  
v. col·o·nized, col·o·niz·ing, col·o·niz·es

v.tr.
1. To form or establish a colony or colonies in.

2. To migrate to and settle in; occupy as a colony.

3.
 new areas in the savannas of West Africa (2). Our results suggest that this might be true. We also found RF caused by B. crocidurae in the tropical region of southern Togo, where the climate may be less favorable for its tick vector. Thus, habitats believed to be preferred by O. sonrai may need to be reconsidered. Southern Togo has been subjected to deforestation deforestation

Process of clearing forests. Rates of deforestation are particularly high in the tropics, where the poor quality of the soil has led to the practice of routine clear-cutting to make new soil available for agricultural use.
, periods of drought, and slash-and-burn agriculture. During the rainy season, the average temperatures in Dapaong and Atakpame are 24[degrees]C and 25.8[degrees]C, respectively, compared with dry season mean temperatures of 28.9[degrees]C and 26.8[degrees]C, respectively (19). The dry wind or harmattan har·mat·tan  
n.
A dry dusty wind that blows along the northwest coast of Africa.



[Akan (Twi) haramata, possibly from Arabic
 from the Sahara Desert during winter can cause periodic droughts in northern Togo. We propose that areas with similar climate in West Africa are likely to have TBRF.

Of particular interest was our finding of B. duttonii in northern Togo, which extends the known distribution of this species in Africa. Additional work is needed to determine if its vector O. moubata is present in northern Togo or if B duttonii can be transmitted by O. sonrai. More studies are needed to determine the distribution of RF spirochetes and their vectors in Africa and what effect these infections have on human health.

Many of the primary symptoms of malaria and RF are similar, such as recurrent fever recurrent fever
n.
See relapsing fever.
, chills, anemia, hepatomegaly, splenomegaly, and possible neurologic symptoms. Thus, a considerable risk for misdiagnosis of TBRF as malaria exists in countries in which RF is not recognized but in which malaria is prevalent. Occasional reports of European tourists returning home from Senegal with B. crocidurae infections have implied that the disease may be misdiagnosed as malaria, which leads to incorrect treatment (14,15,20). Because RF has not been investigated in most West African countries including Togo, the disease is generally not considered in a differential diagnosis differential diagnosis
n.
Determination of which one of two or more diseases with similar symptoms is the one from which the patient is suffering. Also called differentiation.
 for fever patients. Also, malaria is often diagnosed on the basis of only clinical symptoms, not examination for parasites in the blood, which increases misdiagnosis. Increased knowledge of the geographic distribution and epidemiology of RF in West Africa should improve the recognition and treatment of this disease. Prompt diagnosis of RF would also reduce the number of people in whom chronic symptoms such as neuroborreliosis later develop when bacteria cross the blood-brain barrier and infect the central nervous system (5,21,22).

We used a questionnaire to determine possible risk factors associated with RF. Some children <1-[less than or equal to] 4 years of age were infected with RF Borrelia. Since O. sonrai is nocturnal, feeding mostly at night, these children may have been infected at home. However, RF among infants may also reflect infection from mothers before or during birth, as occurs with B. duttonii in East Africa (18). We also found that persons with current Borrelia infections more often lived in houses made of mud rather than cement. This observation is similar to ones in Senegal, where Ornithodoros ticks feed primarily at night inside mud or in adjacent areas where small mammals are present (2,6,20).

Before our study, we trapped 66 rodents and insectivores in or near houses in Togo. Four species were identified: musk shrew (Crocidura spp.), Nile rat (Arvicanthis niloticus), multimammate rat (Mastomys natalensis), and brown rat (Rattus norvegicus); 3 are known reservoirs for B. crocidurae in Senegal. These findings showed the presence of these potential reservoirs in northern and southern Togo (unpub. data). We found that mud huts were associated with entrances of rodent burrows, which might increase the risk for exposure to ticks (data not shown). In the present study, cow herders were also at a greater risk of acquiring RF. However, more studies are required to investigate potential risk groups. A higher proportion of cow herders who were ELISA positive were also Peuhl, who are nomadic See nomadic computing.  people. Their behavior and sleeping outside at night may put them at greater risk of being bitten by nocturnal soft ticks.

We report TBRF in Togo with a prevalence of 8.8% among the patients studied. For those with fever, 63.1% had malaria and 4.5% were coinfected with RF Borrelia. Among those with RF, 33.3% were coinfected with malaria parasites. Given the retrospective finding of spirochetes by PCR, only 1 of 18 patients with TBRF received treatment effective against this disease at the time she was seen in the clinic. Thus, TBRF is obscured by the high incidence of malaria in Togo, and this problem likely occurs in other regions in West Africa. In rural health centers without laboratory facilities, diagnosis of malaria is based only on clinical symptoms. The potential risk for misdiagnosis and ineffective treatment of patients with RF rather than malaria needs to be addressed. Our findings demonstrate the need for improved diagnostic procedures to detect TBRF in West Africa. We consider the high prevalence of RF among febrile febrile /feb·rile/ (feb´ril) pertaining to or characterized by fever.

feb·rile
adj.
Of, relating to, or characterized by fever; feverish.
 children and the lack of correct treatment as important health concerns, particularly with regard to the severity of untreated neuroborreliosis and women infected during pregnancy.

