Printer Friendly
The Free Library
14,505,807 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

The genetic stock structure of the American lobster (Homarus americanus) in Long Island Sound and the Hudson Canyon.


ABSTRACT The genetic population structure of the American lobster (Homarus americanus) was examined in populations collected in Long Island Sound (LIS LIS - Langage Implementation Systeme.

A predecessor of Ada developed by Ichbiah in 1973. It was influenced by Pascal's data structures and Sue's control structures. A type declaration can have a low-level implementation specification.
) and the Hudson Canyon The Hudson Canyon is a submarine canyon that begins from the shallow outlet of New York Harbor (at the mouth of the Hudson River) and extends out over 400 nautical miles (~450 miles or 750 km) seaward across the continental shelf, finally connecting to the deep ocean basin at a  of the Northeastern United States United States, officially United States of America, republic (2005 est. pop. 295,734,000), 3,539,227 sq mi (9,166,598 sq km), North America. The United States is the world's third largest country in population and the fourth largest country in area.  with recently developed microsatellite See miniaturized satellite.  DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 loci loci

[L.] plural of locus.

loci Plural of locus, see there
 probes. Pereiopods, a thoracic thoracic /tho·rac·ic/ (thah-ras´ik) pectoral; pertaining to the thorax (chest).

tho·rac·ic
adj.
Of, relating to, or situated in or near the thorax.
 appendage appendage /ap·pen·dage/ (ah-pen´dij) a subordinate portion of a structure, or an outgrowth, such as a tail.

epiploic appendages  see under appendix .
 used for movement, feeding and defense, were collected from egg-bearing female lobsters from three sites within LIS--an eastern, central and western site--and from sites within the Hudson Canyon. Genomic DNA genomic DNA
n.
The full complement of DNA contained in the genome of a cell or organism.
 was isolated from each pereiopod and examined for nine microsatellite loci. Microsatellite allele frequencies allele frequency

The percentage of a population of a species that carries a particular allele on a given chromosome locus.
, corrected for the presence of null alleles A null allele is a mutant copy of a gene that completely lacks that gene's normal function. This can be the result of the complete absence of the gene product (protein, RNA) at the molecular level, or the expression of a non-functional gene product. , were used to determine genetic differences between sampled groups. In agreement with earlier studies that used mitochondrial DNA Mitochondrial DNA (mtDNA) is the DNA located in organelles called mitochondria. Most other DNA present in eukaryotic organisms is found in the cell nucleus. Nuclear and mitochondrial DNA are thought to be of separate evolutionary origin, with the mtDNA being derived from the  and allozyme markers, there was little genetic differentiation between eastern and central LIS sites and the Hudson Canyon site. However, the genetic differences between western LIS populations and other sampled populations were 10 times higher. These were greater differences than could be attributed to geographical separation. These differences may have arisen as a result of the massive lobster die-off that occurred in 1998/1999 in western LIS.

KEY WORDS: Homarus americanus, American lobster, genetic, populations

INTRODUCTION

An understanding of the genetic population structure of commercially important fisheries fisheries. From earliest times and in practically all countries, fisheries have been of industrial and commercial importance. In the large N Atlantic fishing grounds off Newfoundland and Labrador, for example, European and North American fishing fleets have long  is critical for the conservation and management of exploited fish and crustacean crustacean (krŭstā`shən), primarily aquatic arthropod of the subphylum Crustacea. Most of the 44,000 crustacean species are marine, but there are many freshwater forms.  species (Thorpe Thorpe   , James Francis Known as "Jim." 1888-1953.

American athlete. An outstanding collegiate football player, he later played professional football and baseball.
 et al. 2000). The American lobster (Homarus americanus H. Milne Edwards, 1837) is found at intertidal in·ter·tid·al  
adj.
Of or being the region between the high tide mark and the low tide mark.



in
 depths to 720 m, but most frequently at 4-50 m, along the continental shelf throughout much of western North Atlantic from southern Labrador to offshore North Carolina North Carolina, state in the SE United States. It is bordered by the Atlantic Ocean (E), South Carolina and Georgia (S), Tennessee (W), and Virginia (N). Facts and Figures


Area, 52,586 sq mi (136,198 sq km). Pop.
 (Herrick 1909). Major coastal concentrations of lobster are in the Gulf of Maine The Gulf of Maine is a large gulf of the Atlantic Ocean on the northeastern coast of North America.

It is delineated by Cape Cod at the eastern tip of Massachusetts in the southwest and Cape Sable at the southern tip of Nova Scotia in the northeast.
 and the coastal waters of New Brunswick New Brunswick, province, Canada
New Brunswick, province (2001 pop. 729,498), 28,345 sq mi (73,433 sq km), including 519 sq mi (1,345 sq km) of water surface, E Canada.
 and Nova Scotia Nova Scotia (nō`və skō`shə) [Lat.,=new Scotland], province (2001 pop. 908,007), 21,425 sq mi (55,491 sq km), E Canada. Geography
, Canada (Cooper & Uzmann 1980). Major offshore concentrations are along the outer edge of the Continental Shelf and upper slope between the eastern part of Georges Bank Georges Bank

Submerged sandbank in the Atlantic Ocean east of Massachusetts, U.S. It has long been an important fishing ground, with scallops harvested in its northeastern portion. Navigation is made dangerous by crosscurrents and fog.
 and the Delaware Bay Delaware Bay: see Delaware, river.
Delaware Bay

Inlet of the Atlantic Ocean. Forming part of the New Jersey-Delaware state border, it extends southeast for 52 mi (84 km) from the junction of the Delaware River with Alloway Creek to its entrance
 (Schroeder 1959). Small numbers inhabit the outer edge of the Nova Scotia shelf (Cooper & Uzmann 1980).

American lobster is a commercially important species and effective management of exploited species requires identification of biologically relevant management units that reflect the degree of reproductive isolation An important concept in evolutionary biology, reproductive isolation is a category of mechanisms that prevent two or more populations from exchanging genes. The separation of the gene pools of populations, under some conditions, can lead to the genesis of distinct species.  (Carvalho & Hauser 1994). Previous work that characterized American lobster populations with allozyme markers and randomly amplified polymorphic polymorphic - polymorphism  DNA (RAPD RAPD Randomly Amplified Polymorphic DNA
RAPD relative afferent pupillary defect (ophthalmology; aka Marcus-Gunn Pupil) 
) (Tracey et al. 1975, Harding et al. 1997), suggested that little population structure existed. The lack of noted population structure may have been influenced by the limited resolution of these approaches. Recently, high-resolution microsatellite loci have been characterized for the American lobster (Jones et al. 2003). These loci have been shown to have relatively high levels of heterozygosity heterozygosity /het·ero·zy·gos·i·ty/ (het?er-o-zi-gos´i-te) the state of possessing different alleles at a given locus in regard to a given character.heterozy´gous

het·er·o·zy·gos·i·ty
n.
 (compared with allozyme markers and RAPD but not as high as for some marine fish) and have been shown to be suitable for the characterization of lobster populations.

Previous work has suggested that the enormous potential for larval larval

1. pertaining to larvae.

2. larvate.


larval migrans
see cutaneous and visceral larva migrans.
 dispersion, the wide-ranging movement of adult lobsters (from tagging experiments) and the anthropogenic an·thro·po·gen·ic  
adj.
1. Of or relating to anthropogenesis.

2. Caused by humans: anthropogenic degradation of the environment.
 influence of humans in the placement of adult lobsters have acted to muddy the genetic waters. There are several factors that suggest that lobsters may indeed have a heterogeneous genetic distribution through areas of the eastern United States and specifically within Long Island Sound (LIS). A lobster die-off reduced the 1999 fall landings of lobsters in western LIS by <99% (CT DEP DEP Deposit
DEP Deputy
DEP Department of Environmental Protection
DEP Dependent
DEP Departure
DEP Depot
DEP Deposition
DEP deployed (US DoD)
DEP Data Execution Prevention (computer security) 
 2003). The die-off corresponded with several years of above-normal water temperatures, application of pesticides for West Nile West Nile may refer to:
  • West Nile virus
  • West Nile region in Uganda
 virus-carrying mosquito control and Paramoeba sp. infections (CT DEP 2003). Certain factors suggest that there may have been a genetic component for survivorship survivorship n. the right to receive full title or ownership due to having survived another person. Survivorship is particularly applied to persons owning real property or other assets, such as bank accounts or stocks, in "joint tenancy. .

In this study, experiments are carried out to determine the genetic population structure of lobsters within LIS and from the Hudson Canyon area, an area long believed to supply lobsters to LIS. The results of these studies are discussed in the context of lobster management.

METHODS

Collections

Egg-bearing female lobster pereiopods (a thoracic appendage used for feeding, walking, and defense) were collected from four sites in the spring, and two sites in the summer in 2001 within LIS and from a site in the spring in the Hudson Canyon by scientists from the Connecticut DEP and the Millstone millstone

Either of two flat, round stones used for grinding grain to make flour. The stationary bottom stone is carved with shallow grooved channels that radiate from the centre. The upper stone rotates horizontally, and has a central hole through which grain is poured.
 Environmental Laboratory (Table 1 & Fig. 1). Pereiopods were collected from eggbearing females because natal Natal, city, Brazil
Natal (nətäl`), city (1991 pop. 606,887), capital of Rio Grande do Norte state, NE Brazil, just above the mouth of the Potengi River.
 homing increases the likelihood of detecting genetic differences between populations. The sites within LIS are approximately 30-50 km apart, whereas the Hudson Canyon collection site is over 50 km away from the other collection sites. Lobsters were collected from baited traps, and the pereiopods removed and placed in 70% ethanol and then transferred to the laboratory. Up to 150 pereiopods were collected from each site, one from each lobster (Table 1). The spring and summer lobster collections were treated as separate groups even if they were collected from the same sites, because it has been suggested that spawning lobster populations (spring) are different from summer and fall populations (P. Howell, CT DEP, pers. comm.).

[FIGURE 1 OMITTED]

Genomic DNA Isolation

In the laboratory, a segment was cut from each pereiopod, and the inner soft tissue removed and processed for the isolation of genomic DNA as described (Crivello et al. 2004). The genomic DNA was quantified with PicoGreen (Molecular Probes Molecular Probes is a biotechnology company located in Eugene, Oregon specializing in fluorescence. The company was founded in 1975 by Richard and Rosaria Haugland in their kitchen in Minnesota, then moved briefly to Texas and finally to Oregon in the early 1980s.  Inc., Eugene, Oregon The city of Eugene is the county seat of Lane County, Oregon, United States. It is located at the south end of the Willamette Valley, at the confluence of the McKenzie and Willamette rivers, about 60 miles (100 km) east of the Oregon Coast. ) and each sample was adjusted to 2 ng/[micro]L genomic DNA.

Microsatellite Loci

Lobster-specific microsatellite locus and flanking PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
 primer sequences described in Jones et al. (2003) were used to characterize microsatellite alleles at 9 loci (Table 2). To analyze each microsatellite loci, 10 ng of genomic DNA was mixed with a stock solution containing 0.5 [micro]M forward & reverse primer (with the forward primer tagged with a [D.sub.2], [D.sub.3] or [D.sub.4] fluorescent tag In molecular biology and biotechnology, a fluorescent tag is a part of a molecule that researchers have attached chemically to aid in detection of the molecule to which it has been attached. The tag is some kind of fluorescent molecule (also known as fluorophore). , Beckman Coulter This article needs sources or references that appear in reliable, third-party publications. Alone, primary sources and sources affiliated with the subject of this article are not sufficient for an accurate encyclopedia article. , Palo Alto, California “Palo Alto” redirects here. For other uses, see Palo Alto (disambiguation).
Palo Alto (IPA: /ˌpæloʊˈʔæltoʊ/, from Spanish: palo: "stick" and alto: "high", i.e.
), 0.2 mM dNTPs, 10 mM Tris, 50 mM KCl, 2.5 mM Mg[Cl.sub.2] and 0.5 units of a thermostable ther·mo·sta·ble or ther·mo·sta·bile
adj.
Unaffected by relatively high temperatures, as certain ferments or toxins.
 DNA polymerase DNA polymerase /DNA po·lym·er·ase/ (pah-lim´er-as) any of various enzymes catalyzing the template-directed incorporation of deoxyribonucleotides into a DNA chain, particularly one using a DNA template.  in a final 10 [micro]L volume. Each sample was heated to 94[degrees]C for 30 s, to the annealing annealing (ənēl`ĭng), process in which glass, metals, and other materials are treated to render them less brittle and more workable.  temperature for 30 s and then 72[degrees]C for 45 s for 35 cycles.

The reaction products were diluted with 30 [micro]L of water and then 10 [micro]L of a [D.sub.2], [D.sub.3] and [D.sub.4] reaction were combined and precipitated. The precipitated products were washed with 70% ethanol and redissolved in formamide that contained 60-400 base pair size markers labeled with [D.sub.1] (Beckman Coulter, Palo Alto, California). The samples were then analyzed in a Beckman Seq2000 capillary electrophoresis Capillary electrophoresis (CE), also known as capillary zone electrophoresis (CZE), can be used to separate ionic species by their charge and frictional forces. In traditional electrophoresis, electrically charged analytes move in a conductive liquid medium under the  system. Microsatellite alleles were identified by size with a resolution of 0.25 bp by comparison with size standards.

Statistical Analysis of Genetic Differences

Observed heterozygosity, mean number of alleles, and conformity to Hardy-Weinberg Equilibrium (HWE HWE Horner-Wadsworth-Emmons (organic reaction)
HWE Healthy Worker Effect
HWE Hardy-Weinberg Equilibrium Test
HWE Harper Wood Electric
HWE Henry Walker Eltin Mining (Nedlands, West Australia) 
) were analyzed for all loci with GenePop version 3.2 (Raymond & Rousset 1995). For loci with more than four alleles in a sampled population, a Markov chain (probability) Markov chain - (Named after Andrei Markov) A model of sequences of events where the probability of an event occurring depends upon the fact that a preceding event occurred.

A Markov process is governed by a Markov chain.
 method was used to estimate the exact P value. Each microsatellite loci was tested for the presence of null alleles by the method of Brookfield (1996) using the freely available MicroChecker software (http://www.microchecker.hull.ac.uk). Null alleles are one or more alleles that fail to amplify during PCR, or incorrect scoring of alleles because of stuttering stuttering or stammering, speech disorder marked by hesitation and inability to enunciate consonants without spasmodic repetition. Known technically as dysphemia, it has sometimes been attributed to an underlying personality disorder. , or if large alleles do not amplify as efficiently as small alleles-allele dropout (1) On magnetic media, a bit that has lost its strength due to a surface defect or recording malfunction. If the bit is in an audio or video file, it might be detected by the error correction circuitry and either corrected or not, but if not, it is often not noticed by the human . The allele frequencies of loci showing evidence of null alleles were corrected statistically prior to analysis of conformity to HWE and for genetic differences between populations (van Oosterhout et al. 2004).

Determination of population genetic structure was made by pair-wise statistical examination of the differences in allele frequencies in each population. The statistic [F.sub.ST] reflects the proportion of the observed genetic variation that can be explained by partitioning between populations (Wright 1969). Several approaches have been designed for the analysis of microsatellite differences between populations; [R.sub.ST] is an [F.sub.ST] analogue based on allele allele (əlēl`): see genetics.
allele

Any one of two or more alternative forms of a gene that may occur alternatively at a given site on a chromosome.
 size, and [delta][[mu].sup.2] a [D.sub.S] analogue based on allele size (Slatkin 1995, Goldstein & Pollock 1997, Ronfort et al. 1998). [F.sub.ST] and [R.sub.ST] are computed using an ANOVA anova

see analysis of variance.

ANOVA Analysis of variance, see there
 approach following, respectively, Cockerham & Weir (1986), Ronfort et al. (1998) and Roussett (1996). To obtain estimates of RST using multilocus data, the appropriate variances for each locus was calculated and then averaged over all loci before calculating [R.sub.ST] (Slatkin 1995). However, in datasets with widely different variances, loci with low variance contribute little to [R.sub.ST] even if they show high levels of differentiation. The loci are made compatible by globally standardizing the dataset so alleles are expressed in terms of standard deviations In statistics, the average amount a number varies from the average number in a series of numbers.

(statistics) standard deviation - (SD) A measure of the range of values in a set of numbers.
 from the global mean rather than the allele repeat number. All population-based statistics were computed for each locus and a multilocus weighted average was also calculated (Hardy & Vekemans 1999). A jackknife jack·knife  
n.
1. A large clasp knife.

2. Sports A dive in the pike position, in which the diver straightens out to enter the water hands first.

v.
 procedure over loci (Sokal & Rohlf 1995) provides approximate errors for multilocus estimates. Spatial genetic structure estimates, population differentiation and inbreeding inbreeding, mating of closely related organisms. Inbreeding is chiefly used as a means of insuring the preservation of specific desired traits among the offspring of purebred animals (see breeding).  coefficients are tested by resampling procedures whereby spatial locations, individuals or genes are permuted. Permuting locations is equivalent to a Mantel test The Mantel test is a statistical test of the correlation between two matrices. The matrices must be of the same rank, and in the usual applications, they are matrices of interrelations between the same vectors of objects.  between matrices of pairwise genetic statistics.

RESULTS

A total of 507 lobster pereiopods were collected from an equal number of egg-bearing female lobsters from three sites within LIS and a site within the Hudson Canyon (Table 1 and Fig. 1). The pereiopods were collected in spring and summer. The spring and summer pereiopod collections from eastern and western LIS were treated as separate groups for all statistical analyses.

Lobster genomic DNA analyzed for nine microsatellite loci revealed a high level of heterozygosity among all collection sites and seasons (average [H.sub.obs] = 0.7144) (Table 3). There were no significant differences in heterozygosity among the sampled populations. All microsatellite loci produced multiple products (15 alleles on average per locus). The number of alleles produced per locus was greater than that reported by Jones et al. (2003) from a smaller number of samples. Analysis for the presence of null alleles revealed that 4 out of the 9 microsatellite loci showed evidence of null alleles (Table 4). Loci Ham 6, 9, 15 and 48 showed evidence of null alleles. The allele frequencies for those loci were corrected as described (van Oosterhout et al. 2004). The data were corrected by estimating of the null allele frequency and adjusting the allele and genotype frequencies In population genetics, the genotype frequency is the frequency or proportion (i.e. 0 < f < 1) of genotypes in a population.

It may be denoted thus:



Compare allele frequency.
 accordingly. The adjusted allele frequencies were subsequently re-examined for HardyWeinberg deviations (van Oosterhout et al. 2004) (Table 3). Using the corrected values, several of the alleles were now shown to conform to Verb 1. conform to - satisfy a condition or restriction; "Does this paper meet the requirements for the degree?"
fit, meet

coordinate - be co-ordinated; "These activities coordinate well"
 Hardy-Weinberg equilibrium.

The overall corrected allele frequencies are given in Figure 2. The allele frequencies are similar to those reported by Jones et al. (2003) for American lobsters collected in Canada and for the European lobster (Homarus gammarus Linnaeus, 1758).

[FIGURE 2 OMITTED]

The corrected allele frequencies were used to determine conformity to HWE (Table 3). Two-thirds of the loci--on a population basis--showed lack of conformity to HWE. The lack of conformity to HWE was related to the geographic area from which the lobsters were collected. The lobsters collected from eastern and central LIS and the Hudson Canyon area showed lack of conformity to HWE but lobsters collected in western LIS showed conformance to HWE but only in spring and with only a sample of 11 animals.

Population-level differences in allele frequencies were examined by pair-wise statistical approaches (Table 5). The spring and summer eastern and western LIS populations showed little genetic differentiation among themselves, suggesting that there is little difference between lobster breeding populations and populations later in the year. The eastern (spring and summer) and the central LIS populations showed little genetic differentiation from the Hudson Canyon population. In contrast, even through the central LIS population is approximately the same geographical distance from the western and Stratford Shoal LIS populations as it is from the eastern LIS population, it showed 10 times the level of genetic differentiation. The eastern LIS and Hudson Canyon populations also showed high levels of genetic differentiation from the western LIS and Stratford Shoal populations. The Stratford Shoals and western LIS populations showed high levels of genetic differentiation between themselves even though they are geographically closer together than the central and eastern LIS populations.

DISCUSSION

Evidence has suggested that lobster populations in LIS may be genetically differentiated because of anthropogenic selective pressures (CT DEP 2003). Western LIS was the site of large commercial lobster catches and the area also receives high levels of anthropogenic impacts from the surrounding land, raising the possibility for development of pollution resistance in resident lobsters. There is ample evidence in the literature for the rapid development of insecticide insecticide

Any of a large group of substances used to kill insects. Such substances are mainly used to control pests that infest cultivated plants and crops or to eliminate disease-carrying insects in specific areas.
 resistance in insects (Baker & Argobast 1995, ffrench-Constant et al. 2000). Trapping studies (DNC DNC Democratic National Committee
DNC Democratic National Convention
DNC Do Not Call
DNC Delaware North Companies
DNC Domain Name Commissioner
DNC Direct Numerical Control
DNC Do Not Change
DNC Does Not Compute
DNC Digital Nautical Chart
 2002) have shown that lobsters released in eastern LIS (>150,000) were not collected in western LIS, but were found predominantly (>98%) in eastern LIS. Finally, a shell disease prevalent in eastern LIS is much less prevalent in lobsters collected from western LIS.

Anthropogenic pressures may select for lobster populations more resistant to pollutants pollutants

see environmental pollution.
 but with reduced heterozygosity. The possible reduced lobster population heterozygosity may make them more susceptible to unusual stresses, such as the application of pesticides or elevation in water temperature, and could have led to their massive die-off in 1999.

Previous examination of lobster population structure in coastal American waters has not revealed the presence of extensive genetic differentiation. Previous work relied on mitochondrial DNA and allozyme markers with less resolution than the highly polymorphic microsatellite loci used in this study (Tracey et al. 1975, Harding et al. 1997). The recent development of highly polymorphic microsatellite loci for H. americanus allows for the examination of lobster population structure on a finer geographic range (Jones et al. 2003).

This is the first report of the examination of H. americanus genetic population structure through the use of highly polymorphic and heterozygotic microsatellite loci. In contrast to the work reported by Jones et al. (2003), the microsatellite loci examined in these experiments produced more alleles. This was likely caused by an increase in samples number (over 500 vs. 50 in the Jones work) that any changes in diversity.

Four out of the nine-microsatellite loci showed evidence of null alleles in samples collected from LIS and Hudson Canyon. This is in contrast to the low levels of null alleles reported by Jones et al. (2003) in the examination of H. americanus and H. gammarus collected in Canada and European waters. Null alleles--or nonamplified alleles can cause deviations from Hardy-Weinberg equilibrium and may bias both spatial and temporal population genetic analyses (Pemberton et al. 1995, Jones et al. 1998, Holm holm  
n. Chiefly British
An island in a river.



[Middle English, from Old Norse h
 et al. 2001). The cause of high levels of null alleles in these lobsters is unclear. After correction of the allele frequencies for null alleles by estimation BY ESTIMATION, contracts. In sales of land it not unfrequently occurs that the property is said to contain a certain number of acres, by estimation, or so many acres, more or less.  of the null frequency and adjustment of allele frequencies (van Oosterhout et al. 2004), there was a decrease in the alleles not at the Hardy-Weinberg equilibrium. The remaining nonconformity non·con·form·i·ty  
n. pl. non·con·form·i·ties
1.
a. Refusal or failure to conform to accepted standards, conventions, rules, or laws.

b.
 was found specifically in lobsters collected from central and eastern LIS and the Hudson Canyon area. The fact that some loci were in HWE and others were not is often interpreted as evidence for random mating ran·dom mating
n.
A population mating system in which every female gamete has an equal opportunity to be fertilized by every male gamete.
 and panmixia pan·mix·i·a or pan·mix·is
n.
Random mating within a breeding population.
. In such cases, deviation from HWE is assumed to be a locus-specific phenomenon, possibly a scoring error or null allele.

The analysis of genetic population differences with corrected allele frequencies showed that the eastern and central LIS lobster populations show slight evidence of genetic differentiation, suggesting ample gene flow between populations. The eastern and central LIS lobster populations also showed greater--but not significant--genetic differentiation with Hudson Canyon lobsters, suggesting a geographical component. Genetic subpopulations have been identified in the European lobster H. gammarus that reflect the levels of geographic isolation (Ulrich et al. 2001).

Examination of western LIS and Stratford Shoal lobster populations revealed a much greater level of genetic differentiation--by a factor of 10--from the eastern and central LIS and Hudson Canyon populations. This genetic differentiation is six times greater than what would be expected on the basis of geographic distance using the genetic differences between eastern and central Long Island Sound as a guide. Examination of microsatellite heterozygosity difference did not indicate that the western LIS populations were less heterozygous het·er·o·zy·gous
adj.
1. Having different alleles at one or more corresponding chromosomal loci.

2. Of or relating to a heterozygote.
 than the Hudson Canyon or other LIS populations.

The higher levels of genetic differentiation may be caused by processes, such as, development of pollution resistance, commercial fishing pressure or unique ecologic conditions, naturally occurring in western LIS but not eastern LIS (Howell et al. 2003). The differences may also be a result of the massive die-off in 1999, and the remaining lobsters provided the founder population for the subsequent generations. These experiments cannot differentiate between these two possibilities.

Additional experiments are required to determine if these genetic differences are temporally stable, and, if so, the factors responsible for maintaining these genetic differences. The restoration of lobster populations in western LIS will require a better understanding of the genetic population structure and the linkage between egg-bearing female lobsters and lobster larvae Larvae, in Roman religion
Larvae: see lemures.
 recruitment to establish which female populations are responsible for larvae populations.

ACKNOWLEDGMENTS

The authors thank Penny Howell and the scientists at the Connecticut DEP for the collection of egg-bearing female lobster pereiopods. This work was funded by the Connecticut DEP and the National Marine Fisheries Service The U.S. National Marine Fisheries Service (NMFS) is a United States federal agency. A division of the National Oceanic and Atmospheric Administration (NOAA) and the Department of Commerce, NMFS is responsible for the stewardship and management of the nation's living marine .

LITERATURE CITED

Baker, J. E. & R. T. Arbogast. 1995. Malathion resistance in field strains of the warehouse pirate bug (Heteroptera: Anthocoridae) and a prey species Tribolium castaneum (Coleoptera: Tenebrionidae). J. Ecol. Entomol. 88:241-245.

Brookfield, J. F. Y. 1996. A simple new method for estimating null allele frequency from heterozygote heterozygote (hĕt'ərōzī`gōt): see genetics.  deficiency. Mol. Ecol. 5:453-455.

Cockerham, C. C. & B. S. Weir. 1986. Estimation of inbreeding parameters i in stratified stratified /strat·i·fied/ (strat´i-fid) formed or arranged in layers.

strat·i·fied
adj.
Arranged in the form of layers or strata.
 populations. Ann. Hum. Genet genet: see civet. . 50:271-281.

Carvalho, G.R. & L. Hauser. 1994. Molecular genetics molecular genetics
n.
The branch of genetics that deals with hereditary transmission and variation on the molecular level.
 and the stock concept in fisheries. Rev. Fish Biol. Fish. 4:326-350.

Connecticut Department of Environmental Protection CT DEP. 2003. The status of the Long Island Sound lobster resource. In: N.C. Balcom, editor. Program and abstracts of the 3rd Long Island Sound lobster health symposium. March 7, Bridgeport, CT. Connecticut Sea Grant Publication No. CT-SG-03-03. pp. 2-4.

Cooper, R.A. & J.F. Uzmann. 1980. Ecology of juvenile and adult Homarus americanus. In: J.S. Cobb & B.F. Phillips, editors. The biology and management of lobsters. New York New York, state, United States
New York, Middle Atlantic state of the United States. It is bordered by Vermont, Massachusetts, Connecticut, and the Atlantic Ocean (E), New Jersey and Pennsylvania (S), Lakes Erie and Ontario and the Canadian province of
: Academic Press. pp. 215-276.

Crivello, J. F., D. F. Danila, E. Lorda, M. Keser & E. F. Roseman 2004. The genetic stock structure of larval and juvenile winter flounder flounder: see flatfish.
flounder

Any of about 300 species of flatfishes (order Pleuronectiformes). When born, the flounder is bilaterally symmetrical, with an eye on each side, and it swims near the sea's surface.
 (Pseudopleuronectes americanus) larvae in Connecticut waters of eastern Long Island Sound and estimations of larval entrainment entrainment /en·train·ment/ (en-tran´ment)
1. a technique for identifying the slowest pacing necessary to terminate an arrhythmia, particularly atrial flutter.

2.
. J. Fish Res. 64:1-15.

Dominion Nuclear Connecticut Inc. (DNC). 2002. Winter flounder studies. Monitoring the marine environment of Long Island Sound at Millstone Nuclear Power Station, Waterford, Connecticut Waterford is a town in New London County, Connecticut, United States. It is named after Waterford, Ireland. The population was 19,152 at the 2000 census. Geography
According to the United States Census Bureau, the town has a total area of 115.0 km² (44.4 mi²). 84.
. The 2001 Annual Report. pp. 167-287

French-Constant, R. H., N. Anthony, K. Aronstein, T. Rocbeleau & G. Stilwell 2000. Cyclodiene insecticide resistance: from molecular to population genetics Population genetics

The study of both experimental and theoretical consequences of mendelian heredity on the population level, in contradistinction to classical genetics which deals with the offspring of specified parents on the familial level.
. An. Rev. Entom. 48:447-464.

Goldstein, D. B. & D. D. Pollock. 1997. Launching microsatellites: a review of mutation processes and methods for phylogenetic phy·lo·ge·net·ic
adj.
1. Of or relating to phylogeny or phylogenetics.

2. Relating to or based on evolutionary development or history.
 inference. J. Hered. 88:335-342.

Harding, G. C., E. L. Kenchington, C. J. Bird, D. S. Pezzack & D. S. Landry. 1997. Genetic relationships among subpopulations of the American lobster (Homarus americanus) as revealed by random amplified polymorphic DNA. Can. J. Fish. Aquat. Sci. 54:1762-1771.

Hardy, O. J. & X. Vekemans. 1999. Isolation by distance in a continuous population: reconciliation between spatial auto-correlation analysis and population genetic models. Hered. 83:145-154.

Herrick, F. H. 1909. Natural history of the American lobster. Bull. U.S. Bureau Fish 29:149-408.

Holm, L. E., V. Loeschcke & C. Bendixen. 2001. Elucidation e·lu·ci·date  
v. e·lu·ci·dat·ed, e·lu·ci·dat·ing, e·lu·ci·dates

v.tr.
To make clear or plain, especially by explanation; clarify.

v.intr.
To give an explanation that serves to clarify.
 of the molecular basis of a null allele in a rainbow trout rainbow trout

Species (Oncorhynchus mykiss) of fish in the salmon family (Salmonidae) noted for spectacular leaps and hard fighting when hooked. It has been introduced from western North America to many other countries.
 microsatellite. Mar. Biotechnol. 3:555-560.

Howell, P., C. Giannini, K. Gottschall, D. Pacileo & J. Benway.2003. Assessment and monitoring of the American lobster resource and fishery in Long Island Sound. Semi-annual performance report, NOAA/ MNFS, NA16FWI FWI Fire Weather Index
FWI French West Indies
FWI Families and Work Institute
FWI Financial Women International
FWI Forest Fire Weather Index
FWI Freshwater Institute (Shepherdstown, WV, USA)
FWI Flying While Intoxicated
238.

Jones, A. G., C. A. Stockwell, D. Walker & J. Avise. 1998. The molecular basis of a microsatellite null allele from the white sands pupfish The White Sands pupfish (Cyprinodon tularosa) is a species of fish in the Cyprinodontidae family. It is endemic to the United States. Source
  • Gimenez Dixon, M. 1996. Cyprinodon tularosa. 2006 IUCN Red List of Threatened Species.
. J. Hered. 89:339-342.

Jones, M.W., P. T. O'Reilly, A. A. McPherson, T. L. McParland, D. E. Armstrong, A. J. Cox, K. R. Spence, E. L. Kenchington, C. T. Taggart & P. Benzten. 2003. Development, characterization, inheritance, and cross-species utility of American lobster (Homarus americanus) microsatellite and mtDNA PCR-RFLP PCR-RFLP Polymerase Chain Reaction–Restriction Fragment Length Polymorphism  markers. Genome 46:59-69.

Pemberton, J. M., D. R. Bancroft & J. A. Barrett. 1995. Nonamplifying alleles at microsatellite loci: A caution for parentage PARENTAGE. Kindred. Vide 2 Bouv. Inst. n. 1955; Branch; Line.  and population studies. Mol. Ecol. 4:249-252.

Raymond, M. & F. Rousset. 1995. GenePop Version 1.2: population genetics software for exact tests and ecumenicism ec·u·men·i·cism  
n.
Ecumenism.



ecu·meni·cist n.
. J. Hered. 86:248-249.

Ronfort, J., E. Jenczewski, T. Bataillion, & F. Rousset. 1998. Analysis of population structure in autotetraploid species. Genetics 150:921-930.

Rousset, F. 1996. Equilibrium values of measures of population subdivision for stepwise stepwise

incremental; additional information is added at each step.


stepwise multiple regression
used when a large number of possible explanatory variables are available and there is difficulty interpreting the partial regression
 mutation processes. Genetics 142:1357-1362.

Schroeder, W.C. 1959. The lobster, Homarus americanus, and the red crab Red crab is a common name of two species of crabs:
  • Dungeness crab (Cancer magister)
  • Christmas Island red crab (Gecarcoidea natalis)
, Geryon quinquedens, in the offshore waters of western North Atlantic. Deep Sea Res. 5:266-282.

Slatkin, M. 1995. A measure of population subdivision based on microsatellite allele frequencies. Genetics 139:1463-1476.

Sokal, R. R. & F. J. Rohlf. 1995. In: Biometry biometry /bi·om·e·try/ (bi-om´e-tre) the application of statistical methods to biological phenomena.

bi·om·e·try
n.
The statistical analysis of biological data. Also called biometrics.
. New York: WH Freeman.

Thorpe, J. P., A.M. Sole-Cara & P.C. Watts. 2000. Exploited marine invertebrates: genetics and fisheries. Hydrobiologia 420:165-184.

Tracey, M. L., K. Nelson, D. Hedgecock, R. A. Shleser & M. Pressick. 1975. Biochemical genetics of lobsters: genetic variation and the structure of the American lobster (Homarus americanus) populations. J. Fish. Res. Board Can. 32:2091-2101.

Ulrich, I., J. Mueller, C. Schuett, & F. Buchholz. 200i. A study of population genetics in the European lobster, Homarus gammarus (Decapoda, Nephropidae). Crustaceana 74:825-837.

van Oosterhout, C., W. F. Hutchinson, D. P. M. Wills, & P. Shipley. 2004. Micro-checker software for identifying and correcting genotyping Genotyping refers to the process of determining the genotype of an individual with a biological assay. Current methods of doing this include PCR, DNA sequencing, and hybridization to DNA microarrays or beads.  errors in microsatellite data. Mol. Ecol. 4:535-538.

Wright, S. 1969. Evolution and the genetics of populations, vol. 2. In: The theory of gene frequencies. Chicago: University of Chicago Press The University of Chicago Press is the largest university press in the United States. It is operated by the University of Chicago and publishes a wide variety of academic titles, including The Chicago Manual of Style, dozens of academic journals, including . 511 pp.

JOSEPH F. CRIVELLO, (1) * DONALD F. LANDERS JR. (2) AND MILAN Milan, prince and king of Serbia
Milan (Milan Obrenović) (mĭl`än ōbrĕ`nəvĭch), 1854–1901, prince (1868–82) and king (1882–89) of Serbia; grandnephew of Miloš Obrenović.
 KESER (2)

(1) Department of Physiology and Neurobiology Neurobiology

Study of the development and function of the nervous system, with emphasis on how nerve cells generate and control behavior. The major goal of neurobiology is to explain at the molecular level how nerve cells differentiate and develop their
, University of Connecticut The University of Connecticut is the State of Connecticut's land-grant university. It was founded in 1881 and serves more than 27,000 students on its six campuses, including more than 9,000 graduate students in multiple programs.

UConn's main campus is in Storrs, Connecticut.
, 3107 Horse Barn Hill Road, Storrs, Connecticut 06269; (2) Millstone Power Station, Resource Services Inc., Environmental Laboratory, Waterford, Connecticut 06385

* Corresponding author. E-mail: Joseph.Crivello@uconn.edu
TABLE 1.
Sites for the collection of lobster pereiopod.

Site                          Lat/Long (a)               Season (b)

Hudson Canyon      39[degrees] 31' to 39[degrees] 45'    Spring
Eastern LIS        41[degrees] 17' to 41[degrees] 20'    Spring
                   72[degrees] 09' to 72[degrees] 10'    Summer
Central LIS        41[degrees] 02' to 41[degrees] 11'    Spring
Stratford Shoals   41[degrees] 04' to 41[degrees] 07'    Spring
Western LIS        40[degrees] 59' to 41[degrees] 14'    Spring
                   72[degrees] 59' to 73[degrees] 50'    Summer
Total

                   Number of Collected
Site               Lobster Pereiopods         Label

Hudson Canyon              137           Hudson
Eastern LIS                105           Eastern-1
                            28           Eastern-2
Central LIS                135           Central
Stratford Shoals             9           Stratford Shoals
Western LIS                 11           Western-1
                            82           Western-2
Total                      507

(a) Latitude and longitude values are given for an approximate
rectangular area in which collections occurred.

(b) Lobser pereiopods collected before July 1st were included in the
spring group. those collected after July 1st were included in the
summer group.

TABLE 2.
Primers and PCR conditions, microsatellite sizes and number of alleles.

Loci     Primer Sequences (5' [right arrow] 3')

Ham-6    D2-CATGCAGGTATACACAGACACACTC
         ACTGTGTTGACTTAATCTGGAGAAA
Ham-9    D3-CTGGCTCCATGCATACCC
         CAAGCGGCTACATAACTTTTCGTG
Ham-10   D4-CTATCTACAAGGTCATATGTTCAGTT
         CACAACACACCTTTTATACGATT
Ham-15   D2-CTGCGCCATTAGAGGACA
         GTTGCCATCAGGGTGTTC
Ham-21   D3-TTACTCACTCAACGGCACT
         GACTTGCGGTGTGAAAA
Ham-22   D4-GAGGCAAACATACAAATAGACACA
         GTTTGTCCCTTATTTTCTGGT
Ham-30   D2-CCTTTTATATTCTATCTATCTATCTCTG
         GTTTAACCGGACCAGAC
Ham-48   D3-TTCTGAAAGTTTGACGGGTTA
         ACACGTACACACAGGGATTG
Ham-53   D4-GGCATCCCATAGTGAAGG
         ATTTGCGTTTTTGTTTCATTT

         Product
         Length
         (base      Annealing    Allele
Loci     pairs)    T[degrees]C   Number

Ham-6    102-160       60          19

Ham-9    140-206       58           9

Ham-10   120-188       50          18

Ham-15   68-148        52          17

Ham-21   68-136        53          16

Ham-22   68-144        55           9

Ham-30   68-144        55          13

Ham-48   76-148        54          15

Ham-53   106-160       58          19

[D.sub.2], [D.sub.3] & [D.sub.4] refer to fluorescent tags on the
forward primer.

TABLE 3.
Summary statistics for nine microsatellite loci surveyed in lobsters
at indicated locations.

                               Ham-6             Ham-9
Hudson
N = 137
[Het.sub.Obs]                      0.8759            0.5547
[Het.sub.Est]                      0.9218            0.7507
HWE P value [+ or -] SE            0.0010            0.0000
                          [+ or -] 0.0004   [+ or -] 0.0000
Corrected *                        0.0033            0.0053
                          [+ or -] 0.0001   [+ or -] 0.0006
Eastern-1
N = 105
[Het.sub.Obs]                      0.9047            0.4762
[Het.sub.Est]                      0.9228            0.7300
HWE P value [+ or -] SE            0.4387            0.0000
                          [+ or -] 0.0090   [+ or -] 0.0000
Corrected *                        0.4567            0.0421
                          [+ or -] 0.0094   [+ or -] 0.0011
Eastern-2
N = 28
[Het.sub.Obs]                      0.8571            0.5714
[Het.sub.Est]                      0.8982            0.7836
HWE P value [+ or -] SE            0.3391            0.0375
                          [+ or -] 0.0055   [+ or -] 0.0018
Corrected *                        0.4256            0.0512
                          [+ or -] 0.0061   [+ or -] 0.0017
Central
N = 135
[Het.sub.Obs]                      0.8222            0.5037
[Het.sub.Est]                      0.9286            0.7959
HWE P value [+ or -] SE            0.0003            0.0000
                          [+ or -] 0.0001   [+ or -] 0.0000
Corrected *                        0.0512            0.0331
                          [+ or -] 0.0004   [+ or -] 0.001
Stratford
N = 9
[Het.sub.Obs]                      0.8888            0.4444
[Het.sub.Est]                      0.9542            0.5622
HWE P value [+ or -] SE            0.3741            0.0592
                          [+ or -] 0.0061   [+ or -] 0.0008
Corrected *                        0.4321            0.0672
                          [+ or -] 0.0054   [+ or -] 0.0012
Western-1
N = 11
[Het.sub.Obs]                      0.9090            0.8182
[Het.sub.Est]                      0.9263            0.7727
HWE P value [+ or -] SE            0.5786            0.8320
                          [+ or -] 0.0043   [+ or -] 0.0019
Corrected *                        0.6432            0.8453
                          [+ or -] 0.0067   [+ or -] 0.0007
Western-2
N = 82
[Het.sub.Obs]                      0.9012            0.5062
[Het.sub.Est]                      0.9065            0.6728
HWE P value [+ or -] SE            0.0181            0.0465
                          [+ or -] 0.0020   [+ or -] 0.0017
Corrected *                        0.0561            0.0673
                          [+ or -] 0.0067   [+ or -] 0.0066

                              Ham-10            Ham-15
Hudson
N = 137
[Het.sub.Obs]                      0.5766            0.8102
[Het.sub.Est]                      0.8507            0.8936
HWE P value [+ or -] SE            0.0000            0.0328
                          [+ or -] 0.0000   [+ or -] 0.0035
Corrected *                     --                   0.0543
                                            [+ or -] 0.0031
Eastern-1
N = 105
[Het.sub.Obs]                      0.7810            0.6667
[Het.sub.Est]                      0.8696            0.8082
HWE P value [+ or -] SE            0.0000            0.0001
                          [+ or -] 0.0000   [+ or -] 0.0001
Corrected *                     --                   0.0231
                                            [+ or -] 0.0033
Eastern-2
N = 28
[Het.sub.Obs]                      0.6786            0.8214
[Het.sub.Est]                      0.8039            0.8807
HWE P value [+ or -] SE            0.0000            0.1699
                          [+ or -] 0.0000   [+ or -] 0.0053
Corrected *                     --                   0.2345
                                            [+ or -] 0.0064
Central
N = 135
[Het.sub.Obs]                      0.7407            0.8593
[Het.sub.Est]                      0.8907            0.9018
HWE P value [+ or -] SE            0.0000            0.0585
                          [+ or -] 0.0000   [+ or -] 0.0048
Corrected *                     --                   0.0617
                                            [+ or -] 0.0004
Stratford
N = 9
[Het.sub.Obs]                      0.6667            0.6667
[Het.sub.Est]                      0.5756            0.9211
HWE P value [+ or -] SE            0.8552            0.0201
                          [+ or -] 0.0009   [+ or -] 0.0008
Corrected *                     --                   0.0456
                                            [+ or -] 0.0078
Western-1
N = 11
[Het.sub.Obs]                      0.7273            0.8182
[Het.sub.Est]                      0.8364            0.8636
HWE P value [+ or -] SE            0.1513            0.2263
                          [+ or -] 0.0012   [+ or -] 0.0027
Corrected *                     --                   0.2235
                                            [+ or -] 0.0034
Western-2
N = 82
[Het.sub.Obs]                      0.6543            0.8025
[Het.sub.Est]                      0.7988            0.8790
HWE P value [+ or -] SE            0.0000            0.0318
                          [+ or -] 0.0000   [+ or -] 0.0025
Corrected *                     --                   0.0578
                                            [+ or -] 0.0011

                              Ham-21            Ham-22
Hudson
N = 137
[Het.sub.Obs]                      0.7299            0.5912
[Het.sub.Est]                      0.8458            0.8363
HWE P value [+ or -] SE            0.0000            0.0000
                          [+ or -] 0.0000   [+ or -] 0.0000
Corrected *                     --                --

Eastern-1
N = 105
[Het.sub.Obs]                      0.7524            0.7333
[Het.sub.Est]                      0.8007            0.8294
HWE P value [+ or -] SE            0.0011            0.0001
                          [+ or -] 0.0005   [+ or -] 0.0001
Corrected *                     --                --

Eastern-2
N = 28
[Het.sub.Obs]                      0.8214            0.6429
[Het.sub.Est]                      0.8700            0.7921
HWE P value [+ or -] SE            0.0719            0.0026
                          [+ or -] 0.0026   [+ or -] 0.0002
Corrected *                     --                --

Central
N = 135
[Het.sub.Obs]                      0.7259            0.7556
[Het.sub.Est]                      0.8016            0.8381
HWE P value [+ or -] SE            0.0003            0.0000
                          [+ or -] 0.0003   [+ or -] 0.0002
Corrected *                     --                --

Stratford
N = 9
[Het.sub.Obs]                      0.4444            0.6667
[Het.sub.Est]                      0.8367            0.7256
HWE P value [+ or -] SE            0.0010            0.3481
                          [+ or -] 0.0001   [+ or -] 0.0013
Corrected *                     --                --

Western-1
N = 11
[Het.sub.Obs]                      0.8182            0.8182
[Het.sub.Est]                      0.9273            0.7818
HWE P value [+ or -] SE            0.1645            0.8222
                          [+ or -] 0.0032   [+ or -] 0.0019
Corrected *                     --                --

Western-2
N = 82
[Het.sub.Obs]                      0.5556            0.7284
[Het.sub.Est]                      0.7593            0.8111
HWE P value [+ or -] SE            0.0000            0.0002
                          [+ or -] 0.0000   [+ or -] 0.0000
Corrected *                     --                --

                              Ham-30            Ham-48
Hudson
N = 137
[Het.sub.Obs]                      0.5255            0.4380
[Het.sub.Est]                      0.7588            0.8042
HWE P value [+ or -] SE            0.0000            0.0000
                          [+ or -] 0.0000   [+ or -] 0.0000
Corrected *                     --                   0.0059
                                            [+ or -] 0.0001
Eastern-1
N = 105
[Het.sub.Obs]                      0.5619            0.5905
[Het.sub.Est]                      0.7502            0.8209
HWE P value [+ or -] SE            0.0003            0.0000
                          [+ or -] 0.0002   [+ or -] 0.0000
Corrected *                     --                   0.0378
                                            [+ or -] 0.0051
Eastern-2
N = 28
[Het.sub.Obs]                      0.4286            0.5714
[Het.sub.Est]                      0.7036            0.8193
HWE P value [+ or -] SE            0.0000            0.0460
                          [+ or -] 0.0000   [+ or -] 0.0027
Corrected *                     --                   0.0567
                                            [+ or -] 0.0039
Central
N = 135
[Het.sub.Obs]                      0.6074            0.6148
[Het.sub.Est]                      0.8068            0.8324
HWE P value [+ or -] SE            0.0000            0.0001
                          [+ or -] 0.0000   [+ or -] 0.0001
Corrected *                     --                   0.0345
                                            [+ or -] 0.0007
Stratford
N = 9
[Het.sub.Obs]                      0.7778            0.6667
[Het.sub.Est]                      0.7911            0.9089
HWE P value [+ or -] SE            0.6488            0.0144
                          [+ or -] 0.0020   [+ or -] 0.006
Corrected *                     --                   0.0345
                                            [+ or -] 0.0089
Western-1
N = 11
[Het.sub.Obs]                      0.4545            0.9091
[Het.sub.Est]                      0.6000            0.8818
HWE P value [+ or -] SE            0.0594            0.5329
                          [+ or -] 0.0010   [+ or -] 0.0026
Corrected *                     --                   0.5676
                                            [+ or -] 0.0034
Western-2
N = 82
[Het.sub.Obs]                      0.3580            0.8395
[Het.sub.Est]                      0.5642            0.8531
HWE P value [+ or -] SE            0.0000            0.0038
                          [+ or -] 0.0000   [+ or -] 0.0006
Corrected *                     --                   0.0356
                                            [+ or -] 0.0009

                              Ham-53
Hudson
N = 137
[Het.sub.Obs]                      0.8540
[Het.sub.Est]                      0.9202
HWE P value [+ or -] SE            0.0006
                          [+ or -] 0.0003
Corrected *                     --

Eastern-1
N = 105
[Het.sub.Obs]                      0.8857
[Het.sub.Est]                      0.9371
HWE P value [+ or -] SE            0.0751
                          [+ or -] 0.0044
Corrected *                     --

Eastern-2
N = 28
[Het.sub.Obs]                      0.7500
[Het.sub.Est]                      0.9214
HWE P value [+ or -] SE            0.0092
                          [+ or -] 0.0005
Corrected *                     --

Central
N = 135
[Het.sub.Obs]                      0.8222
[Het.sub.Est]                      0.9124
HWE P value [+ or -] SE            0.0000
                          [+ or -] 0.0000
Corrected *                     --

Stratford
N = 9
[Het.sub.Obs]                      0.6667
[Het.sub.Est]                      0.6144
HWE P value [+ or -] SE            0.0068
                          [+ or -] 0.0006
Corrected *                     --

Western-1
N = 11
[Het.sub.Obs]                      0.7273
[Het.sub.Est]                      0.8727
HWE P value [+ or -] SE            0.0733
                          [+ or -] 0.0020
Corrected *                     --

Western-2
N = 82
[Het.sub.Obs]                      0.7531
[Het.sub.Est]                      0.9049
HWE P value [+ or -] SE            0.0005
                          [+ or -] 0.0002
Corrected *                     --

Hardy-Weinberg equilibrium assumes the "null hypothesis" that the
observed genotype frequencies are not significantly different from
those predicted for a population in equilibrium. A P value less than
0.05 indicate that they are significantly different and the loci are
not at HWE. Loci not at HWE equilibrium are in italics.

* The Hardy-Weinberg equilibrium was recalculated for several of the
loci after correction for null alleles as described by Van Oosterhout
et al. (2004). Only those loci shown to have null alleles (Table 4)
were reanalyzed for compliance to Hardy-Weinberg equilibrium.

TABLE 4.
Presence of null alleles in microsatellite loci.

             Presence
             Null of
Loci         Alleles    Brookfield-1   Corrected *

Ham-6          +        0.0693           0.0514
Ham-9          +        0.1495           0.0725
Ham-10         -        0.0469             --
Ham-15         +        0.1104           0.0511
Ham-21         -        0.0252             --
Ham-22         -        0.0315             --
Ham-30         -        0.0411             --
Ham-48         +        0.1144           0.0612
Ham-53         -        0.0461             --

A value greater than 0.05 indicates the presence of null alleles.
The Brookfield-1 algorithm ignores all null alleles as degraded DNA,
human error, or other reasons for nonamplification other than the
presence of a  true null allele homozygote.

* Statistically corrected values as described by Van Oosterhout
et al (2004).

TABLE 5.
Genetic differences between sampled populations from LIS and the
Hudson Canyon.

                                              [delta]
Location           Vs.         [F.sub.ST]   [[mu].sup.2]   [R.sub.ST]

Hudson      Stratford Shoals     0.0275        0.1085       0.0321
  Canyon    Western-1            0.2000        0.1058       0.0236
Eastern-1   Central              0.0033        0.0141       0.0045
            Hudson Canyon        0.0033        0.0168       0.0049
            Stratford Shoals     0.0391        0.1618       0.0441
            Western-1            0.0192        0.1009       0.0233
Eastern-2   Eastern-1            0.0029        0.0021       0.0034
            Central              0.0033        0.0141       0.0043
            Hudson Canyon        0.0045        0.0283       0.0055
            Stratford Shoals     0.0227        0.0696       0.0328
            Western-1            0.0289        0.0786       0.0277
            Western-2            0.0277        0.0654       0.0331
Central     Hudson Canyon        0.0051        0.0248       0.0051
            Stratford Shoals     0.0406        0.1745       0.0452
            Western-1            0.0215        0.1377       0.0313
Stratford
  Shoals    Western-1            0.0366        0.1166       0.0412
Western-2   Eastern-1            0.0145        0.0366       0.0241
            Central              0.0111        0.0451       0.0216
            Hudson Canyon        0.0205        0.0731       0.0289
            Stratford Shoals     0.0106        0.0393       0.0156
            Western-1            0.0169        0.0690       0.0278
COPYRIGHT 2005 National Shellfisheries Association, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2005, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Author:Keser, Milan
Publication:Journal of Shellfish Research
Geographic Code:1U2NY
Date:Oct 1, 2005
Words:5605
Previous Article:The contribution of egg-bearing female American lobster (Homarus americanus) populations to lobster larvae collected in Long Island Sound by...
Next Article:Long-term population trends in American lobster (Homarus americanus) and their relation to temperature in Long Island Sound.
Topics:



Related Articles
A method for assessing removal of foreign particles from the blood by fixed phagocytes of the American lobster, Homarus americanus.
Nuclear small-subunit ribosomal RNA gene-based characterization, molecular phylogeny and PCR detection of the neoparamoeba from Western Long Island...
Isolation of mitochondrial cytochrome B gene and development of a real-time quantitative PCR assay for detecting Neoparamoeba aestuarina.
Culture-dependent characterization of the microbial community associated with epizootic shell disease lesions in American lobster, Homarus americanus.
A description of the pathology of epizootic shell disease in the American lobster, Homarus americanus, H. Milne Edwards 1837.
Response of the American lobster to the stress of shell disease.
A prolonged thermal stress experiment on the American lobster, Homarus americanus.
Resmethrin immunotoxicity and endocrine disrupting effects in the American lobster (Homarus americanus) upon experimental exposure.
The contribution of egg-bearing female American lobster (Homarus americanus) populations to lobster larvae collected in Long Island Sound by...
Long-term population trends in American lobster (Homarus americanus) and their relation to temperature in Long Island Sound.

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles