The immortalized UROtsa cell line as a potential cell culture model of human urothelium.The UROtsa cell line was isolated from a primary culture of normal human urothelium through immortalization immortalization /im·mor·tal·iza·tion/ (imor?tah-li-za´shun) the gaining of immunity to normal limitations on growth or life span, sometimes achieved by animal cells in vitro or by tumor cells. with a construct containing the SV40 large T antigen T antigen n. See tumor antigen. T antigen tumor antigen. . It proliferates in serum-containing growth medium as a cell monolayer mon·o·lay·er n. 1. A film or layer one molecule thick formed at the interface between water and either oil or air by a substance such as a partially esterified fatty acid that contains both hydrophobic and hydrophilic groups in the same with little evidence of uroepithelial differentiation. The working hypothesis in the present study was that this cell line could be induced to differentiate and express known features of in situ In place. When something is "in situ," it is in its original location. urothelium if the original serum-containing growth medium was changed to a serum-free formulation. We demonstrated that the UROtsa cells could be successfully placed into a serum-free growth medium consisting of a 1:1 mixture of Dulbeco's modified Eagle's medium and Ham's F-12 supplemented with selenium selenium (səlē`nēəm), nonmetallic chemical element; symbol Se; at. no. 34; at. wt. 78.96; m.p. 217°C;; b.p. about 685°C;; sp. gr. 4.81 at 20°C;; valence −2, +4, or +6. (5 ng/mL), insulin (5 [micro]g/mL), transferrin transferrin /trans·fer·rin/ (-fer´in) a glycoprotein mainly produced in the liver, binding and transporting iron, closely related to the apoferritin of the intestinal mucosa. trans·fer·rin n. (5 [micro]g/mL), hydrocortisone hydrocortisone (hī'drəkôr`tĭzōn'), another name for the steroid hormone cortisol, more especially used to refer to preparations of this hormone used medicinally. (36 ng/mL), triiodothyronine triiodothyronine /tri·io·do·thy·ro·nine/ (tri?i-o?do-thi´ro-nen) one of the thyroid hormones, an organic iodine-containing compound liberated from thyroglobulin by hydrolysis. It has several times the biological activity of thyroxine. (4 pg/mL), and epidermal growth factor Epidermal growth factor or EGF is a growth factor that plays an important role in the regulation of cell growth, proliferation and differentiation. Human EGF is a 6045 Da protein with 53 amino acid residues and three intramolecular disulfide bonds. (10 ng/mL). Under serum-free growth conditions, confluent con·flu·ent adj. 1. Flowing together; blended into one. 2. Merging or running together so as to form a mass, as sores in a rash. UROtsa cells were shown by light microscopy to produce raised, three-dimensional structures. Routine ultrastructural examination disclosed these three-dimensional areas to consist of a stratified stratified /strat·i·fied/ (strat´i-fid) formed or arranged in layers. strat·i·fied adj. Arranged in the form of layers or strata. layer of cells that strongly resembled in situ urothelium. The cells displayed numerous desmosomal connections, complex interactions of the lateral membranes, and abundant intermediate filaments within the cytoplasm cytoplasm: see protoplasm. cytoplasm Portion of a eukaryotic cell outside the nucleus. The cytoplasm contains all the organelles (see eukaryote). . Freeze fracture analysis demonstrated that the cells possessed tight-junction sealing strands and gap junctions gap junctions regions of high and special ionic permeability between closely apposed cells. They are places at which cells exchange molecules of large size and provide an avenue by which developing cells can influence each other. Called also nexus. . The overall morphology was most consistent with that found in the intermediate layers of in situ urothelium. The basal expression patterns of the metallothionein (MT) and heat shock proteins 27, 60, and 70 were determined in these cells, and expression was in agreement with that known to occur for in situ urothelium. The cells were also successfully tested for their ability to be stably transfected using expression vectors containing the MT-3 or MT-2A genes. The findings suggest that the UROtsa cells grown with a serum-free medium could be a valuable adjunct for studying environmental insult to the human urothelium in general and for the stress response in particular. Key words: bladder, bladder cancer bladder cancer Malignant tumour of the bladder. The most significant risk factor associated with bladder cancer is smoking. Exposure to chemicals called arylamines, which are used in the leather, rubber, printing, and textiles industries, is another risk factor. , bladder cell line, heat shock proteins, immortalization, interstitial cystitis interstitial cystitis: see cystitis. , metallothionein isoforms, stress response, urothelium. *********** Disorders of the bladder have a strong environmental base. Epidemiologically, bladder cancer represents one of the first cancers in which environmental carcinogens Carcinogens Substances in the environment that cause cancer, presumably by inducing mutations, with prolonged exposure. Mentioned in: Colon Cancer, Rectal Cancer were found to play the major role. This association was first observed in 1895, when Rehn (1) demonstrated the link between exposure to aromatic amines and development of bladder cancer in factory workers. This association has been confirmed in both animal models and in humans working in industries that involve exposure to aromatic amines (2,3). Recently, many studies have defined an association between cigarette smoking and bladder cancer, with some reports suggesting a 2- to 4-fold increased risk and that 50% of the bladder cancers in men would not occur in the absence of cigarette smoking (4,5). The majority of the remaining bladder cancers are believed to be caused by industrial or agricultural carcinogens. The number of cigarettes smoked, degree of inhalation, type of tobacco, use of filters, and smoking cessation smoking cessation Public health Temporary or permanent halting of habitual cigarette smoking; withdrawal therapies–eg, hypnosis, psychotherapy, group counseling, exposing smokers to Pts with terminal lung CA and nicotine chewing gum are often ineffective. have all been shown to have specific relationships with the development of bladder cancer (6). The strong environmental base of bladder cancer and the lack of biomarkers for diseases of the bladder led us to define the expression of the metallothionein (MT) and heat shock protein (hsp) genes in formalin-fixed, paraffin-embedded biopsy specimens from patients with bladder cancer and other diseases using a combination of immunohistochemical and reverse transcription-polymerase chain reaction (RT-PCR RT-PCR reverse transcriptase-polymerase chain reaction. See PCR1. ) techniques (7-11). The expression of these genes was chosen for analysis because they are members of the stress response gene superfamily superfamily /su·per·fam·i·ly/ (soo´per-fam?i-le) 1. a taxonomic category between an order and a family. 2. , which are widely accepted as being major weapons in the cell's armamentarium ar·ma·men·tar·i·um n. pl. ar·ma·men·tar·i·ums or ar·ma·men·tar·i·a The complete equipment of a physician or medical institution, including drugs, books, supplies, and instruments. for protection against and recovery from both physical and chemical environmental insult (12-15). For bladder cancer, it was demonstrated that MT-3 might be a potential biomarker because it was not expressed in normal urothelium but was overexpressed in all bladder cancers, with expression correlating directly to increasing tumor grade (7). It was also shown that the MT-1 and MT-2 isoforms had a low level of expression in normal urothelium and were overexpressed in many bladder cancers, with overexpression correlating to tumor grade (8). Furthermore, overexpression of the MT-1/2 protein in bladder cancer correlated with the increased expression of mRNA from the MT-1X isoform gene (8). For samples from patients with interstitial cystitis and related disorders, it was demonstrated that expression of the hsp 60 and hsp 70 was reduced compared to that found in the urothelium of the normal bladder, whereas hsp 27 and hsc 70 expression were unaltered (9-11). While these empirical observations are interesting, an opportunity to gain a mechanistic insight into the underlying alterations in stress gene regulation in the bladder is extremely limited due to the complexities of acquiring human tissue--much less the use of formalin-fixed, paraffin-embedded biopsy material. Because of this limitation, we initially searched for cell culture models of human urothelium that would help define the alterations of metallothionein gene expression that occurs in human bladder cancer. Although highly characterized human bladder cancer-derived cell lines were easy to identify (16), the same was not true for cell lines that retain features of normal human urothelium. There are several requirements and desired features of a cell culture model of normal urothelium in general and, in particular, for use in studies that may involve MT. First, the cell culture has to be of human origin because the gene organization and regulation of the MT gene family are more complex in humans than in rodent animal models (17). Second, the resulting cell culture needs to retain known differentiated features of normal urothelium and the gene expression patterns identified in situ in normal urothelium. Additionally, the cell culture should be immortal, but not tumorigenic tu·mor·i·gen·ic adj. Capable of causing tumors. , to avoid the complexities of human tissue acquisition that are inherent in the isolation and propagation of primary cell cultures. Immortalization also allows the stable transfection trans·fec·tion n. Infection of a bacterium or cell with DNA or RNA isolated from a bacteriophage or from an animal or a plant virus, resulting in replication of the complete virus. of the cell culture with vectors containing gene sequences of interest, and the cell culture should be tested to assure it is receptive to transfection protocols. In the present study, we tested the UROtsa cell line to determine if it would fulfill the above requirements as a cell culture model of human urothelium. The UROtsa cell line was derived from the normal urothelium lining the ureter ureter (y rē`tər), thick-walled tube that conveys urine from the kidney to the urinary bladder. It is approximately 10 in. (25. and was immortalized using the simian virus sim·i·an virusn. Any of a number of viruses of variable taxonomic classification isolated from monkeys and from cultures of monkey cells. 40 (SV40) large T antigen (17,18). After immortalization, the cells did not acquire characteristics of neoplastic neoplastic /neo·plas·tic/ (ne?o-plas´tik) 1. pertaining to a neoplasm. 2. pertaining to neoplasia. neoplastic pertaining to neoplasia or a neoplasm. transformation, as noted by lack of colony formation in soft agar and growth of tumors in nude mice. The present study advances this initial characterization, and using light and electron microscopy, shows that propagation of the UROtsa cell line on a serum-free growth medium results in expression of structural features of differentiated urothelium. Furthermore, the resulting cultures retain the MT and hsp expression background expected from normal urothelium and can be stably transfected to overexpress the MT-3 gene or knock-out MT gene expression using an antisense antisense, DNA or RNA manipulated in a laboratory so that its components (nucleotides) form a complementary copy of normal, or "sense," messenger RNA (mRNA; see nucleic acid). vector. The findings suggest the UROtsa cell line could be a valuable in vitro in vitro /in vi·tro/ (in ve´tro) [L.] within a glass; observable in a test tube; in an artificial environment. in vi·tro adj. In an artificial environment outside a living organism. model for studies assessing the effects of environmental agents on human bladder urothelium. Materials and Methods Cell culture. Stock cultures of the UROtsa cell line were maintained using the original conditions described by Petzoldt et al. (18). Briefly, cells were grown on plastic using Dulbecco's modified Eagle's medium (DMEM DMEM Dulbecco's Modified Eagle's Medium (for cell culture growth) DMEM Design Manufacture and Engineering Management Department ) containing 5% v/v fetal bovine serum Fetal bovine serum ( or foetal bovine serum) is serum taken from the fetuses of cows. Fetal Bovine Serum (or FBS) is the most widely used serum in the culturing of cells. In some papers the expression foetal calf serum is used. with incubation at 37 [degrees] C in a 5% C[O.sub.2]:95% air atmosphere. Confluent flasks were subcultured at a 1:4 ratio, and the cells were fed fresh growth medium every 3 days. The UROtsa cells normally attained confluency within 7 days after subculture. Development of serum-free growth conditions. The initial step in development of a serum-free growth formulation was to allow the UROtsa cells to attain confluence in standard serum-containing growth media and then to change the media to a serum-free formulation used previously by this laboratory for the growth of human proximal tubule cells (19). The serum-free growth medium was composed of a 1:1 mixture of DMEM and Ham's F-12 supplemented with selenium (5 ng/mL), insulin (5 [micro]g/mL), transferrin (5 [micro]g/mL), hydrocortisone (36 ng/mL), triiodothyronine (4 pg/mL), and epidermal growth factor (EGF EGF abbr. epidermal growth factor ; 10 ng/mL). The cells were fed this serum-free growth formulation for two additional feedings at 3-day intervals and then subcultured at a 1:4 ratio into the serum-free formulation. As will be detailed, the UROtsa cells proliferated under these conditions with an indefinite culture life span. The cells were able to proliferate on the standard plastic growth surface. Using these cells, a deletion study was performed to determine the minimal requirements for growth of UROtsa cells in culture. UROtsa cells maintained in complete serum-free growth medium were subcultured in six-well plates at a 1:4 subculture ratio. Each plate contained three control wells and three experimental wells. Control wells were fed with the complete serum-free growth medium. Experimental cultures were fed with serum-free medium that was deficient in one of the supplements described above. All cultures were maintained under standard conditions for 10 days, and the time necessary for each of the cultures to reach confluence was recorded. We monitored cells daily and documented growth with phase-contrast micrographs. Light, electron, and freeze-fracture microscopy. A record of the light-level morphology of the cultured cells was maintained using an Olympus IX70 inverted microscope with capture of the digital image using a Kontron Prog/Res/3012 camera and the Autocyte Image Management System (Zeiss, Thornwood, NY, USA). For ultrastructural analysis, the cultured cells were fixed in 2.5% glutaraldehyde glutaraldehyde /glu·ta·ral·de·hyde/ (gloo?tah-ral´de-hid) a disinfectant used in aqueous solution for sterilization of non-heat–resistant equipment; also used as a tissue fixative for light and electron microscopy. in 0.1 M phosphate buffer, pH 7.4, for 30 min in situ. The cells were then rinsed two times with phosphate buffered saline Phosphate buffer saline (abbreviated PBS) is a buffer solution commonly used in biochemistry. It is a salty solution containing sodium chloride, sodium phosphate and potassium phosphate. The buffer helps to maintain a constant pH. (pH 7.4) and postfixed in 1% osmium tetroxide in 0.1 M phosphate buffer for 1 hr. The cells were rinsed, routinely dehydrated de·hy·drate v. de·hy·drat·ed, de·hy·drat·ing, de·hy·drates v.tr. 1. To remove water from; make anhydrous. 2. To preserve by removing water from (vegetables, for example). in a graded series of ethanol, and infiltrated and embedded in Epon 812 (LADD LADD Lifetime Average Daily Dose LADD Lacrimoauriculodentodigital (syndrome) LADD Light and Darkness Dragon (YuGiOh trading cards) LADD Low-Angle Drogue Delivery LADD Lowest Acceptable Daily Dose Research Industries Inc., Burlington, VT, USA). Upon polymerization polymerization Any process in which monomers combine chemically to produce a polymer. The monomer molecules—which in the polymer usually number from at least 100 to many thousands—may or may not all be the same. , portions of the resulting preparation were cut and reembedded in additional Epon 812 in two spatial orientations. In this manner, ultrathin sections were obtained in planes that were parallel and perpendicular to the growth surface. Sections were stained with uranyl acetate and lead citrate citrate /cit·rate/ (sit´rat) a salt of citric acid. citrate phosphate dextrose (CPD) anticoagulant citrate phosphate dextrose solution. and viewed and photographed using an electron microscope electron microscope: see microscope. . For freeze-fracture analysis, confluent cultures of cells were subcultured onto mylar strips and fractured as described, previously (20). Briefly, the cells were fixed by treatment with 2.5% glutaraldehyde in culture medium for 1 hr followed by 25% glycerol glycerol, glycerin, glycerine, or 1,2,3-propanetriol (prō`pāntrī'ŏl), CH2OHCHOHCH2OH, colorless, odorless, sweet-tasting, syrupy liquid. in culture medium for 30 min. Using a tuberculin tuberculin /tu·ber·cu·lin/ (-lin) a sterile solution containing the growth products of, or specific substances extracted from, the tubercle bacillus; used in various forms in the diagnosis of tuberculosis; see also under test. syringe and needle, a small drop of polyvinyl alcohol polyvinyl alcohol, n a complex alcohol that is soluble in water and is used as an emulsifier and adhe-sive. (Elvanol; E.I. DuPont de Nemours and Co., Wilmington, DE, USA) was placed on a 3-mm gold specimen carrier. A section of mylar with attached cells was drained of excess fluid and placed cell-side up on the polyvinyl alcohol. A second drop of polyvinyl alcohol was placed on the surface of the monolayer. A strip of mylar (2 x 4 mm) was positioned on the second drop of polyvinyl alcohol so that one end overlapped the edge of the filter and specimen carrier. The resulting assembly was frozen in a liquid--solid nitrogen slush and mounted on a standard three-position Balzers specimen table. Using a Balzers BAF BAF British Athletics Federation 400T freeze-etch unit (BAL-TEC AG, Balzers, Principality of Liechtenstein), fractures were obtained at -105 [degrees] C and [10.sup.-7] mbar by positioning the knife blade beneath the free edge of the mylar strip and raising the knife blade. Following platinum/carbon and carbon deposition, the replicas with attached cells were floated from the specimen carriers in physiologic saline. These were treated with chromic-sulfuric acid and the replicas placed in 50% chromic-sulfuric acid overnight. Replicas were rinsed three times with distilled water, mounted on copper grids, and viewed in an electron microscope. RNA RNA: see nucleic acid. RNA in full ribonucleic acid One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic isolation and RT-PCR analysis of MT and hsp mRNA expression in UROtsa cells. Total RNA was isolated according to the protocol supplied with TRI TRI Toxics Release Inventory (US EPA) TRI Touch Research Institute TRI Taux de Rentabilité Interne (French: internal rate of return) TRI Taux de Rentabilité Interne TRI Tile Roofing Institute REAGENT (Molecular Research Center, Inc., Cincinnati, OH, USA) as described previously (21). We determined the concentration and purity of samples using spectrophotometer spectrophotometer, instrument for measuring and comparing the intensities of common spectral lines in the spectra of two different sources of light. See photometry; spectroscope; spectrum. scan in the UV region and ethidium bromide (EtBr) visualization of intact 18S and 28S RNA bands following agarose gel electrophoresis Agarose gel electrophoresis is a method used in biochemistry and molecular biology to separate DNA, RNA, or protein molecules by size. This is achieved by moving negatively charged nucleic acid molecules through an agarose matrix with an electric field (electrophoresis). . Total RNA (0.5 [micro]g) was reverse transcribed using MuLV (murine leukemia virus The murine leukemia virus belongs to the gammaretroviral genus of the Retroviridae family of viruses, their hosts are vertebrates. It is a Type VI: positive sense ssRNA viruses that replicates through a DNA intermediate, reverse transcriptase. ) reverse transcriptase Reverse transcriptase Any of the deoxyribonucleic acid (DNA) polymerases present in particles of retroviruses which are able to carry out DNA synthesis using an RNA template. (50 U) in 1 x PCR PCR polymerase chain reaction. PCR abbr. polymerase chain reaction Polymerase chain reaction (PCR) buffer (50 mM KCl and 10 mM Tris-HCl, pH 8.3), 5 mM Mg[Cl.sub.2] , 20 U RNase inhibitor, 1 mM each of the dNTPs, and 2.5 [micro]M random hexanucleotide primers. The samples were reverse transcribed for 20 min at 42 [degrees] C, followed by a 5-min denaturation denaturation, term used to describe the loss of native, higher-order structure of protein molecules in solution. Most globular proteins exhibit complicated three-dimensional folding described as secondary, tertiary, and quarternary structures. step at 99 [degrees] C using a DNA DNA: see nucleic acid. DNA or deoxyribonucleic acid One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes. thermocycler (Perkin-ElmerCetus 9600; Perkin Elmer, Foster City, CA, USA). The reverse-transcribed product was used for PCR amplification using the AmpliTaq DNA polymerase DNA polymerase /DNA po·lym·er·ase/ (pah-lim´er-as) any of various enzymes catalyzing the template-directed incorporation of deoxyribonucleotides into a DNA chain, particularly one using a DNA template. enzyme (2.5 U; Perkin Elmer) and the specific upstream and downstream primers. The primers and reaction conditions developed for analysis of each of the active MT genes and hsp 27, hsp 60, hsc 70, and hsp 70A, B,C have been previously described (21-25). Controls for each PCR included a no-template control where water was added instead of the RNA and a no-reverse-transcriptase control where water was added instead of the enzyme. Samples were removed at 25, 30, 35, and 40 PCR cycles to ensure that the reaction remained in the linear region. The final PCR products were electrophoresed on 2% agarose agarose more highly purified form of agar with similar uses to agar and widely used in the separation of nucleic acid fragments. gels containing EtBr along with DNA markers. The intensity (integrated optical density; IOD IOD Institute of Directors IOD Information on Demand IOD International One Design (sailing) IOD Institute on Disability (University of New Hampshire) IOD Indian Ocean Dipole ) of the PCR product bands was determined on a Dell workstation (Dell Computer Corporation (company) Dell Computer Corporation - One of the biggest US manufacturers of IBM PC compatibles. "From notebooks to networks", their slogan says. http://us.dell.com. , Austin, TX, USA) configured with Kontron KS 400 image analysis software (Carl Zeiss Vision, Thornwood, NY, USA). MT protein determination. The immunoblot protocol used for the determination of the levels of MT-1 and MT-2 and MT-3 protein in cell lysates has been described previously (26,27). The MT-1 and MT-2 proteins were detected by immunoblotting immunoblotting, n the immunologic methods for isolating and quantitatively measuring immunoreactive substances. When used with immune reagents such as monoclonal antibodies, the process is known generically as Western blot analysis. using a mouse anti-horse antibody (DAKO-MT, E9, Dako, Carpinteria, CA, USA) as the primary antibody. This antibody detects both the MT-1 and MT-2 isoforms, and the product detected is referred to as MT-l/2 in this report. MT-1/2 protein was quantified by comparing the optical density of the sample dots to that of the standard MT curve using KS 400 image analysis software. Rabbit liver Cd/Zn metallothionein-1 (Sigma Chemical Co., St. Louis, MO, USA) was applied to each blot to generate standard curves. This assay has detection limits in the range of 0.1-0.5 ng MT-1/2 protein. The MT-3 protein was detected using an antibody against human MT-3 that was generated using the dodecapeptide GGEAAEAEAEKC (corresponding to MT-3 amino acids, 53-64, which contains the MT-3 unique amino acid insert) conjugated conjugated adj. Conjugate. estrogens, conjugated Warning - Hazardous drug! C.E.S. through the C-terminal cysteine cysteine (sĭs`tēn), organic compound, one of the 20 amino acids commonly found in animal proteins. Only the l-stereoisomer participates in the biosynthesis of mammalian protein. sulfhydryl group to keyhole limpet limpet, marine gastropod mollusk with a simple, flattened, conical shell, found in cooler waters of the Atlantic and the Pacific oceans. Certain species creep over rocks, feeding on algae during high tides, but when the tide recedes they return instinctively to the hemocyanine using maleimidobenzoyl-Nhydroxysuccinimide ester. This was used to immunize im·mu·nize v. 1. To render immune. 2. To produce immunity in, as by inoculation. im New Zealand white rabbits. The MT-3 antibody was affinity purified using the dodecapeptide linked to SulfoLink gel (Pierce, Rockford, IL, USA) through the C-terminal cysteine residue. MT-3 protein was quantified by comparing the optical density of the sample dots to the standard MT-3 curve using KS 400 image analysis software. Standard curves were obtained by applying known amounts of the conjugated synthetic peptide to each blot. This assay has detection limits in the range of 0.5-2 pg MT-3 protein. Western analysis of hsp protein expression. The determination of the hsp 27, hsp 60, hsc 70, and hsp 70 proteins by Western analysis has been described previously (23-25). The hsp 27 was detected using a primary mouse monoclonal antibody monoclonal antibody, an antibody that is mass produced in the laboratory from a single clone and that recognizes only one antigen. Monoclonal antibodies are typically made by fusing a normally short-lived, antibody-producing B cell (see immunity) to a fast-growing (SPA800; StressGen, Victoria, BC, Canada); hsp 60 using a primary mouse monoclonal antibody (STM-806; StressGen); hsc 70 using a primary rat monoclonal antibody (SPA-815; StressGen); and hsp 70 using a primary mouse monoclonal antibody (SPA-810; StressGen). For reactions in the linear range of analysis, we obtained IODs of the samples by inputting the image to a Dell workstation configured with KS400 software using a Kodak DCS (1) See also DSC. (2) Digital Cross-connect System) A network switching and grooming device used by telecom carriers. See digital cross-connect. 420 CCD camera (Eastman Kodak Co., Rochester, NY, USA). Transfection of UROtsa cells. The MT-2A and MT-3 coding sequences were cloned from cultured human proximal tubule cell RNA by RT-PCR using primers described previously by this laboratory (28). The sequences were blunt-end ligated into the EcoR V site of pcDNA3.1/Hygro (+) (Invitrogen, Carlsbad, CA, USA). This vector has a cytomegalovirus cytomegalovirus (sī'təmĕg'əlōvī`rəs), member of the herpesvirus family that can cause serious complications in persons with weakened immune systems. immediate-early promoter upstream of the multiple cloning site A multiple cloning site (MCS), also called a polylinker, is a short segment of DNA which contains many (usually 20+) restriction sites - a standard feature of engineered plasmids. Restriction sites within an MCS are typically unique. and a hygromycin B hygromycin B an antibiotic produced by Streptomyces hygroscopicus; used for the control of ascariasis and esophagostomiasis in sows. The method of use is to feed it to sows over a period of several weeks, or continuously to growing pigs. resistance gene driven by an SV40 early promoter. All DNA constructs were linearized by Fsp I before transfection. The UROtsa cells were maintained in DMEM with 5% fetal bovine serum and were transfected with the MT-3 plasmid construct in the sense direction and MT-2A in the antisense orientation or the vector alone by using Effectene transfection reagent (Qiagen, Valencia, CA, USA). Briefly, lipid DNA complexes were prepared according to the manufacturer's protocol at a ratio of 1:10 plasmid to Effectene. Lipid complexes were added to cells at 2 [micro]g DNA per 9.6-[cm.sup.2] well for 24 hr. The cells were placed in normal media for 48 hr, trypsinized, and seeded at 8% confluency for selection in growth medium containing 30 [micro]g/mL hygromycin B. Clones were selected using cloning rings and propagated in media containing 30 [micro]g/mL hygromycin B. The stable transfectants were identified, recloned, and preserved in liquid nitrogen storage. MT-3 mRNA was identified by PT-PCP using MT-3 specific primers and MT-2 antisense using vector specific primers (CGGATCCACTAGTCCAGTGTG; upstream and ACGGGCCCTCTAGACTCG; downstream). Results Morphology of UROtsa cells on serum-containing growth medium. Stock cultures of the UROtsa cells have been maintained on serum-containing growth media for more than 100 population doublings with no alteration in the rate of growth (doubling time doubling time Oncology A parameter used to determine tumor aggressiveness, which serves to prognosticate, measure therapeutic success, and quantify tumor kinetics and growth rate. Cf Gompertzian growth curve. of approximately 30 hr) or in the light-level morphology of the cells (data not shown). The light-level morphology of the UROtsa cells on serum-containing growth media have a flattened appearance with an epitheloid morphology at both subconfluent and confluence densities (Figure 1A, B). The UROtsa cells appear to grow as a monolayer and, even when maintained for 14 days at confluence, show no tendency to multilayer or form foci of multilayered cells (Figure 1C). The monolayer growth of the UROtsa cells on serum-containing growth media was confirmed by ultrastructural analysis. Examination of highly confluent cells sectioned perpendicular to the growth surface at low magnification showed that the cells overlap one another in a monolayer arrangement and are connected to one another by frequent desmosomal connections (Figure 2A). The cells had a high nuclear-to-cytoplasmic ratio, and profiles of intermediate filaments were prevalent in the cytoplasm of the cells (Figure 2B,C). The apical apical /ap·i·cal/ (ap´i-k'l) pertaining to an apex. a·pi·cal adj. 1. Relating to the apex of a pyramidal or pointed structure. 2. surface of the cells possessed occasional microvilli microvilli (mī´krōvil´ē), n.pl tiny hairlike processes that extend from the surface of many cells. They are usually so small as to be visible only with an electron microscope. , and the overlapping segments of the cells had moderate lateral interdigitation (Figure 2). The low-magnification micrographs showed no evidence of tight junctions between the apical poles of the cells or the presence of gap junctions. The lack of these structures was confirmed by examination of the apical points of interaction between adjacent cells (Figure 2B,C). [FIGURE 1-2 OMITTED] Growth and morphology of UROtsa cells on serum-free growth medium. The UROtsa cell line was successfully placed into a serum-free growth media used previously by this laboratory for the growth of human proximal tubule cells (19,20). This serum-free formulation consisted of a 1:1 mixture of DMEM and Ham's F-12 supplemented with selenium (5 ng/mL), insulin (5 [micro]g/ml), transferrin (5 [micro]g/mL), hydrocortisone (36 ng/mL), triiodothyronine (4 pg/mL), and EGF (10 ng/mL). Unlike the human proximal tubule cells, the UROtsa cells needed no matrix other than the plastic growth surface on which to attach and proliferate. The light-level morphology of the UROtsa cells grown on serum-free media was altered from that noted to occur on serum-containing growth media. The UROtsa cells grown on serum-free growth media had a more polarized A one-way direction of a signal or the molecules within a material pointing in one direction. epithelial morphology when sub-confluent and, upon reaching confluency, developed areas of multicellular mul·ti·cel·lu·lar adj. Having or consisting of many cells. mul ti·cel organoid structures that became even more extensive as the cells were maintained past confluence (Figure 1D,E,F). Ultrastructural examination at low magnification of newly confluent cells sectioned perpendicular to the growth surface confirmed that the raised areas noted on light microscopy were, in fact, areas of cells arranged in a multilayered formation (Figure 2D). The cells contained abundant profiles of intermediate filaments, and there was some stratification of the cells from the bottom to the top of the multilayered structure, with cells located apically having a more differentiated appearance. The cells contained frequent desmosomal connections and the apical aspects of the cells were noted to interdigitate In`ter`dig´i`tatev. t. 1. To interweave. v. i. 1. To interlock, as the fingers of two hands that are joined; to be interwoven; to commingle. extensively. Higher magnifications demonstrate the extensive connections between cells of the multilayer (Figure 2E,F) and the degree of complexity of the lateral interdigitations between cells and the extensive interaction between cells at the apical surface of adjacent cells. These interactions between cells suggested that the cells might possess gap junctions and tight junctions, but the complexity of the cell-to-cell interactions rendered this hard to determine using routine ultrastructural examination. Because gap junctions are a known feature of urothelium and tight junctions are a feature of the apical-most cells, we used the technique of freeze fracture to confirm the presence of these structures. Freeze-fracture analysis disclosed the presence of both gap junctions and tight-junction sealing strands in the UROtsa cells cultured on serum-free growth medium (Figure 3 A,B,C). The low power micrograph micrograph /mi·cro·graph/ (-graf) 1. an instrument used to record very minute movements by making a greatly magnified photograph of the minute motions of a diaphragm. 2. of the replica demonstrates the presence of gap junctions on the surface of the cells and profiles of desomosomal connections and tight junctional sealing strands between the cells (Figure 3A). The higher power micrograph of the fracture replicas provides details of the complexity of the tight-junction sealing strands (Figure 3 B,C). [FIGURE 3 OMITTED] We performed a deletion study on the serum-free growth medium to determine which components were essential for the growth and differentiation of the UROtsa cells (data not shown). The results of this study demonstrated that only EGF was required for the immediate growth and differentiation of the cells. The absence of EGF resulted in cells that could neither proliferate nor differentiate after subculture. The absence of EGF had no effect on the ability of the UROtsa cells to remain viable and differentiated once a high level of confluence had been attained. The only other component of the growth medium that had an effect on cell growth was insulin, and a slowing of cell growth was only noticeable after insulin was absent from the growth media for several passages. The other components of the serum-free medium had no noticeable positive or negative contribution to the growth or differentiation of the UROtsa cells. Basal expression of hsp 27, hsp 60, hsp 70, and hsc 70 mRNA and protein by UROtsa cells. Total RNA was isolated from confluent UROtsa cells grown on both serum-containing and serum-free growth medium and used to determine the basal expression of the respective heat shock protein genes relative to the glyceraldehyde 3-phosphate dehydrogenase Glyceraldehyde 3-phosphate dehydrogenase (abbreviated as GAPDH or less commonly as G3PDH) (EC 1.2.1.9) is an enzyme that catalyzes the sixth step of glycolysis and thus serves to break down glucose for energy and carbon molecules. (g3pdh) housekeeping gene using RTPCR RTPCR Reverse Transcriptase Polymerase Chain Reaction technology as described previously (23-25). The expression of g3pdh mRNA was identical for the UROtsa cells grown on serum-containing and serum-free growth media, as noted by product bands of equal intensity at 30 reaction cycles using a total RNA input of 500 ng (Figure 4). The basal expression of hsp 27 mRNA was also identical for the UROtsa cells grown on both serum-containing and serum-free growth media (Figure 4). In both cases, the basal level of hsp 27 mRNA expression were high relative to the g3pdh housekeeping gene as evidenced by the fact that an hsp 27 reaction product of approximate equal intensity could be detected after only 20 cycles of the PCR at a 500 ng total RNA input. [FIGURE 4 OMITTED] There was no difference in the basal expression of hsp 60 mRNA between the UROtsa cells grown on serum-containing and serum-free media (Figure 4). A positive reaction product for hsp 60 mRNA was routinely detected after 40 cycles of the PCR using 500 ng total RNA from UROtsa cells grown on either serum-containing or serum-free growth media. As shown in Figure 4, the basal level of hsc 70 mRNA was identical for the UROtsa cells regardless of growth media composition, and relative expression was below that of the g3pdh housekeeping gene (35 vs. 30 cycles of PCR, respectively). No basal expression of mRNA for the hsp 70B or hsp 70C isoform genes were detected in the UROtsa cells regardless of growth media when using a 500 ng total RNA input and 40 cycles of the PCR (Figure 4). In contrast, basal expression of mRNA for the hsp 70A isoform gene was detected in the UROtsa cells grown on both media, but basal expression was much higher in cells grown on the serum-containing growth media (Figure 4). For UROtsa cells grown on serum-containing media, basal expression of hsp 70A mRNA was routinely detected at 35 PCR cycles, whereas only a marginal reaction product was demonstrated following 35 PCR cycles using equal total RNA from UROtsa cells grown on serum-free media. Thus, UROtsa cells express basal levels of mRNA for the hsp 27, hsp 60, hsc 70, and hsp 70A genes regardless of growth media composition, but demonstrate reduced relative levels of mRNA expression for the hsp 70A gene when grown on serum-free media. In agreement with the basal expression of hsp 27 mRNA, an analysis of hsp 27 protein expression by Western blotting demonstrated that the basal expression of the hsp 27 protein was approximately equal when the cells were propagated on either growth media (Figure 5). This agreement between mRNA and protein expression was also demonstrated for the hsp 60 and hsc 70 protein (Figure 5). In contrast, the reduction in hsp 70A mRNA expression noted for UROtsa cells grown on serum-free media was enhanced at the level of protein expression, with hsp 70 protein being undetectable for cells grown in serum-free growth media, even at 10-[micro]g inputs of total protein (Figure 5). Thus, UROtsa cells express basal levels of the hsp 27, hsp 60, and hsc 70 proteins regardless of growth media composition but demonstrate expression of hsp 70 protein only on serum-containing growth media. [FIGURE 5 OMITTED] Basal expression of metallothionein isoform-specific mRNA and protein by UROtsa cells. We also used the total RNA isolated from confluent UROtsa cells grown on both serum-containing and serum-free growth media to determine the basal expression of the MT isoform-specific mRNAs relative to the g3pdh housekeeping gene using RT-PCR and gene-specific primers, as described previously (21,22,28). Using a total RNA input of 500 ng and 40 cycles of PCR, it was demonstrated that there was no expression of mRNA representing the MT-1A, MT-1B, MT-1F, MT-1G, MT-1H, MT-3, or MT-4 genes in UROtsa cells grown on either serum-containing or serum-free growth media (Figure 6). In contrast, mRNA representing the MT-1E, MT-IX, and MT-2A genes was expressed in UROtsa cells grown on either serum-containing or serum-free growth media following 35, 30, and 35 cycles of PCR (at 500-ng total RNA inputs), respectively (Figure 6). [FIGURE 6 OMITTED] Immunoblotting with an MT antibody that recognizes both the MT-1 and MT-2 isoforms, but not the MT-3 or MT-4 isoforms, demonstrated that the cells expressed 0.5 ng of MT-l/2 protein/[micro]g total protein when grown on either growth media (data not shown). Immunoblotting with an MT-3-specific antibody demonstrated no MT-3 protein in the UROtsa cells (limit of detection 0.5-2 pg/[micro]g total protein). Stable transfection of the UROtsa cell line with vectors overexpressing the MT-3 gene and an MT-2A isoform antisense sequence. The coding sequence of the MT-3 gene was obtained from human proximal tubule cell RNA by RT-PCR, blunt-end ligated into the EcoRV site of pcDNA3.1/Hygro(+), and linearized by Fsp I before transfection of the UROtsa cells. The UROtsa cells were transfected with the MT-3 plasmid construct in the sense direction or by the vector without insert using the Effectene protocol. After selection in hygromycin B-containing growth medium, four clones were selected for further characterization. It was demonstrated using RT-PCR that each of the four clones overexpressed MT-3 mRNA when compared to wild-type UROtsa cells or UROtsa cells containing the pcDNA3.1 vector without the MT-3 sequence (Figure 7). Expression of MT-3 protein went from nondetectable levels in the wild-type UROtsa cells and the vector controls to a level of 0.3 ng/lag total protein in the MT-3 stably transfected clones (range 0.14-0.30 ng/[micro]g; data not shown). The level of MT-3 mRNA and protein in the stable transfected clones was not affected by growth medium composition, nor did over-expression change the light level morphology of the cells (data not shown). [FIGURE 7 OMITTED] The coding sequence of the MT-2A gene was obtained from human proximal tubule cell RNA by RT-PCR, blunt-end ligated into the EcoRV site of pcDNA3.1/Hygro(+), and linearized by Fsp I before transfection of the UROtsa cells. The UROtsa cells were transfected with the MT-2A plasmid in the antisense direction or by vector without MT-2A insert using the Effectene protocol. After selection in hygromycin B-containing growth medium, four clones were selected for further characterization. The presence of the antisense MT-2A sequence was confirmed by RT-PCR using vector-specific primers, and it was demonstrated that all four clones overexpressed mRNA for the insert when compared to the vector only control or wild-type UROtsa cells (Figure 8). That the MT-2 anti-sense sequence was productive in inhibiting MT-1 and MT-2 isoform-specific mRNA expression was confirmed by the finding that no MT-1/2 protein was detected in any of the four clones. The inhibition of MT-1/2 protein expression by MT-2A antisense overexpression had no effect on the light-level morphology of the cells (data not shown). [FIGURE 8 OMITTED] Discussion The goal of the present study was to determine if the UROtsa cell line might serve as a model to study human bladder urothelium in general and the stress response in particular. The study was motivated by the apparent lack of a widely used human-derived cell culture model for studying urothelium that retains important features of urothelial cell differentiation. A major factor inhibiting development of a widely used human urothelial cell culture model probably involves the complexity of acquiring human tissue, because primary cell culture models have been developed that appear to recapitulate re·ca·pit·u·late v. re·ca·pit·u·lat·ed, re·ca·pit·u·lat·ing, re·ca·pit·u·lates v.tr. 1. To repeat in concise form. 2. the major features of the urothelium. An inherent requirement of a primary (single-use) culture system is that one has access to a constant supply of appreciable amounts of viable human bladder tissue. Previously developed primary culture systems for studying urothelium have been summarized in a recent report that details a primary urothelial cell culture system derived from rabbit bladder that mimics most, if not all, of the major characteristics of urothelium found in vivo in vivo /in vi·vo/ (ve´vo) [L.] within the living body. in vi·vo adj. Within a living organism. in vivo adv. (29). These cultures consisted of an underlying cell layer that interacts with a collagen substratum sub·stra·tum n. pl. sub·stra·ta or sub·stra·tums 1. a. An underlying layer. b. A layer of earth beneath the surface soil; subsoil. 2. A foundation or groundwork. 3. , an intermediate cell layer, and an upper cell layer of large, superficial cells. These superficial cells were identified as umbrella cells based on their ability to form junctional complexes, possession of an asymmetric unit membrane unit membrane n. A trilaminar structure of the cell membrane as seen in cross section through an electron microscope. , expression of uroplakins and a 27-kDa urothelial cell-specific antigen that assembled into detergent-resistant asymmetric unit membrane particles. The multilayered cultures were also shown to have low diffusive dif·fu·sive adj. Characterized by diffusion. dif·fu sive·ly adv.dif·fu permeabilities for water and urea and high transepithelial resistance when the calcium concentration of the growth medium was increased to 1 mM. For all parameters tested, these primary cultures exhibited hallmark characteristics of in situ urothelium. In an attempt to overcome the problems associated with acquiring human tissue, several investigators have attempted to immortalize im·mor·tal·ize tr.v. im·mor·tal·ized, im·mor·tal·iz·ing, im·mor·tal·iz·es To make immortal. im·mor primary cultures of human urothelium using SV 40 or a construct containing the SV 40 large T antigen (18,30). The first of these efforts (30) resulted in an immortal epithelial cell culture that was easy to grow on serum-containing growth medium, required no substrate other than plastic for attachment, required no irradiated feeder cell layer, and had a generation time similar to that of primary cultures of human urothelial cell cultures. Unfortunately, the cells lacked one of the major differentiated properties of urothelium: they had monolayer cell growth instead of cell stratification--cell stratification being a hallmark of urothelium. The cells were able to grow in soft agar but were unable to form tumors in athymic mice. The second effort used a construct containing the SV40 large T antigen and produced a similar immortal cell culture (UROtsa) that was easy to use and proliferated on serum-containing growth medium and required no special matrix for medium additions. The UROtsa cells did not grow in soft agar or form tumors in athymic mice. As confirmed by ultrastructural examination in the present study, the UROtsa cells also grew as a monolayer of cells and did not stratify strat·i·fy v. strat·i·fied, strat·i·fy·ing, strat·i·fies v.tr. 1. To form, arrange, or deposit in layers. 2. , as would be expected to occur from primary cultures and in situ morphology. Thus, currently available culture models for human urothelium are at the two extremes of the technique: highly differentiated primary cultures with no serial growth potential and undifferentiated cultures with unlimited serial growth potential. The working hypothesis in the current study was that the failure of the UROtsa cells to differentiate might be due to the serum-containing growth medium and not due to an inherent inability of the immortalized cells to differentiate. This hypothesis was tested by adapting the cells to a serum-free growth formulation used successfully for the growth of human proximal tubule cells (19). When confluent, UROtsa cells were changed to this growth formulation and then subcultured further using the serum-free medium, and the result was a cell culture that possessed an altered morphology compared to the same cells grown on serum. When examined by light microscopy, preconfluent cells had a similar morphology regardless of growth medium composition. However, once the cells were confluent, the serum-free cultures continued to proliferate and formed raised, three-dimensional interactive structures with one another in many areas of the flask. Routine ultrastructural examination disclosed that the raised areas of the cell cultures displayed the stratification expected of differentiated urothelial cells. Also displayed were the numerous desmosomal connections between cells and abundant cytoplasmic cytoplasmic pertaining to or included in cytoplasm. cytoplasmic inclusions include secretory inclusions (enzymes, acids, proteins, mucosubstances), nutritive inclusions (glycogen, lipids), pigment granules (melanin, lipofuscin, intermediate filaments expected of such cells. There was no evidence of terminal keratinization keratinization /ker·a·tin·i·za·tion/ (ker?ah-tin?i-za´shun) conversion into keratin. ker·a·tin·i·za·tion n. The conversion of squamous epithelial cells into a horny material, such as nails. in the cell cultures, and cells could be serially passaged indefinitely using standard cell culture methods. A comparison of the ultrastructural morphology of the cells with that of in situ urothelium suggested that the cultured cells were similar in differentiation to the intermediate layer of the bladder uroepithelium (31-33). The finding on freeze fracture analysis that the cultured cells possessed tight junctional sealing strands further suggested a level of differentiation similar to the apical intermediate layer of the bladder urothelium. However, the organization of the sealing strands was not complex enough, nor did the cells possess an asymmetric unit membrane, to suggest that the UROtsa cultures have characteristics similar to that of the most apically located umbrella cells. At the current level of cell culture development, the UROtsa cells grown on the described serum-free growth medium appear to provide a valuable new model that retains important features of urothelial cell differentiation on which to base studies regarding human bladder urothelium. Although outside the scope of the present study, findings with the rabbit primary culture system (29) suggest that further manipulation of the cell culture technique could modify the level of differentiation of the UROtsa cell cultures toward either the highly differentiated umbrella cell or the undifferentiated basal cell basal cell n. A type of cell found in the deepest layer of the epithelium. . This assumption is based on findings in the rabbit primary culture system which showed that for the urothelium to achieve maximal differentiation (from an undifferentiated basal cell layer to a high resistance apical umbrella cell layer) required growth of the cells on a permeable support, careful attention to seeding densities, and manipulation of the calcium concentration of the growth medium (29). Likewise, these same studies demonstrated that lowering the calcium concentration of the growth medium resulted in the proliferation of undifferentiated basal cells. Although none of these manipulations were tested in the present study, there is no reason to anticipate that they should not prove operable operable /op·er·a·ble/ (op´er-ah-b'l) subject to being operated upon with a reasonable degree of safety; appropriate for surgical removal. op·er·a·ble adj. for the UROtsa cell culture system. The ability to manipulate the degree of differentiation of an easy-to-grow immortal human urothelial cell line by cell culture conditions would have enhanced value for modeling the response of human urothelium to environmental agents. An additional goal of this study was to determine if the UROtsa cells would have basal patterns of MT and heat shock gene expression similar to those found in both fresh and formalin-fixed normal human urothelium (7-11). Complete agreement was found between the expression patterns of the MT isoform-specific genes and MT proteins between the UROtsa cells grown on either growth medium and that found in situ urothelium. Specifically, expression of the MT-1E, MT-IX, and MT-2A genes and MT-1 and 2 proteins were found in both the cultured cells and in situ urothelium (7,8). No expression of MT-3 mRNA or protein was detected in the UROtsa cells. The lack of MT-3 expression is significant because MT-3 has been shown to be overexpressed in transitional cell carcinoma tran·si·tion·al cell carcinoma n. A malignant neoplasm derived from transitional epithelium and occurring primarily in the urinary bladder, ureters, or renal pelvises. transitional cell carcinoma Bladder cancer, see there of the bladder and in associated areas of dysplasia dysplasia Abnormal formation of a bodily structure or tissue, usually bone, that may occur in any part of the body. Several types are well-defined diseases in humans. (7). A similar analysis of hsp 27, hsp 60, hsc 70, and hsp 70 expression demonstrated complete agreement in the basal patterns of expression of hsp 27, hsp 60, and hsc 70 between the cultured cells and in situ urothelium (9-11). The expression of hsp 70 mRNA and protein was different between the UROtsa cells cultured on serum-free and serum-containing growth media, but this difference correlated to the localization Customizing software and documentation for a particular country. It includes the translation of menus and messages into the native spoken language as well as changes in the user interface to accommodate different alphabets and culture. See internationalization and l10n. of hsp 70 protein within in situ urothelium. For in situ urothelium, the expression of hsp 70 was localized using immunohistochemistry only in the lower basal cells of the intact urothelium, with the more differentiated upper layers of the urothelium being devoid of hsp 70 immunoreactivity (10). We found hsp 70 expression only for cells grown on serum-containing growth medium. This pattern of expression correlated with the degree of differentiation of the UROtsa cells grown in the respective growth media. Finally, for an immortal cell culture model to have full utility and ease of use, it needs to be receptive to stable transfection by expression vectors. This was tested successfully for the UROtsa cells using both sense and antisense sequences. The first was stable transfection of the coding sequence of the MT-3 gene under the control of the CMV CMV cytomegalovirus. CMV abbr. 1. controlled mechanical ventilation 2. cytomegalovirus Cytomegalovirus (CMV) promoter. Stable clones that overexpressed both MT-3 mRNA and protein were obtained, purified, and serially subcultured without difficulty. The second test was the stable transfection of an antisense sequence of the coding region of the MT-2A gene that, due to sequence homology among the MT genes, would be expected to knock out to force out by a blow or by blows; as, to knock out the brains s>. See also: Knock the mRNA expression of any MT gene. Again, stable clones that overexpressed RNA for the expression vector plus insert and underexpressed the MT protein were obtained, purified, and serially subcultured. In conclusion, the findings of this study indicate that the UROtsa cells can serve as a valuable adjunct for studying the human urothelium in general and the stress response in particular. REFERENCES AND NOTES (1.) Rehn L. Blasengeschwulte bei fuchsin-arbeitern. Arch Klin Chir 50:588 (1895). (2.) Hueper WC, Wiley FH, Wolfe HD. Experimental production of bladder tumors in dogs by administration of beta-naphthylamine. Hyg Toxicol 20:48 (1938). (3.) Case RAM, Hosker ME, McDonald DB, Pearson JT. Tumours of the urinary bladder urinary bladder n. A musculomembranous elastic receptacle in the anterior part of the pelvic cavity serving as the temporary storage place for urine. in workmen engaged in the manufacture and use of certain dyestuff intermediates in the British Chemical Industry. Br J Ind Med 11:75-104 (1954). (4.) Morrison AS, Buring JE, Verhoeck WG, Aoki K, Leck I, Ohno Y, Obata K. An international study of smoking and bladder cancer. J Urol 131:650-654 (1984). (5.) Clavel J, Cordier S, Boccon-Gibod L, Hereon here·on adv. On this; hereupon. D. Tobacco and bladder cancer in males: increased risk for inhalers and smokers of black tobacco. Int J Cancer 44:605-610 (1989). (6.) Vincis P, Esteve J, Hartge P, Hoover R, Silverman DT, Terracini B. Effects of timing and type of tobacco in cigarette-induced bladder cancer. Cancer Res 48:3849-3852 (1998). (7.) Sens MA, Somji S, Lamm DL, Garrett SG, Slovinsky F, Todd JH, Sens DA. Metallothionein isoform 3 as a potential biomarker for human bladder cancer. Environ Health Perspect 108:413-418 (2000). (8.) Somji S, Sens MA, Lamm DL, Garrett SH, Sens DA. Metallothionein isoform 1 and 2 gene expression in the human bladder: evidence for up-regulation of MT-1X mRNA in bladder cancer. Cancer Detect Prey 25:62-75 (2001). (9.) Somji S, Garrett SH, Sens DA, Nseyo UO, Todd JH, Sens MA. Expression of heat shock protein 27 in human bladder. Urol Pathol 9:1-15 (1998). (10.) Somji S, Sens DA, Todd JH, Garrett SH, Nseyo UO, Sens MA. Expression of heat shock protein 70 in the bladder from controls and patients with interstitial cystitis-like syndromes. Urol Pathol 10:9-21 (1999). (11.) Somji S, Sens DA, Todd JH, Garrett SH, Nseyo UO, Sens MA. The expression of heat shock protein 60 is reduced in the bladder of patients with interstitial cystitis. Urol Pathol 10:97-108 (1999). (12.) Arrigo AP. Small stress proteins: chaperones that act as regulators of intracellular redox redox (rē`dŏks): see oxidation and reduction. state and programmed cell death pro·grammed cell death n. See apoptosis. programmed cell death proposed system of cell death, often including poly(ADP)-ribosylation, ensures that a cell will not survive if it is so badly damaged that its recovery would harm the . Biol Chem 379:19-26 (1998). (13.) Macario AJL AJL Association of Jewish Libraries . Heat-shock proteins and molecular chaperones; implications for pathogenesis, diagnostics, and therapeutics. Int J Clin Lab Res 25:59-70 (1995). (14.) Georgopoulos C, Welch WJ. Role of the major heat shock proteins as molecular chaperones. Annu Rev Cell Biol 9:601-634 (1993). (15.) Bukau B, Horwich AL. The hsp 70 and hsp 60 chaperone chaperone /chap·er·one/ (shap´er-on) someone or something that accompanies and oversees another. molecular chaperone machines. Cell 92:351-366 (1998). (16.) Master JRW, Hepburn PJ, Walker L, Highman WJ, Trejdosiewicz LK, Povey S, Parkar M, Hill BT, Riddle PR, Franks LM. Tissue culture model of transitional cell carcinoma: characterization of twenty-two urothelial cell lines. Cancer Res 46:3630-3636 (1986). (17.) Petzoldt JL, Leigh IM, Duffy PG, Masters JRW. Culture and characterisation of human urothelium in vivo and in vitro. Urol Res 22:67-74 (1994). (18.) Petzoldt JL, Leigh IM, Duffy PC, Sexton C, Masters JRW. Immortalisation of human urothelial cells. Urol Res 23:377-380 (1995). (19.) Sens DA, Detrisac CJ, Sens MA, Rossi MR, Wenger SL, Todd JH. Tissue culture of human renal epithelial cells Epithelial cells Cells that form a thin surface coating on the outside of a body structure. Mentioned in: Corneal Transplantation using a defined serum-free growth formulation. Exp Nephrol 7:344-352 (1999). (20.) Todd JH, Sens DA, Sens MA, Hazen-Martin DJ. In situ freeze-fracture of monolayer cell cultures grown on a permeable support. Microsc Res Tech 22:301-305 (1992). (21.) Garrett SH, Somji S, Todd JH, Sens DA. Exposure of human proximal tubule cells to [Cd.sup.2+], [Zn.sup.2+], and [Cu.sup.2+] induces metallothionein protein accumulation but not metaltothionein isoform 2 mRNA. Environ Health Perspect 106:587-595 (1998). (22.) Garrett SH, Somji S, Todd JH, Sens, MA, Sens DA. Differential expression of human metallothionein isoform I mRNAs in human proximal tubule cells exposed to metals. Environ Health Perspect 106:825-831 (1998). (23.) Somji S, Sens DA, Garrett SH, Sens MA, Todd JH. Heat shock protein 27 expression by human proximal tubule cells exposed to lethal and sublethal sublethal /sub·le·thal/ (-le´thal) insufficient to cause death. sub·le·thal adj. Not sufficient to cause death. concentrations of Cd[Cl.sub.2]. Environ Health Perspect 107:545-552 (1999). (24.) Somji S, Todd JH, Sens MA, Garrett SH, Sens DA. Expression of the constitutive and inducible forms of heat shock protein 70 in human proximal tubule cells exposed to heat, sodium arsenite and Cd[Cl.sup.2]. Environ Health Perspect 107:887-893 (1999). (25.) Somji S, Todd JH, Sens MA, Garrett SH, Sens DA. Expression of heat shock protein 60 in human proximal tubule cells exposed to heat, sodium arsenite, and Cd[Cl.sub.2]. Toxicol Lett 115:127-136 (2000). (26.) Garrett SH, Sens MA, Shukla D, Nestor, S, Somji S, Todd JH, Sens DA. Metallothionein isoform 3 expression in the human prostate and cancer-derived cell lines. Prostate 41:196-202 (1999). (27.) Garrett SG, Sens MA, Shukla D, Luis Rotes, Somji S, Todd JH, Sens DA. Metallothionein isoform 1 and 2 gene expression in the human prostate: down-regulation of MT-1X in advanced prostate cancer prostate cancer, cancer originating in the prostate gland. Prostate cancer is the leading malignancy in men in the United States and is second only to lung cancer as a cause of cancer death in men. . Prostate 43:125-135 (2000). (28.) Mididoddi S, McGuirt JP, Sens MA, Todd JH, Sens DA. Isoform-specific expression of metallothionein mRNA in the developing and adult human kidney. Toxicol Lett 685:17-27 (1996). (29.) Truschel ST, Ruiz WG, Shulman T, Pilewski J, Sun TT, Zeidel ML, Apodaca G. Primary uroepithelial cultures. J Biol Chem 274:15020-15029 (1999). (30.) Christian BJ, Loretz LJ, Oberley TD, Reznikoff CA. Characterization of human uroepithelial cells immortalized in vitro by simian virus 40. Cancer Res 47:6066-6073 (1987). (31.) Moran DT, Rowley JC. The urinary bladder. In: Visual Histology. Philadelphia:Lea and Febiger, 1988;184-185. (32.) Jost SP, Gosling JA, Dixon JS. The morphology of normal human bladder urothelium. J Anat 167:103-115 (1989). (33.) Lewis SA. Everything you wanted to know about the bladder epithelium but were afraid to ask. Am J Physiol 278:F867-F874 (2000). Michael R. Rossi, (1) John R.W. Masters, (2) Seongmi Park, (1) John H. Todd (3) Scott H. Garrett, (4) Mary Ann Sens, (3) Seema Somji, (4) Joginder Nath, (1) and Donald A. Sens (4) (1) Genetics and Developmental Biology Program, West Virginia University West Virginia University, mainly at Morgantown; coeducational; land-grant and state supported; est. and opened 1867 as an agricultural college, renamed 1868. , Morgantown, West Virginia, USA; (2) Institute of Urology, University College London “UCL” redirects here. For other uses, see UCL (disambiguation). University College London, commonly known as UCL, is the oldest multi-faculty constituent college of the University of London, one of the two original founding colleges, and the first British , London, England; (3) Department of Pathology; and (4) Department of Urology, West Virginia University, Morgantown, West Virginia, USA Address correspondence to D.A. Sens, Department of Urology, West Virginia University, Robert C. Byrd Health Sciences, PO Box 9251, Morgantown, WV 26506-9251 USA. Telephone: (304) 293-1621. Fax: (304) 293-3316. E-mail: dsens@wvu.edu Received 29 November 2000; accepted 15 February 2001. |
|
||||||||||||||

rē`tər)
ti·cel
sive·ly adv.
Printer friendly
Cite/link
Email
Feedback
Reader Opinion