Acknowledgments

We thank Hospice Fonvi, Genevieve Carpentier, Egi Madeleine Goerki, Akutsa Kafui Amedzro, Kossi George Yakpa, the Association Protestante des Oeuvres Medico-Sociales et Humanitaires du Togo, Cecilia Norin, Peter Larsson, Anna Dahl, and Malin Agren for their contributions to the project; Merry Schrumpf and Ingela Nilsson for their technical assistance; and Ingela Krantz Krantz is the name of two persons:
  • Kermit E Krantz Physician and inventor
  • Grover Krantz Bigfoot researcher
 for reviewing the manuscript.

The study was supported by a planning grant from the Swedish International Development Agency/Department for Research Co-operation, the Swedish Research Council The Swedish Research Council (Swedish: Vetenskapsrådet) is a Swedish government agency established in 2001, with the responsibility to support and develop basic scientific research.  (VR-M 07922), and the Swedish Foundation for International Cooperation in Research and Higher Education.

References

(1.) Helmy N. Seasonal abundance of Ornithodoros (0.) savignyi and prevalence of infection with Borrelia spirochetes in Egypt. J Egypt Soc Parasitol. 2000;30:607-19.

(2.) Trape JF, Godeluck B, Diatta G, Rogier C, Legros F, Albergel J, et al. The spread of tick-borne borreliosis in West Africa and its relationship to sub-Saharan drought. Am J Trop Med Hyg. 1996;54:289-93.

(3.) Anda P, Sanchez-Yebra W, del Mar Vitutia M, Perez Pastrana E, Rodriguez I, Miller NS, et al. A new Borrelia species isolated from patients with relapsing lever in Spain. Lancet. 1996;348:162-5.

(4.) Goubau PF, Munyangeyo C. Congenital relapsing fever caused by Borrelia duttoni. Apropos of a case in Rwanda. Ann Soc Belg Med Trop. 1983;63:367-9.

(5.) Cadavid D, Barbour ACt Neuroborreliosis during relapsing fever: review of the clinical manifestations, pathology, and treatment of infections in humans and experimental animals. Clin Infect Dis. 1998;26:151-64.

(6.) World Health Organization. Vector control: methods for use by individuals and communities. Geneva Geneva, canton and city, Switzerland
Geneva (jənē`və), Fr. Genève, canton (1990 pop. 373,019), 109 sq mi (282 sq km), SW Switzerland, surrounding the southwest tip of the Lake of Geneva.
: The Organization; 1997.

(7.) Barbour ACt Antigenic variation of a relapsing fever Borrelia species. Annu Rev Microbiol. 1990;44:155-71.

(8.) Barbour ACt Borrelia species and antigenic variation. Trends Microbiol. 1993;1:236-9.

(9.) Meier JT, Simon MI, Barbour ACt Antigenic variation is associated with DNA rearrangements in a relapsing fever Borrelia. Cell. 1985;41:403-9.

(10.) Shamaei-Tousi A, Martin P, Bergh A, Burman N, Brannstrom T, Bergstrom S. Borrelia crocidurae induces formation of microemboli. J Infect Dis. 1999;180:1929-38.

(11.) Trape JF, Duplantier JM, Bouganali H, Godeluck B, Legros F, Cornet JP, et al. Tick-borne borreliosis in west Africa. Lancet. 1991 ;337:473-5.

(12.) Lecompte Y, Trape JF. West African tick-borne relapsing fever. Ann Biol Clin (Paris). 2003;61:541-8.

(13.) Vial L, Diatta G, Tall A, Ba el H, Bouganali H, Durand P, et al. Incidence of tick-borne relapsing fever in west Africa: longitudinal study. Lancet. 2006;368:37-43.

(14.) van Dam AP, van Gool T, Wetsteyn JC, Dankert J. Tick-borne relapsing fever imported from West Africa: diagnosis by quantitative burly coat analysis and in vitro in vitro /in vi·tro/ (in ve´tro) [L.] within a glass; observable in a test tube; in an artificial environment.

in vi·tro
adj.
In an artificial environment outside a living organism.
 culture of Borrelia crocidurae. J Clin Mierobiol. 1999;37:2027-30.

(15.) Brahim H, Perrier-Gros-Claude JD, Postic D, Baranton G, Jambou R. Identifying relapsing fever Borrelia, Senegal. Emerg Infect Dis. 2005;11:474-5.

(16.) Porcella SF, Raffel SJ, Schrumpf ME, Schriefer ME, Dennis DT, Scbwan TG. Serodiagnosis serodiagnosis /se·ro·di·ag·no·sis/ (-di?ag-no´sis) diagnosis of disease based on serologic tests.serodiagnos´tic

se·ro·di·ag·no·sis
n. pl.
 of louse-borne relapsing fever with glycerophosphodiester phosphodiesterase (GlpQ) from Borrelia recurrentis. J Clin Microbiol. 2000;38:3561-71.

(17.) Kisinza WN, McCall PJ, Mitani H, Talbert A, Fukunaga M. A newly identified tick-borne Borrelia species and relapsing fever in Tanzania. Lancet. 2003;362:1283-4.

(18.) Melkert PW, Stel HV. Neonatal Borrelia infections (relapsing fever): report of 5 cases and review of the literature. East Aft Med J. 1991;68:999-1005.

(19.) Climate information for Togo. 2005. [cited 2006 Oct 17]. Available from www.climate-zone.com/climate/togo

(20.) Colebunders R, De Serrano P, van Gompel A, Wynants H, Blot K, van den Enden E, et al. Imported relapsing lever in European tourists. Scand J Infect Dis. 1993;25:533-6.

(21.) Nordstrand A, Barbour AG, Bergstrom S. Borrelia pathogenesis research in the post-genomic and post-vaccine era. Curt Opin Mierobiol. 2000;3:86-92.

(22.) Nordstrand A, Shamaei-Tousi A, Ny A, Bergstrom S. Delayed invasion of the kidney and brain by Borrelia crocidurae in plasminogen-deficient mice. Infect Immun. 2001 ;69:5832-9.

Annika Nordstrand, * Ignas Bunikis, * Christer Larsson, * Kodjo Tsogbe, ([dagger]) Tom G Schwan, ([doubledagger]) Mikael Nilsson, ([section]) and Sven Bergstrom *

* Umea University, Umea, Sweden; ([dagger]) Association Protestante des Oeuvres Medico-Sociales et Humanitaires du Togo, Lome, Togo; ([doubledagger]) National Institutes of Health, Hamilton, Montana, USA; and ([section]) The Swedish Institute for Infectious Disease Infectious disease

A pathological condition spread among biological species. Infectious diseases, although varied in their effects, are always associated with viruses, bacteria, fungi, protozoa, multicellular parasites and aberrant proteins known as prions.
 Control, Solna, Sweden

Dr Nordstrand is a medical microbiologist and epidemiologist at the Department of Public Health and Clinical Medicine/Epidemiology and Public Health Sciences at Umea University. Her current research interests focus on relapsing fever Borrelia and other tickborne diseases in West Africa.

Address for correspondence: Sven Bergstrom, Department of Molecular Biology molecular biology, scientific study of the molecular basis of life processes, including cellular respiration, excretion, and reproduction. The term molecular biology was coined in 1938 by Warren Weaver, then director of the natural sciences program at the Rockefeller , Umea University, SE 90187 Umea, Sweden, email: sven.bergstrom@molbiol.umu.se
Table 1. Primers used for cloning, PCR, and DNA sequencing

Primer            Sequence (5' [right arrow] 3'] *       Reference

Br_GLpQ_3_BamHl   GGCGGATCCGCTTGACCAGTTGCTCCTCCGC        (16)
Br_GLpQ_5_Xhol    GCCGCTCGAGGAAAAGAAAATGCAAAAATAAATAAA   (16)
GlpQ For          GGTATGCTTATTGGTCTTC                    Present study
GlpQ Rev          TTGTATCCTCTTGTAATTG                    Present study
GlpQ1             CAAATCACTAAGCCTTAGCGAAAGAT             Present study
GlpQ2             ATCTGTTGGTGCTTCTTCCCAGT                Present study
GlpQ3             CAGGGAAAATTGATAATGCTTGTTGG             Present study
GlpQ4             CTGCTAATGTGAAATCGACGGAATA              Present study
Nested_1_F        AGAGTTTGATCCTGGCTTAG                   (15)
Nested_1_R        CTTGCATATCCGCCTACTCA                   (15)
Nested_2_F        GGCTTAGAACTAACGCTGGCA                  (15)
Nested_2_R        CTGCTGGCACGTAATTAGCC                   (15)

* Sequences in boldface indicate restriction sites for BamH1 and Xhol.

Table 2. Prevalence and identification of Borrelia infections in
patients with fever at clinics in northern and southern Togo,
2002-2004

                     Seropositive for
                     relapsing fever    Borrelia in blood,
                      Borrelia, * no.     ([dagger]) no.
Region,                positive/no.        positive/no.
age group, y            tested (%)          tested (%)

Northern
  0-4                     6/60 (10)            4 (6.7)
  5-14                    3/30 (10)           4 (13.3)
  Total                   9/90 (10)            8 (8.8)
Southern
  0-4                   2/16 (12.5)            1 (6.3)
  5-14                   3/35 (8.6)            2 (5.7)
  Total                  5/51 (9.8)            3 (5.9)
  15-24                 7/43 (16.3)              3 (7)
  [greater than         9/55 (16.4)           7 (12.7)
  or equal to] 25
  Total for adults     16/98 (16.3)          10 (10.2)
  Total               21/149 (14.1)           13 (8.7)
All                   30/239 (12.6)           21 (8.8)

                        Infected with B.         Infected with B.
                      crocidurae, ([double      duttonii, ([double
Region,              dagger]) no. positive/   dagger]) no. positive/
age group, y             no. tested (%)           no. tested (%)

Northern
  0-4                          3 (5)                 1 (1.7)
  5-14                        3 (10)                 1 (3.3)
  Total                      6 (6.7)                 2 (2.2)
Southern
  0-4                        1 (6.3)                    0
  5-14                       2 (5.7)                    0
  Total                      3 (5.9)                    0
  15-24                        3 (7)                    0
  [greater than             7 (12.7)                    0
  or equal to] 25
  Total for adults         10 (10.2)                    0
  Total                     13 (8.7)                    0
All                         19 (7.9)                 2 (1.2)

* Determined by ELISA for glycerophosphodiester phosphodiesterase
antigen.

([dagger]) Determined by 16S rRNA gene PCR amplification from blood of
patients with high ELISA values divided by all ELISA-tested patients.

([double dagger]) Determined by genomic sequence of 16S rRNA in blood
samples.

Table 3. Coinfection with malaria and relapsing fever caused by
Borrelia and treatment in patients in northern and southern Togo with
fever, 2002-2004

                Malaria infection, * no. positive/
                          no. tested (%)

Region, group     All patients   Borrelia infected

Northern
  Children        34/96 (35.4)         4/8 (50)
Southern
  Children        46/68 (67.6)       2/3 (66.7)
  Adults          35/80 (43.8)        1/10 (10)
  Total          81/148 (54.7)      3/13 (23.1)
All             154/244 (63.1)      7/21 (33.3)

                Borrelia infected ([dagger]) and
                treated for malaria, no. positive/
                          no. tested (%)

                                   Malaria negative
Region, group   Malaria positive   ([double dagger])

Northern
  Children          4/4 (100)            1/4 (25)
Southern
  Children           1/2 (50)                 0/1
  Adults                  0/1          1/6 (16.6)
  Total            1/3 (33.3)          1/7 (14.3)
All                5/7 (71.4)         2/11 (18.2)

                   Borrelia infections
                effectively treated, no.
Region, group    positive/no. tested (%)

Northern
  Children                 0/8
Southern
  Children             1/3 (33.3)
  Adults                   0/7
  Total                 1/10 (10)
All                    1/18 (5.6)

* Determined by microscopy of Giemsa-stained blood smears.

([dagger]) Determined by positive PCR result and Borrelia species
identification by sequence in blood. Three malaria-negative adults were
not included because treatment information was not available.

([double dagger]) Values represent patients treated only for malaria.
Two of these 4 patients were treated for malaria in combination with
drugs for treating helminth infections.
COPYRIGHT 2007 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2007, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Author:Bergstrom, Sven
Publication:Emerging Infectious Diseases
Article Type:Disease/Disorder overview
Geographic Code:6TOGO
Date:Jan 1, 2007
Words:4725
Previous Article:Emergence of Arctic-like rabies lineage in India.(RESEARCH)
Next Article:Clinical diagnosis and geographic distribution of leptospirosis, Thailand.(DISPATCHES)
Topics:



Related Articles
Relapsing fever-like spirochetes infecting European vector tick of Lyme disease agent. (Research).
Tick-borne relapsing fever caused by Borrelia hermsii, Montana.(Dispatches)
Identifying relapsing fever Borrelia, Senegal.(Dispatches)
Tickborne meningoencephalitis, first case after 19 years in Northeastern Germany.(Letters)
Typing African relapsing fever spirochetes.(RESEARCH)
Tickborne relapsing fever in Israel.(DISPATCHES)
Imported tickborne relapsing fever, France.(Letter to the Editor)
Tick-Borne Diseases of Humans.(Book Review)
Possibilities for relapsing fever reemergence.(PERSPECTIVE)
Molecular characterization of tickborne relapsing fever Borrelia, Israel.(DISPATCHES)

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles