Printer Friendly
The Free Library
5,676,108 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Subchronic exposure to TCDD, PeCDF, PCB126, and PCB153: effect on hepatic gene expression.


We employed DNA microarray to identify unique hepatic gene expression patterns associated with subchronic exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and other halogenated halogenated

pertaining to a substance to which a halogen is added.


halogenated salicylanilides
see rafoxanide, clioxanide.
 aromatic hydrocarbons (HAHs). Female Harlan Sprague-Dawley rats were exposed for 13 weeks to toxicologically equivalent doses of four different HAHs based on the toxic equivalency factor of each chemical: TCDD (100 ng/kg/day), 2,3,4,7,8-pentachlorodibenzofuran (PeCDF; 200 ng/kg/day), 3,3',4,4',5-pentachlorobiphenyl (PCB PCB: see polychlorinated biphenyl.
PCB
 in full polychlorinated biphenyl

Any of a class of highly stable organic compounds prepared by the reaction of chlorine with biphenyl, a two-ring compound.
126; 1,000 ng/kg/day), or 2,2',4,4',5,5'hexachlorobiphenyl (PCB153; 1,000 [micro]g/kg/day). Global gene expression profiles for each exposure, which account for 8,799 gene probe sets contained on Affymetrix RGU RGU The Robert Gordon University (Aberdeen, Scotland)
RGU Responsible Governmental Unit
RGU Revenue-Generating Unit
34A GeneChips, were compared by principal components analysis. The aryl hydrocarbon receptor The Aryl hydrocarbon receptor (AhR) is member of the family of basic-helix-loop-helix transcription factors. AhR is a cytosolic transcription factor that is normally inactive, bound to several co-chaperones.  (AhR) ligands TCDD, PeCDF, and PCB126 produced very similar global gene expression profiles that were unique from the nonAhR ligand PCB153, underscoring the extensive impact of AhR activation and/or the resulting hepatic injury on global gene expression in female rat liver. Many genes were co-expressed during the 13-week TCDD, PeCDF, or PCB126 exposures, including classical AhR-regulated genes and some genes not previously characterized as being AhR regulated, such as carcinoembryonic-cell adhesion molecule 4 (C-CAM4) and adenylate adenylate /aden·yl·ate/ (ah-den´i-lat) the dissociated form of adenylic acid.

a·den·yl·ate
n.
A salt or ester of AMP.



adenylate

a salt, anion or ester of adenylic acid.
 cydase-associated protein 2 (CAP2). Real-time reverse-transcriptase polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is  confirmed the increased expression of these genes in TCDD-, PeCDF-, and PCB126-exposed rats as well as the up- or downregulation of several other novel dioxin-responsive genes. In summary, DNA microarray successfully identified dioxin-responsive genes expressed after exposure to AhR ligands (TCDD, PeCDF, PCB126) but not after exposure to the non-AhR ligand PCB153. Together, these findings may help to elucidate some of the fundamental features of dioxin toxicity and may further clarify the biologic role of the AhR signaling pathway. Key words: AhR, HAH, liver, microarray, PCB, TCDD. Environ Health Perspect 112:1636-1644 (2004). doi:10.1289/txg.7253 available via http://dx.doi.org/[Online 22 September 2004]

**********

2,3,7,8-Tetrachlorodibenzo-p-dioxin (dioxin, TCDD) is a persistent environmental contaminant contaminant /con·tam·i·nant/ (kon-tam´in-int) something that causes contamination.

contaminant

something that causes contamination.
, a human and rodent carcinogen carcinogen: see cancer.
carcinogen

Agent that can cause cancer. Exposure to one or more carcinogens, including certain chemicals, radiation, and certain viruses, can initiate cancer under conditions not completely understood.
, and the most potent ligand for the aryl hydrocarbon receptor gene (AhR) (Fingerhut et al. 1991; Gu et al. 2000; Kociba et al. 1978; McGregor et al. 1998). The AhR gene also displays affinity for structurally related xenobiotics, including polychlorinated dibenzo-p-dioxins (PCDDs), polychlorinated dibenzofurans (PCDFs), and coplanar co·pla·nar  
adj.
Lying or occurring in the same plane. Used of points, lines, or figures.



copla·nar
 polychlorinated biphenyls polychlorinated biphenyls, (pol´ēklôr´nā´tid bīfē´n  (PCBs) (Denison et al. 2002). Ligand binding and activation of AhR induces nuclear localization Customizing software and documentation for a particular country. It includes the translation of menus and messages into the native spoken language as well as changes in the user interface to accommodate different alphabets and culture. See internationalization and l10n.  and heterodimerization with the AhR nuclear transporter (ARNT) protein (Whitlock 1999). This activated heterodimer binds to cognate cognate

describes two biomolecules that normally interact such as an enzyme and its normal substrate or a receptor and its normal ligand.


cognate cooperation
 cis-acting sequences [dioxin response elements (DREs)], located in the 5'-regulatory region of target genes.

A specific subgroup of genes are activated by an AhR-dependent mechanism during dioxin exposure, including (but not limited to) cytochrome P450 (CYP CYP

In currencies, this is the abbreviation for the Cyprus Pound.

Notes:
The currency market, also known as the Foreign Exchange market, is the largest financial market in the world, with a daily average volume of over US $1 trillion.
)1A1 CYP1A CYP1A Cytochrome P450 1A 1, CYP1A2, CYP1B1, aldehyde dehydrogenase (ADH ADH: see antidiuretic hormone. ), NADPH-quinoneoxidoteductase (NQO1), glutathione S-transferase (GST GST
abbr.
Greenwich sidereal time


GST (in Australia, New Zealand, and Canada) Goods and Services Tax
) Ya (GSTA GSTA Giant Screen Theater Association (now Giant Screen Cinema Association)
GSTA Garden State Towman’s Association
GSTA Ground Surveillance & Target Acquisition
1), and UDP-glucuronosyltransferase 1A1 (UGT UGT
abbr.
urgent (telegram)
1A1) (Manjunath and Dufresne 1988; Mimura and Fujii-Kuriyama 2003; Schrenk 1998; Sutter and Greenlee 1992). AhR-dependent transcription is required for dioxin toxicity (Bunger et al. 2003), but it is unclear how activation of AhR-dependent genes produces the multiplicity of toxic responses characteristic of dioxin exposure.

As an attempt to characterize AhR-dependent genes and signaling pathways responsible for subchronic dioxin toxicity, the present study evaluated differential hepatic gene expression in female Harlan Sprague-Dawley (SD) rats exposed subchronically (13 weeks) to toxicologically equivalent doses of the AhR ligands TCDD (100 ng/kg/day), 2,3,4,7,8-pentachlorodibenzofuran (PeCDF; 200 ng/kg/day), 3,3',4,4',5-pentachlorobiphenyl (PCB 126; 1,000 ng/kg/day), or the non-AhR ligand 2,2', 4,4', 5,5'-hexachlorobiphenyl (PCB153; 1,000 [micro]g/kg/day). This gene expression study was performed in conjunction with a cancer bioassay Bioassay

A method for the quantitation of the effects on a biological system by its exposure to a substance, as well as the quantitation of the concentration of a substance by some observable effect on a biological system.
 conducted by the National Toxicology Program National Toxicology Program Environment A program that conducts toxicologic tests on substances frequently found at the EPA's National Priorities List sites, which have the greatest potential for human exposure  (NTP (Network Time Protocol) A TCP/IP protocol used to synchronize the real time clock in computers, network devices and other electronic equipment that is time sensitive. It is also used to maintain the correct time in NTP-based wall and desk clocks. ), which included interim sacrifices (13, 30, and 52 weeks) to investigate tissue dosimetry dosimetry /do·sim·e·try/ (do-sim´e-tre) scientific determination of amount, rate, and distribution of radiation emitted from a source of ionizing radiation, in biological d. , histopathology his·to·pa·thol·o·gy
n.
The science concerned with the cytologic and histologic structure of abnormal or diseased tissue.


Histopathology
The study of diseased tissues at a minute (microscopic) level.
, and other biochemical and molecular responses throughout the 2-year study.

Subchronic TCDD exposure is associated with numerous toxic responses, and many of these responses may be AhR dependent. Kociba et al. (1976) showed previously that SD rats exposed to high levels of TCDD (1 [micro]g/kg/day) for 13 weeks were subject to mortality, chloracne chloracne /chlor·ac·ne/ (klor-ak´ne) an acneiform eruption due to exposure to chlorine compounds.

chlor·ac·ne
n.
, thymic thymic /thy·mic/ (thi´mik) pertaining to the thymus.

thy·mic
adj.
Of or relating to the thymus.



thymic

pertaining to the thymus.
 atrophy, and a "wasting syndrome" characterized by rapid weight loss and fat redistribution. Antioxidant antioxidant, substance that prevents or slows the breakdown of another substance by oxygen. Synthetic and natural antioxidants are used to slow the deterioration of gasoline and rubber, and such antioxidants as vitamin C (ascorbic acid), butylated hydroxytoluene  enzyme expression was enhanced in rats exposed to lower doses of TCDD for 13 weeks (10-46 ng/kg/day; Hassoun et al. 2003), and the hepatotoxic hep·a·to·tox·ic
adj.
Damaging or destructive to the liver.



hepatotoxic

causing liver damage.
 biomarkers serum bilirubin Bilirubin

The predominant orange pigment of bile. It is the major metabolic breakdown product of heme, the prosthetic group of hemoglobin in red blood cells, and other chromoproteins such as myoglobin, cytochrome, and catalase.
 and alkaline phosphatase were elevated in rats exposed to intermediate doses for the same exposure period (100 ng/kg/day TCDD; Kociba et al. 1976). Rats exposed to TCDD for 13 weeks (100 ng/kg/day) also developed cachexia cachexia /ca·chex·ia/ (kah-kek´se-ah) a profound and marked state of constitutional disorder; general ill health and malnutrition. , hepatic hypertrophy hypertrophy (hīpûr`trəfē), enlargement of a tissue or organ of the body resulting from an increase in the size of its cells. Such growth accompanies an increase in the functioning of the tissue. , and altered hepatic foci (Kociba et al. 1976), whereas chronic exposure (104 weeks) at this dose resulted in porphyria Porphyria

comes in a winter storm to show her devotion, and her lover strangles her with her own tresses. [Br. Poetry: Browning Porphyria’s Lover in Magill IV, 247]

See : Love, Unrequited
 and cancer of the liver Noun 1. cancer of the liver - malignant neoplastic disease of the liver usually occurring as a metastasis from another cancer; symptoms include loss of appetite and weakness and bloating and jaundice and upper abdominal discomfort
liver cancer
, lung, and oral mucosa (Kociba et al. 1978; NTP 2004a). Although AhR activation likely contributes to the many toxicologic effects produced by subchronic and chronic TCDD exposures, little is known about AhR and non-AhR signaling mechanisms mediating these effects.

The TCDD, PeCDF, and PCB126 exposure doses used in this study were carcinogenic carcinogenic

having a capacity for carcinogenesis.
 to female SD rats, but tumors and other hepatotoxic effects were not evident until several months after the 13-week interim sacrifice (NTP 2004a, 2004b, 2004c). Thus, evaluation of differential gene expression patterns after 13-week exposures to subchronic halogenated aromatic hydrocarbons (HAHs) may yield important clues about the mechanisms by which these chemicals produce their chronic toxicologic effects, including cancer. Although there have been several attempts to evaluate TCDD-dependent gene expression in vitro and in vivo (Fisher et al. 2004; Frueh et al. 2001; Martinez et al. 2002; Puga et al. 2000), to our knowledge, this is the first of such to characterize gene expression during long-term, subchronic exposure to carcinogenic doses of TCDD and other dioxin-like chemicals.

Materials and Methods

Sample Procurement

Tissues for this study were provided by the NTP (2004a, 2004b, 2004c) as part of a 2-year bioassay for relative carcinogenic potencies of dioxin-like chemicals. Female Harlan SD rats were exposed 5 days a week by oral garage to toxicologically equivalent doses of TCDD [toxic equivalency factor (TEF TEF Tracheoesophageal fistula, see there ) = 1.0; 3, 10, 22, 46, 100 ng/kg/day], PeCDF (TEF = 0.5; 6, 20, 44, 92, 200 ng/kg/day), PCB126 (TEF = 0.1; 10, 30, 100, 175, 300, 550, 1,000 ng/kg/day), PCB153 (TEF = 0, N/A; 10, 100, 300, 1,000 [micro]g/kg/day), or corn oil:acetone acetone (ăs`ĭtōn), dimethyl ketone (dīmĕth`əl kē`tōn), or 2-propanone (prō`pənōn), CH3COCH3  (99:1; vehicle control). Toxicologic dose equivalence was based on the current World Health Organization TEF recommendations (Van den Berg Van den Berg is the surname of:
  • Rudolf van den Berg (born 1949), Dutch director
  • Albert van den Berg (born 1976), South African rugby player
  • Jan Hendrik van den Berg (born 1914), Dutch psychologist
  • Janwillem van den Berg (1920-1985), Dutch speech scientist
 et al. 1998). Subgroups of rats were sacrificed at 14, 31, and 53 weeks (corresponding to 13, 30, or 52 weeks of exposure), and target organs were removed, flash frozen in liquid nitrogen, and stored at -70[degrees]C for mechanistic studies.

RNA RNA: see nucleic acid.
RNA
 in full ribonucleic acid

One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic
 Isolation and Hybridization hybridization /hy·brid·iza·tion/ (hi?brid-i-za´shun)
1. crossbreeding; the act or process of producing hybrids.

2. molecular hybridization

3.


The present study used liver from female rats exposed to vehicle control or the highest dose of each compound for 13 weeks to ensure that hepatic gene expression was evaluated in the context of carcinogenic exposure doses for TCDD, PeCDF, and PCB126. Frozen hepatic tissue was disrupted by homogenization homogenization (həmŏj'ənəzā`shən), process in which a mixture is made uniform throughout. Generally this procedure involves reducing the size of the particles of one component of the mixture and dispersing them evenly  with a rotor statot homogenizer A laboratory equipment for the homogenization of various types of material, such as tissue, plant, food, soil, and many others. Many different models have been developed using various physical technologies for the disruption. , and total RNA was isolated with Qiagen RNeasy columns Qiagen Inc., Valencia, CA). There were a total of six rats in each exposure group. Three pools of RNA were created from each exposure group (n = 2 rats per pool), similar to the experimental design of Yechoor et al. (2002). Pooled total RNA was further purified using the Qiagen poly(A) RNA isolation kit. RNA integrity was assessed by the Agilent Bioanalyzer 2100 (Agilent Technologies, Palo Alto, CA). This study employed high-quality RNA that displayed two distinct, sharp peaks and a 28S/18S ribosomal RNA ratio greater than 1. Poly(A) RNA was transformed into labeled cRNA by the Roswell Park Cancer Institute The Roswell Park Cancer Institute is a cancer research and treatment center located in Buffalo, New York. Founded in 1898 by Dr. Roswell Park, it was the first dedicated medical facility for cancer treatment and research in the United States.  Microarray and Genomics Core Facility (Buffalo, NY). cRNA from each pool was fragmented and its quality evaluated with Affymetrix GeneChip Test3 arrays (Santa Clara, CA) by comparing 3':5' signal ratios of housekeeping genes. High-quality cRNA (3':5' signal ratio near 1) was subsequently hybridized to Affymetrix RGU34A GeneChips, and chips were scanned with the Affymetrix 428 scanner.

Data Analysis

Cell intensity files (.CEL CEL Cellular
CEL Celestial
CEL Check Engine Light
CEL Degrees Celsius (temperature)
CEL Comisión Ejecutiva Hidroeléctrica del Río Lempa (El Salvador)
CEL Center for Entrepreneurial Leadership
) files were generated with Affymetrix Microarray Suite (MAS) 5.0 software (Affymetrix) and probe-level data were background subtracted and normalized, and gene expression was summarized using the MAS 5.0 algorithm included in the Bioconductor Affy package for R, version 1.6.1 (Ihaka and Gentleman 1996). Gene expression data from n = 3 GeneChips in each exposure group were averaged, and changes in gene expression were calculated as the average change versus gene expression for the n = 3 GeneChips from the vehicle-treated control group. Cluster analysis was performed with TIGR TIGR The Institute for Genomic Research
TIGR Treasury Investment Growth Receipt
TIGR This Is Getting Ridiculous
TIGR Thermally Induced Gallium Removal
TIGR TSPI Interface for GPS/RAJPO
 Microarray Experiment Viewer (Saeed et al. 2003). The gene expression profiles associated with TCDD, PeCDF, PCB126, and PCB153 exposures were assessed by principal components analysis (PCA (tool, programming) PCA - A dynamic analyser from DEC giving information on run-time performance and code use. ) with the covariance Covariance

A measure of the degree to which returns on two risky assets move in tandem. A positive covariance means that asset returns move together. A negative covariance means returns vary inversely.
 value distance metric (Raychaudhuri et al. 2000) to evaluate relationships between exposure groups. Genes co-expressed during various exposure conditions were identified by Pavlidis template matching (PTM PTM Post-Translational Modifications
PTM Porsche Traction Management
PTM Point-To-Multipoint
PTM Please Tell Me
PTM Packet Transfer Mode
PTM Pulse-Time Modulation
PTM Portugal The Man (band)
PTM Predictive Technology Model
; Pavlidis and Noble 2001). For each PTM analysis, gene expression profile templates were constructed by designating relative gent expression ratios for each exposure condition. Gene expression data were filtered for genes that matched each template based on the Pearson correlation (R [greater than or equal to] 0.9). Template matching genes were subjected to Euclidean distance hierarchical clustering. Genes were annotated with GenBank accession numbers by Affymetrix MAS 5.0 and TIGR Resourcerer gene annotation tool (Tsai et al. 2001), and official gene names were provided by the Rat Genome Database The Rat Genome Database (also known as RGD) is a collection of genetic and genomic information on the rat. Development and maintenance of RGD is funded by the United States National Institutes of Health and hosted at the Medical College of Wisconsin.  (http://rgd.mcw.edu/). Expressed sequence tags without annotation were filtered from PTM outputs, thus restricting gene sets to annotated genes. Promoters of selected genes were mapped for DREs using MatInspector Professional (Quant Quant

A person with numerical and computer skills who carries out quantitative analyses of companies.


quant

A person who has strong skills in mathematics, engineering, or computer science, and who applies those skills to the securities
 et al. 1995). Quantitative gene expression estimates obtained by microarray analysis were validated by two-step real-time reverse-transcriptase polymerase chain reaction (RTPCR RTPCR Reverse Transcriptase Polymerase Chain Reaction ) for selected genes.

Real-Time RT-PCR RT-PCR

reverse transcriptase-polymerase chain reaction. See PCR1.
 Validation of Gene Expression

Reverse transcriptase reactions (80 [micro]L) contained 20 [micro]g total RNA, 0.5 mM dNTP mix, and 15 ng/[micro]L random primers, 1x first-strand buffer, 10 mM dithiothreitol, 27 U Rnasin RNase inhibitor (Promega, Madison, WI), and 800 U superscript Any letter, digit or symbol that appears above the line. For example, 10 to the 9th power is written with the 9 in superscript (109). Contrast with subscript.  reverse transcriptase (Invitrogen). A mixture containing total RNA, dNTPs, and random primers was heated to 65[degrees]C for 5 min to denature de·na·ture
v.
1. To change the nature or natural qualities of.

2. To render unfit to eat or drink without destroying usefulness in other applications, especially adding methyl alcohol to ethyl alcohol.

3.
 the RNA and then immediately placed on ice. The remaining components of the reaction mixture were then added to the RNA, and cDNA synthesis was performed at 42[degrees]C for 60 min. Reactions were terminated by heating to 70[degrees]C for 10 min.

PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
 primers were selected from GenBank database sequences with Primer3 software (Rozen and Skaletsky 2000). Primer sequences were between 20 and 22 bp, contained at least one 3'-GC clamp, displayed a maximal [T.sub.m] (melting temperature) difference of 1[degrees]C, a maximal poly-X value of 3, maximal 3'-complementarity of 2, and a [T.sub.m], between 60 and 62[degrees]C. Nonspecific nonspecific /non·spe·cif·ic/ (non?spi-sif´ik)
1. not due to any single known cause.

2. not directed against a particular agent, but rather having a general effect.


nonspecific

1.
 mispriming was managed by a mispriming threshold of 10.0 in the rodent mispriming library. The primer sequences used in the present study are shown in Table 1.

Real-time PCR was performed with the SYBR Green PCR kit from Applied Biosystems (Foster City, CA) according to the manufacturer's instructions. PCR reactions (25 [micro]L) contained diluted eDNA, 1x SYBR Green buffer, 3 mM [MgCl.sub.2], 0.2 mM dNTP mix, 0.2 [micro]M left and right primers, 10 nM fluorescein fluorescein /flu·o·res·ce·in/ (fldbobr-res´en) a fluorescing dye; its sodium salt is used as a tracer in retinal angiography and as a diagnostic aid for revealing corneal trauma and fitting contact lenses. , and 1.1 U of Amplitaq Gold polymerase. The reaction was initiated by incubation at 95[degrees]C for 10 min and followed by 40 cycles of denaturation denaturation, term used to describe the loss of native, higher-order structure of protein molecules in solution. Most globular proteins exhibit complicated three-dimensional folding described as secondary, tertiary, and quarternary structures.  at 95[degrees]C for 15 sec and primer annealing/extension at 60[degrees]C for 1 min. Sample fluorescence was evaluated during the annealing/extension step. Upon completion of thermocycling, the specificity of each reaction was evaluated by melting analysis. Samples were heated to 95[degrees]C for 2 min and cooled to 55[degrees]C. The temperature was maintained at 55[degrees]C for 15 sec to analyze sample fluorescence, and the temperature was increased by increments of 0.5[degrees]C followed by 15 sec of fluorescence analysis for a total of 80 cycles.

The efficiency of each primer set was validated over a range of cDNA concentrations. Primer pairs that demonstrated reaction efficicncies between 85 and 103%, concentration vs. fluorescence slope factors between -1.3 and -1.7, and concentration versus fluorescence correlation coefficients between 0.98 and 1.0 were accepted for further use. After primer validation, PCR reactions were performed with a single cDNA concentration, and the threshold cycle ([C.sub.t]) was determined for each reaction. The difference ([DELTA][C.sub.t]) between the threshold cycle for the target gene and endogenous control gene (18S RNA) was calculated for each sample, and the 18S normalized relative expression of each gene was calculated by the comparative method according to the Applied Biosystems' User Bulletin No. 2 for the ABI Abi (ā`bī) [short for Abijah], in the Bible, King Hezekiah's mother.


(Application Binary Interface) A specification for a specific hardware platform combined with the operating system.
 Prism Sequence Detection System (Applied Biosystems), as described by Imasato et al. (2002).

Results

Dosimetry and Liver Pathology from the NTP Cancer Bioassay

Tissue dosimetry and liver pathology for each 13-week HAH exposure are detailed in Table 2. The dosimetry values indicate that the AhR ligands (TCDD, PeCDF, PCB126) exhibit more pronounced hepatic accumulation, relative to administered dose, than does the non-AhR ligand PCB153. It is important to note that the exposure to PCB153 is in micrograms per kilogram per day ([micro]g/kg/day), whereas the level of PCB153 in the liver is in units of nanograms per gram of liver (ng/g liver), supporting the greatly reduced relative hepatic accumulation of PCB153. Preferential hepatic accumulation of TCDD, PeCDF, and PCB126 is consistent with CYP1A2 serving as a sequestering Particle Physics
In particle physics, sequestering is a procedure of isolating different types of physical processes or different particle species by separating them geometrically in additional dimensions of space.
 protein for AhR ligands (Van den Berg et al. 1994). There was a statistically significant increase in the incidence of hepatic hypertrophy for all exposures compared with the respective vehicle control animals. Liver hypertrophy was mild to moderate among female rats from the TCDD exposure group, minimal to mild in the PCB126 exposure group, and minimal in rats exposed to PeCDF or PCB153. A limited and nonsignificant non·sig·nif·i·cant  
adj.
1. Not significant.

2. Having, producing, or being a value obtained from a statistical test that lies within the limits for being of random occurrence.
 number of animals exposed to TCDD for 13 weeks displayed multinucleated multinucleated

characterized by having more than one nucleus per cell.


multinucleated giant cell
see giant cell.
 hepatocytes.

There was an increased incidence and severity of liver hypertrophy for the TCDD and PCB126 exposures relative to the other AhR ligand, PeCDF. PTM was employed to identify genes associated with the more pronounced hepatic hypertrophy in the TCDD and PCB126 groups relative to the PeCDF group (Figure 1). We were unable to identify genes that were selectively repressed re·pressed
adj.
Being subjected to or characterized by repression.
, but we did identify a limited subset of genes selectively induced by TCDD and PCB126 compared with PeCDF. These genes were functionally classified as neurotransmitter and endocrine signaling genes.

Effects of HAH Exposure on Global Hepatic Gene Expression

TCDD, PeCDF, and PCB126 activate AhR, whereas PCB153 displays little or no binding affinity for AhR. PCA was employed to determine whether the relationship between global gene expression profiles for each chemical would be related to their AhR affinities (Figure 2). The principal components for TCDD, PeCDF, and PCB 126 exposures were spatially co-localized along the x-axis of the PCA plot (PeCDF and PCB126 were localized to the same quadrant, whereas TCDD was proximally located in the adjacent quadrant). The principal component for the PCB 153 exposure was unique from those of AhR ligands.

Because the global gene expression profile associated with PCB 153 exposure differed from that of TCDD, PeCDF, and PCB126, PTM was employed to identify genes that were selectively induced or repressed by PCB153 (Figure 3). PCB 153 does not bind to AhR, and genes activated or repressed during PCB153 exposure are likely regulated by an AhR-independent mechanism. Liver from PCB153-exposed rats exhibited a unique class of differentially expressed genes compared with rats exposed to AhR ligands, with CFP 1. CFP - Constraint Functional Programming.
2. CFP - Communicating Functional Processes.
3. CFP - Call For Papers (for a conference).
2BI being the most up-regulated by PCB153. PCB153 exposure also produced the differential expression of proinflammatory genes interleukin 2 (IL2) and interleukin 1 (ILl) and myxovirus myxovirus

Any of a group of viruses that are agents of influenza and can cause the common cold, mumps, and measles in humans, canine distemper, rinderpest in cattle, and Newcastle disease in fowl.
 (influenza virus) resistance (MX1) and apoptosis-related genes B-cell leukemia/lymphoma 2 (BCL-2) and Weel a. & adv. 1. Well.
n. 1. A whirlpool.
1. A kind of trap or snare for fish, made of twigs.
 tyrasine kinase (WEE1).

Global hepatic gene expression profiles of animals exposed to PeCDF more closely resembled those of PCB126-exposed animals than of TCDD-exposed animals, indicating that PeCDF and PCB126 may co-regulate a unique group of genes that are not differentially expressed relative to TCDD exposure. This subgroup of genes may be activated by an AhR-independent mechanism unique to PeCDF and PCB126. PTM was used to identify genes that were selectively activated by PeCDF and PCB126 compared with TCDD (Figure 4). A total of 29 different genes were identified, all of which were mutually induced by PeCDF and PCB126. These genes included those coding for metabolic enzymes (cytochrome P450 15-beta gene, CYP2C39, NADH dehydrogenase) and oxidative stress response genes [catalase catalase /cat·a·lase/ (kat´ah-las) a hemoprotein enzyme that catalyzes the decomposition of hydrogen peroxide to water and oxygen, protecting cells.  (CAT), cytochrome c oxidase The enzyme cytochrome c oxidase or Complex IV (PDB 2OCC, EC 1.9.3.1) is a large transmembrane protein complex found in bacteria and the mitochondrion. Function
It is the last protein in the electron transport chain.
 (COX)].

[FIGURE 4 OMITTED]

PTM was also employed to identify genes co-expressed during TCDD, PeCDF, and PCB126 exposures because differential expression of these genes may be associated with AhR-mediated pathology (Figure 5). Many of the

TCDD-inducible genes identified by PTM represented classic dioxin-inducible genes, including CYP1A1, CYP1B1, CFP1A2, NAD NAD: see coenzyme. (P)H-menadione oxidoreductase oxidoreductase /ox·i·do·re·duc·tase/ (ok?si-do-re-duk´tas) any of a class of enzymes that catalyze the reversible transfer of electrons from a substrate that becomes oxidized to one that becomes reduced (oxidation-reduction, or redox , immunoglobulin M, and UDP UDP (uridine diphosphate): see uracil.


(User Datagram Protocol) A protocol within the TCP/IP protocol suite that is used in place of TCP when a reliable delivery is not required.
 glycosyltransferase 1 family, polypeptide polypeptide: see peptide.  A1. Although cytochrome c oxidase has been associated with TCDD induction, COX8H represents a novel dioxin-inducible isoform of this gene. Carcinoembryonic-cell adhesion molecule 4 (U-CAM4) and adenylate cyclase-associated protein 2 (CAP2) were also induced during TCDD, PeCDF, and PCB 126 exposures. Several genes were coordinately down-regulated by TCDD, PeCDF, and PCB126 but not by PCB153, including epidermal growth factor Epidermal growth factor or EGF is a growth factor that plays an important role in the regulation of cell growth, proliferation and differentiation. Human EGF is a 6045 Da protein with 53 amino acid residues and three intramolecular disulfide bonds.  and

[FIGURE 5 OMITTED]

C-CAM4 and CAP2 were highly induced by all three AhR ligands but have not been linked to AhR-mediated transcriptional regulation. The enhanced expression of C-CAM4 and CAP2 was verified by real-time RT-PCR (Table 3). To determine whether C-CAM4 and CAP2 are direct AhR target genes, the 5'-regulatory sequences of these genes were modeled by MatInspector Professional to identify potential cis-acting DRE DRE
Digital rectal examination.

Mentioned in: Rectal Examination
 sequences within these gene promoters. Neither gene promoter contained DRE consensus sequences.

The expression of several additional genes was also verified by real-time RT-PCR (Table 3). In general, there was relatively good association between the up- or down-regulation of genes according to Affymetrix GeneChip analysis and real-time RT-PCR methods. CYP1B1, C-CAM4, and CAP2 were consistently increased in livers of rats exposed to AhR ligands (TCDD, PeCDF, PCB126), whereas livers of PCB153-exposed rats exhibited little or no change. CYP3A9 and serine serine (sĕr`ēn), organic compound, one of the 20 amino acids commonly found in animal proteins. Only the l-stereoisomer appears in mammalian protein.  proteinase proteinase /pro·tein·ase/ (pro´ten-as?) endopeptidase.

pro·tein·ase
n.
A protease that begins the hydrolytic breakdown of proteins usually by splitting them into polypeptide chains.
 inhibitor, clade clade Cladus, subtype Genetics A branch of biological taxa or species that share features inherited from a common ancestor; a single phylogenetic group or line. See Inheritance, Species.  A (SERPIN7A) were down-regulated by exposure to AhR ligands, whereas somatostatin Somatostatin

A naturally occurring regulatory peptide that carries out numerous functions in the human body, including the inhibition of growth hormone secretion from the anterior pituitary gland.
 was down-regulated by exposure to AhR ligands and PCB 153. Real-time RT-PCR also suggests that carboxylesterase 3 (CES3) was down-regulated by AhR ligands.

Discussion

The TEF classification scheme has been used for many years to facilitate risk assessment for individual congeners and mixtures of dioxin-like PCDDs, PCDFs, and PCBs (Becher et al. 1998; Finley et al. 2003; Flesch-Janys et al. 1998; Van den Berg et al. 1998). However, there is some question about whether TEF values are predictive of long-term toxicologic end points, including cancer (Safe 1994). The present study evaluated hepatic gene expression during a 13-week interim sacrifice from a 2-year chronic toxicity and carcinogenicity carcinogenicity /car·ci·no·ge·nic·i·ty/ (kahr?si-no-je-nis´i-te) the ability or tendency to produce cancer.

carcinogenicity

the ability or tendency to produce cancer.
 study of TCDD, PeCDF, PCB126, and PCB153 in female Harlan SD rats. The TCDD, PeCDF, and PCB126 exposures from this study produced cholangiocarcinoma, hepatocellular adenoma, toxic hepatopathy, multinucleated hepatocytes, diffuse fatty change, and liver pigmentation pigmentation, name for the coloring matter found in certain plant and animal cells and for the color produced thereby. Pigmentation occurs in nearly all living organisms.  after 2 years of exposure (NTP 2004a, 2004b, 2004c). Liver tumor incidence was not equivalent among AhR ligands but instead was higher in animals exposed to TCDD and PCB126 compared with animals exposed to PeCDF at toxicologically equivalent doses. Similar results were seen for the incidence and severity of hepatic hypertrophy at 13 weeks, where PeCDF produced less hypertrophy than TCDD and PCB126 (Table 2). The 13-week PeCDF exposure also induced substantially less CYP1B1 mRNA compared with TCDD and PCB126, as shown by RT-PCR (Table 3). Thus, it is possible that enhanced AhR activation by TCDD and PCB126 may be responsible for the increased liver pathology of TCDD- and PCB126-exposed rats compared with PeCDF-exposed rats. Consistent with these findings, our laboratory previously reported more CYP1-mediated ethoxyresorufin-O-deethylase activity in liver microsomes from TCDD- and PCB126-exposed female SD rats compared with PeCDF-exposed rats after 13 weeks of exposure (Shubert et al. 2002). Thus, the 200 ng/kg/day PeCDF exposure is less effective in activating AhR-dependent gene expression and less toxic regarding hepatic hypertrophy and carcinogenicity compared with 100 ng/kg/day TCDD and 1,000 ng/kg/day PCB126 exposures.

An alternative possibility of the enhanced toxicity of TCDD and PCB126 exposures compared with PeCDF is that these chemicals activate a unique subgroup of genes that is not activated by PeCDF, thus enhancing toxicity. In support of this possibility, DNA microarray analysis revealed a subset of differentially expressed genes in TCDD- and PCB126-exposed rat liver that were relatively unchanged during PeCDF exposure (Figure 1). These genes were functionally related to neurotransmitter and neuroendocrine neuroendocrine /neu·ro·en·do·crine/ (-en´do-krin) pertaining to neural and endocrine influence, and particularly to the interaction between the nervous and endocrine systems.

neu·ro·en·do·crine
adj.
 signaling. Activation of neuroendocrine signaling by TCDD has been demonstrated in other tissues, including monkey hypothalamus hypothalamus (hī'pəthăl`əməs), an important supervisory center in the brain, rich in ganglia, nerve fibers, and synaptic connections. It is composed of several sections called nuclei, each of which controls a specific function.  and rodent pituitary pituitary /pi·tu·i·tary/ (pi-too´i-tar?e)
1. hypophysial.

2. pituitary gland; see under gland.


anterior pituitary  adenohypophysis.
 and adrenal adrenal /ad·re·nal/ (ah-dre´n'l)
1. paranephric.

2. adrenal gland.

3. pertaining to an adrenal gland.


ad·re·nal
adj.
1.
 (Pitt et al. 2000; Shridhar et al. 2001). Subchronic exposure to TCDD and PCB126 may therefore stimulate hepatic neuroendocrine signaling. Activation of hepatic neuroendocrine cells by these chemicals may also be a symptom or contributor to chemical-induced liver hypertrophy, which was substantially less in PeCDF-exposed rats.

[FIGURE 1 OMITTED]

AhR activation by PCDDs, PCDFs, and coplanar PCBs is a hallmark of exposure to dioxin-like chemicals and is likely implicated im·pli·cate  
tr.v. im·pli·cat·ed, im·pli·cat·ing, im·pli·cates
1. To involve or connect intimately or incriminatingly: evidence that implicates others in the plot.

2.
 in their toxicity. AhR activation has also been attributed to the direct activation of some dioxin-responsive genes (Mimura and Fujii-Kuriyama 2003; Schrenk 1998; Sutter and Greenlee 1992). However, there is little knowledge regarding how many genes are activated or repressed in an AhR-dependent mechanism during subchronic exposure to AhR ligands. The present study used PCA to address relationships between exposure to traditional AhR ligands (TCDD, PeCDF, and PCB126) and the non-AhR ligand PCB153. PCA has been previously employed to compare genomic profiles of toxicants (Heijne et al. 2003), identify common molecular effects among potential drug candidates (Shi et al. 2000), and predict treatment prognosis (Ringberg et al. 2001). PCA revealed a unique association among hepatic gene expression profiles produced by exposure to dioxin-like toxicants, where global gene expression profiles for rats exposed to PeCDF and PCB126 were verv similar and closely related to the gene expression profile for TCDD exposure (Figure 2). The global gene expression profile for exposure to the noncoplanar PCB153, however, was substantially different from that of the dioxin-like AhR ligands. Prominent differences between PCB153-mediated and AhR-ligand--mediated gene expression suggest that subchronic exposure to TCDD, PeCDF, and PCB 126 has an extensive impact on global hepatic gene expression that involves many genes. Furthermore, it is important to note that the expression or repression of the genes examined may result from direct regulation by the AhR, events further downstream from a direct regulation of some gene by the AhR, and/or a response to the tissue injury resulting from the genes directly or indirectly regulated by the dioxin-like chemicals via the AhR.

[FIGURE 2 OMITTED]

PCB153 is the most prevalent PCB congener congener /con·ge·ner/ (kon´je-ner) something closely related to another thing, as a member of the same genus, a muscle having the same function as another, or a chemical compound closely related to another in composition and exerting  in biologic tissues (Kimbrough 1995; Krogaenas et al. 1998; Safe 1994). It is also extraordinarily persistent and its half-life may exceed 100 years in marine sediments (Jonsson et al. 2003). PCB153 exposure has been associated with various biologic effects including developmental toxicity (Kuchenhoff et al. 1999) and induction of CFP2B1 and other phenobarbital-responsive genes (Connor et al. 1995). Although PCB153 does not bind to AhR and produced minimal hepatic hypertrophy after 13 weeks of subchronic exposure, PCB153 did promote differential expression of several biomarker genes for liver injury (Figure 3). Thus, gene expression profiling may be a more sensitive gauge of PCB153 toxicity than standard histology, and this hypothesis will be tested with low-dose PCB153 exposures in future experiments. PCB153 activates an acquired immune response in mice (Smialowicz et al. 1997). PCB153 exposure in this study was associated with differential gene expression of proinflammatory cytokines Cytokines
Chemicals made by the cells that act on other cells to stimulate or inhibit their function. Cytokines that stimulate growth are called "growth factors.
, including IL1, IL2, and the immune response gene immune response gene
n.
A gene in the major histocompatibility complex that controls a cell's immune response to specific antigens.
 MX1. PCB153 exposure decreased expression of the apoptotic genes BCL-2 and WEE1. BCL-2 and WEE1 are responsive to p53 and are down-regulated during apoptosis (Bishay et al. 2000; Leach et al. 1998). PCB153 exposure selectively enhanced expression of cAMP response element modulator Modulator

Any device or circuit by means of which a desired signal is impressed upon a higher-frequency periodic wave known as a carrier. The process is called modulation. The modulator may vary the amplitude, frequency, or phase of the carrier.
 (CREM CREM Corporate Real Estate Management
CREM Classified Removable Electronic Media
CREM cAMP Response Element Modulator
CREM Center for Rural Emergency Medicine (West Virginia University) 
) protein. CREM gene activation is a signature response to liver regeneration after hepatocyte hepatocyte /hep·a·to·cyte/ (hep´ah-to-sit?) a hepatic cell.

hep·a·to·cyte
n.
A parenchymal liver cell.


Hepatocyte
A liver cell.
 injury. CREM mRNA is increased after partial hepatectomy hep·a·tec·to·my
n.
Excision of liver tissue.



hepatectomy

surgical excision of liver tissue.

hepatectomy Surgery Segmental resection of the liver Indications Cancer, parasites, major trauma–eg, MVAs
 in wild-type mice and liver regeneration is inhibited in CRE CRE Commercial Real Estate
CRE Corporate Real Estate
CRE Commission for Racial Equality (Scotland)
CRE CCD (Charge Coupled Device) and Readout Electronics
CRE Camp Response Element
[M.sup.(-/-]) mice (Servillo et al. 1998). The identification of these and other PCB153-responsive genes in the present study provides new targets for future mechanistic studies of PCB 153 toxicity.

[FIGURE 3 OMITTED]

The mutual AhR binding affinity of TCDD, PeCDF, and PCB126 is likely responsible for strong similarity between global gene expression profiles produced by these chemicals. However, PCA also revealed that gene expression profiles associated with PCB126 and PeCDF exposures were more closely related to each other than to TCDD. On the basis of this finding, it is possible that PeCDF and PCB126 activate a unique group of genes not activated during TCDD exposure.

We identified a limited subset of genes activated by PeCDF and PCB126 but not TCDD (Figure 4). Induction of CAT, cytochrome [b.sub.5] (CYB CYB Canada Year Book (Historical Collection)
CYB Cayman Brac Island, Cayman Islands (Airport Code)
CYB Cover Your Butt
CYB Carlsbad Youth Baseball (Carlsbad, California) 
5), and COX oxidatative stress response genes (Poulsen et al. 2000) suggests that PeCDF and PCB126 exposures are capable of inducing oxidative stress. PeCDF and PCB126 also induced growth arrest and DNA-damage-inducible 45 (Gadd45) expression, a DNA-damage--inducible gene product (Sheikh sheikh
 or shaykh

Among Arabic-speaking tribes, especially Bedouin, the male head of the family, as well as of each successively larger social unit making up the tribal structure. The sheikh is generally assisted by an informal tribal council of male elders.
 et al. 2000). Induction of Gadd45 during PeCDF and PCB 126 exposures may indicate oxidative DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 damage in liver from animals exposed to these toxicants. Oxidative stress was previously reported during AhR activation (Dalton et al. 2002). Interestingly, however, oxidative stress response genes were not activated in livers from animals exposed to TCDD in the present study. It is interesting that PeCDF produced less hypertrophy than did TCDD, yet was more effective in activating the expression of oxidative stress response genes. These data may indicate that PeCDF and PCB126 exposures promote oxidative stress through a unique, AhR-independent mechanism and/or that the responses are secondary to liver injury produced during the subchronic exposure.

[FIGURE 4 OMITTED]

AhR activation plays a critical role in many end points of TCDD toxicity [Agency for Toxic Substances and Disease Registry The United States Agency for Toxic Substances and Disease Registry, (ATSDR) is an agency for the U.S. Department of Health and Human Services that is directed by a congressional mandate to perform specific functions concerning the effect on public health of hazardous  (ATSDR ATSDR Agency for Toxic Substances & Disease Registry ) 1998; Hahn 2002; Mimura and Fujii-Kuriyama 2003; Van den Berg et al. 1998]. PCA from the present study suggests that subchronic exposure to AhR ligands causes differential expression of numerous genes. Although a few AhR target genes have been identified in previous studies, many members of the AhR gene battery remain unknown. Genomic and proteomic approaches provide valuable opportunities to elucidate additional genes involved in AhR signal transduction and hepatotoxic responses to dioxin-like chemicals.

PTM revealed genes specifically induced or repressed by AhR ligands TCDD, PeCDF, and PCB126 but not by PCB153 (Figure 5). Many of these genes were previously classified as being dioxin responsive, which validated the efficacy of the PTM approach and further verified RNA sample integrity. PTM also revealed several genes, including C-CAM4, CAP2, SERPIN7A, CES3, and expressed sequence tags (ESTs) not yet associated with the AhR signaling pathway (Table 3).

[FIGURE 5 OMITTED]

C-CAM4 represents a novel dioxinresponsive gene. In the present study, C-CAM4 was selectively induced in rats exposed to AhR ligands, but not in rats exposed to PCB153, and was among the genes most highly up-regulated by TCDD exposure (Table 3, Figure 5). C-CAM4 does not contain a promoter-based DRE sequence, which suggests that it may not be regulated directly by AhR.

C-CAM4 is a recent addition to the carcinoembryonic antigen (CEA CEA carcinoembryonic antigen.

CEA
abbr.
carcinoembryonic antigen


CEA (Carcinoembryonic antigen) 
) family of cell adhesion molecules (Earley et al. 1996). CEA immunoglobulins demonstrate important roles in growth and differentiation. Although most soluble CEA molecules are unable to mediate intercellular intercellular /in·ter·cel·lu·lar/ (-sel´u-lar) between or among cells.

in·ter·cel·lu·lar
adj.
Located among or between cells.
 associations, C-CAM4 actively promotes cell adhesion (Lin et al. 1998). C-CAM1 is a secretory secretory /se·cre·to·ry/ (se-kre´tah-re) (se´kre-tor?e) pertaining to secretion or affecting the secretions.

se·cre·to·ry
adj.
Relating to or performing secretion.
 paralog of C-CAM4, is expressed during hepatocyte differentiation (Cheung et al. 1993; Thompson et al. 1993), and is selectively down-regulated in hepatocellular carcinoma (Cheung et al. 1993; Thompson et al. 1993). TCDD has been associated with hepatocellular carcinoma in female Spartan SD rats (Kociba et al. 1978) and with hepatocellular adenoma and cholangiocarcinoma in a recent NTP study of female Harlan SD rats (NTP 2004a). The NTP study also found evidence of other hepatotoxic responses after 2 years of chronic exposure to TCDD, including hepatocyte hypertrophy, multinucleated hepatocyte, diffuse fatty change, bile duct hyperplasia, bile duct cyst cyst, abnormal sac in the body, filled with a fluid or semisolid and enclosed in a membrane. Cysts can be congenital but are usually acquired, the most common locations being the skin and the ovaries. , oval cell hyperplasia, necrosis, pigmentation, inflammation, nodular nodular

marked with, or resembling, nodules.


nodular dermatofibrosis
see dermatofibrosis.

nodular episcleritis
see nodular fasciitis (below).

nodular fasciitis
a firm painless nodular swelling, 0.
 hyperplasia, portal fibrosis, cholangiofibrosis, and toxic hepatopathy (NTP 2004a). No major evidence for hepatotoxicity hepatotoxicity (hepˑ··tō·t  was observed after 13 weeks of exposure to TCDD, but livers from female rats exposed for this time period were hypertrophic Hypertrophic
Enlarged.

Mentioned in: Heart Failure


hypertrophic

characterized by a state of hypertrophy.


hypertrophic pulmonary osteoarthropathy
see hypertrophic osteopathy.
. The increased expression of secreted C-CAM4 in these rats may suggests that TCDD initiates a cellular transition from membrane-bound U-CAM1 expression in normal tissue to secreted C-CAM4 expression during hypertrophy and neoplastic neoplastic /neo·plas·tic/ (ne?o-plas´tik)
1. pertaining to a neoplasm.

2. pertaining to neoplasia.


neoplastic

pertaining to neoplasia or a neoplasm.
 transformation. Although C-CAM4 may be a potential marker for disrupted cell differentiation in livers of animals exposed to dioxin-like toxicants, it will be important in future studies to investigate protein expression in conjunction with gene expression

Like C-CAM4, CAP2 is a novel dioxin-responsive gene that exhibits dynamic activation in the presence of AhR ligands (Table 3, Figure 5). The CAP2 promoter is also devoid of XRE XRE XUL Runtime Environment
XRE eXtreme Reactive Environment
 sequences. CAP2 mRNA is expressed at moderate to low levels in normal rat liver tissue (Swiston et al. 1995) but is markedly induced by TCDD and related compounds. It is unclear whether CAP2 activity is implicated in the preneoplastic hepatotoxic effects of dioxin in rats, but a yeast homolog hom·o·log  
n.
Variant of homologue.
 of CAP2 associates with the actin cytoskeleton cytoskeleton

System of microscopic filaments or fibres, present in the cytoplasm of eukaryotic cells (see eukaryote), that organizes other cell components, maintains cell shape, and is responsible for cell locomotion and for movement of the organelles within it.
 (Lila and Drubin 1997), is responsible for the posttranslational post·trans·la·tion·al  
adj.
Of or relating to a substance or process, such as the addition of sugar groups to form a glycoprotein, that occurs or is formed after translation of protein: a posttranslational modification. 
 posttranslational processing of Ras, and serves as an effector effector /ef·fec·tor/ (e-fek´ter)
1. an agent that mediates a specific effect.

2. an organ that produces an effect in response to nerve stimulation.
 for Rasdependent activation of adenylyl cyclase cyclase /cy·clase/ (si´klas) an enzyme that catalyzes the formation of a cyclic phosphodiester.

cy·clase
n.
An enzyme that acts as a catalyst in the cyclization of a compound.
 (Shima et al. 1997). Ras expression was increased in altered hepatic loci from a diethyl nitrosamine/TCDD tumor initiation and promotion study (Sills et al. 1994). A Ras-related mechanism suppressed CY-P1A1 expression, potentially serving as a negative feedback mechanism that rectifies CYP1A1 levels in the presence of TCDD (Reiners et al. 1997). Although the AhR pathway may indeed have cross talk with the adenylyl cyclase pathway, the specific details of these interactions are unclear. CAP2 may play an important role in this signaling cross talk and warrants further characterization. As with C-CAM4, future studies will investigate protein expression in conjunction with the expression of this gene.

This study represents one of the first attempts to characterize hepatic gene expression in the context of subchronic exposure to carcinogenic doses of dioxin-like chemicals. DNA microarrays and/or RT-PCR successfully identified novel dioxin-responsive genes that were either up-or down-regulated after exposure to AhR ligands (TCDD, PeCDF, PCB126) but not after exposure to the non-AhR ligand PCB153. Future studies are needed to assess the species- and tissue-specific expression of these genes and their respective functional proteins to establish whether these differentially expressed genes may be a response to and/or lead to the carcinogenic and/or noncarcinogenic effects of these compounds in humans and laboratory animals. Together, these findings may help to elucidate some of the fundamental features of dioxin toxicity and may further clarify the biologic role of the enigmatic AhR signaling pathway.
Figure 1. Hepatic genes differentially expressed during TCDD and PCB126
exposures but not during PeCDF exposure. Acc. no., GenBank accession
number. PTM was used to identify genes co-expressed after exposure to
TCDD and PCB126 but not PeCDF for 13 weeks. Matching genes conformed
to a template where the relative expression ratios for toxicant versus
vehicle exposure were PeCDF = 0.2, TCDD = 1, and PCB126 = 1 ([r.sup.2]
= 0.9). The PTM output was further refined to include only those genes
differentially expressed [greater than or equal to] 2-fold in livers
of rats exposed to TCDD and PCB126 compared with vehicle control
animals. (A) PTM diagram showing co-expressed genes. The color key
indicates the magnitude of change. (B) Average fold changes for n = 3
Affymetrix GeneChips (each chip represents pooled RNA from two
animals). Accession numbers and gene names are from GenBank
(http://www.ncbi.nlm.nih.gov/entrez./query.fcgi?db=nucleotide),

Acc. no.    Gene name

U60145      Fragile X mental retardation 1
X67108      Brain derived neurothrophic factor
L20682      Erythroblastosis virus E26 oncogene homolog 1 (avian)
M12492      Type IIb subunit of cAMPdependent protein kinase
U09401      Tenascin C
M31178      Calbindin 1
M85301      Solute carrier family 9, member 4
M35162      Gamma-aminobutyric acid A receptor, delta
S39221      N-methyl-D-aspartate receptor
U89514      Calpain 9
AA866238    Similar to Acyl carrier protein, mitochondrial precursor
U90271      CD152 antigen
AB019576    Timeless (Drosophila) homolog
Z22607      Bone morphogenetic protein 4
AF083331    Kinesin family member IB
A1639073    Similar to Cadherin-related neuronal receptor

Acc. no.              PeCDF             TCDD           PCB126

U60145                 -1.0              4.3              3.8
X67108                 -1.2              6.0              4.7
L20682                  1.8              2.7              3.3
M12492                  2.1              2.9              2.5
U09401                  2.6              3.3              3.1
M31178                  2.0              2.2              2.1
M85301                  2.0              2.1              2.1
M35162                  1.7              2.0              2.1
S39221                  1.6              2.0              2.2
U89514                  1.6              2.2              2.3
AA866238               -1.1              2.7              2.8
U90271                 -1.1              2.9              2.7
AB019576                1.1              2.3              2.3
Z22607                  1.5              3.0              2.3
AF083331               -1.4              3.5              2.1
A1639073               -1.5              3.6              2.0

Figure 3. Hepatic genes differentially expressed during PCB153
exposure but not during exposure to PCDD, PeCDF, PCB126. Acc. no.,
GenBank accession number. PTM was used to identify differentially
expressed genes in livers of rats exposed to PCB153 compared with
rats exposed to AhR ligands. Matching genes conformed to a template
where the relative expression ratios for toxicant versus vehicle
exposure were TCDD = 0, PeCDF = 0, PCB126 = 0, and PCB153 = 1
((r.sup.2) = 0.9). The PTM output was further refined to include
only those genes differentially expressed [greater than or equal to]
2-fold in livers of rats exposed to PCB153 compared with vehicle
control animals. (A) PTM diagram showing genes differentially expressed
during PCB153 exposure. The color key indicates the magnitude of change.
(B) Average fold changes for n = 3 Affymetrix GeneChips (each chip
represents pooled RNA from two animals). Accession numbers and gene
names are from GenBank (http://www.ncbi.nlm.nih.gov/entrez/
query.fcgi?db=nucleotide).

Acc. no.   Gene name                                    TCDD    PeCDF

L00320     Cytochrome P450, subfamily IIB1              -2.3     -1.1

J00728     Cytochrome P450, subfamily IIB2              -1.7     -2.6

M22899     Interleukin 2                                 3.2      3.7

J02861     Cytochrome P450 2c13                          2.5      2.6

L24051     Early B-cell factor                           2.8      2.8

L06441     Decidual prolactin-related protein           -1.4     -1.3

M32474     Carcinoembryonic antigen-related cell
           adhesion molecule 3                          -1.1      1.0

M90661     Insulin receptor-related receptor            -1.2      1.1

M60388     Hemiferrin                                    1.5      1.7

S83194     Calcium/calmodulin-dependent protein
           kinase kinase 1, alpha                        1.6      1.6

D64046     phosphatidylinositol 3-kinase,
           regulatory subunit, polypeptide 2             1.3      1.2

Z15158     cAMP responsive-element modulator             1.5      1.0

AF025425   RNA polymerise 1-4                           -1.5     -1.9

L00131     Pancreatic trypsin 2                         -1.3     -1.5

S54008     Fibroblast growth factor receptor 1          -1.1     -2.3

U32498     Secretory protein SEC8                       -1.2     -1.2

J03024     Adrenergic receptor, beta 2                   1.1     -1.3

AA800168   Vacuolar protein sorting r-vps33b             1.0     -1.3

U60416     Myosin 5B                                     1.0     -1.4

U41453     A kinase anchor protein 12                   -1.4     -1.1

U33314     p2l (CDKN1A)-activated kinase 3              -1.3     -1.3

J02643     Sulfotransferase hydroxvsteroid gene 2       -1.3     -1.5

X52711     Myxovirus (influenza virus) resistance       -1.5     -1.5

AF042499   MAD homolog 7                                -1.1     -1.3

L14680     B-cell leukemia/lymphoma 2                   -1.6      1.2

D31838     Weel tyrosine kinase                         -1.4      1.3

M86758     Sulfotransferase, estrogen preferring        -1.3      1.7

D90048     ATPase, Na+/K+ transporting, beta 2           1.5     -1.2

M20721     Proline-rich protein                          1.5      1.0

A1070721   glial cell line derived neurotrophic
           factor family receptor alpha 1                1.1      1.2

A1639237   Similar to Tho2                               1.1     -1.1

U48592     Interleukin 1 receptor accessory protein      1.0     -1.1

U91847     Mitogen activated protein kinase 14          -1.2     -1.4

Acc. no.   Gene name                                  PCB126   PCB153

L00320     Cytochrome P450, subfamily IIB1              -1.3     84.4

J00728     Cytochrome P450, subfamily IIB2              -3.5     18.4

M22899     Interleukin 2                                 2.3      9.2

J02861     Cytochrome P450 2c13                          3.0      3.7

L24051     Early B-cell factor                           3.2      3.7

L06441     Decidual prolactin-related protein            1.2      3.7

M32474     Carcinoembryonic antigen-related cell
           adhesion molecule 3                           1.2      2.6

M90661     Insulin receptor-related receptor             1.1      3.2

M60388     Hemiferrin                                    1.6      2.3

S83194     Calcium/calmodulin-dependent protein
           kinase kinase 1, alpha                        1.9      2.6

D64046     phosphatidylinositol 3-kinase,
           regulatory subunit, polypeptide 2            -1.4      3.5

Z15158     cAMP responsive-element modulator            -1.1      4.6

AF025425   RNA polymerise 1-4                           -2.3      2.8

L00131     Pancreatic trypsin 2                         -2.6      2.3

S54008     Fibroblast growth factor receptor 1          -2.5      3.5

U32498     Secretory protein SEC8                       -1.4      4.0

J03024     Adrenergic receptor, beta 2                  -1.5      3.2

AA800168   Vacuolar protein sorting r-vps33b            -1.7      2.6

U60416     Myosin 5B                                    -1.9      3.0

U41453     A kinase anchor protein 12                   -1.4      2.5

U33314     p2l (CDKN1A)-activated kinase 3              -1.7      2.1

J02643     Sulfotransferase hydroxvsteroid gene 2       -1.5      2.0

X52711     Myxovirus (influenza virus) resistance       -1.6      2.0

AF042499   MAD homolog 7                                -1.6      2.0

L14680     B-cell leukemia/lymphoma 2                    1.2     -7.0

D31838     Weel tyrosine kinase                         -1.2     -4.3

M86758     Sulfotransferase, estrogen preferring        -1.4     -5.7

D90048     ATPase, Na+/K+ transporting, beta 2           1.1     -2.8

M20721     Proline-rich protein                         -1.1     -2.6

A1070721   glial cell line derived neurotrophic
           factor family receptor alpha 1               -1.3     -3.0

A1639237   Similar to Tho2                              -1.2     -3.2

U48592     Interleukin 1 receptor accessory protein     -1.7     -4.3

U91847     Mitogen activated protein kinase 14          -1.5     -4.6

Figure 4. Hepatic genes activated or repressed during PeCDF and PCB126
exposure but not during TCDD exposure. PTM was used to identify genes
co-expressed after exposure to PeCDF and PCB126 but not TCDD for 13
weeks. Acc. no., GenBank accession number. Matching genes conformed to
a template where the relative expression ratios for toxicant versus
vehicle exposure were TCDD = 0.2, PeCDF = 1, and PCB126 = 1 ((r.sup.2)
= 0.9). The PTM output was further refined to include only those genes
differentially expressed [greather than or equal to] 2-fold in livers
of rats exposed to PeCDF and PCB126 compared with vehicle control
animals. (A) PTM diagram showing co-expressed genes. The color key
indicates the magnitude of change. (B) Average fold changes for n = 3
Affymetrix GeneChips (each chip represents pooled RNA from two animals).
Accession numbers and gene names are from GenBank
(http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=nucleotide)

Acc. no.   Gene name                            TCDD   PeCDF   PCB126

M87634     Forkhead box O1                      -1.7    12.5     15.5

K00750     Cytochrome c, somatic                 1.2     6.4      4.4

AA945054   Cvtochrome b5                         2.4    22.3     21.0

A1070295   growth arrest and
           DNA-damage-inducible 45 alpha         1.6    47.3     33.1

AJ224441   Est Upregulated during prostatic
           apoptosis                             5.0    11.1      8.7

AI171243   erythrocyte protein band 4,
           1-like 3                              2.6    10.6      6.3

AA799997   Similar to homoloc-13 (LOC360984),
           mRNA                                  2.3     8.6      4.8

U06273     UDP-glucuronosyltransferase 2B12      2.0     7.8      5.3

M60322     Aldehyde reductase 1                  1.7    10.5      6.2

U75405     Collagen Type l, A1                   1.9     9.1      6.9

U10995     Nuclear receptor subfamily 2,
           group F, member 1                     1.2    10.4      7.3

U46958     Hyaluronan-binding CD44i             -1.1    13.2      8.0

AIO10292   Similar to galactose binding Lectin   1.6    11.0     10.9

AA926149   Catalase                              1.1     2.5      2.2

Z46614     Caveolin                              1.3    23.1     15.3

AAB66240   Similar to CYP2C39                   -1.4     5.5      4.6

AA799336   Similar to NADH-ubiquinone
           oxidoreductase                       -1.2     5.3      3.7

J03786     Cylochrome P450 15-beta gene         -1.0     4.6      4.3

M58404     Thymosin, beta 10                    -l.l     4.1      3.6

Figure 5. Identification of novel dioxin-responsive genes. Gene
expression data were clustered by PTM to identify co-expressed genes
in livers of rats exposed to AhR ligands TCDD, PeCDF, and PCB126 for
13 weeks. Acc. no., GenBank accession number. Matching genes
conformed to a template where the relative expression ratios for
toxicant versus vehicle exposure were TCDD = 0.8, PeCDF = 0.8, PCB126
= 0.8, and PCB153 = 0.1 ((R.sup.2) = 0.9). Each row represents a
separate gene; each column specifies the toxicant treatment (n = 3
replicate arrays per toxicant). The PTM output was further refined to
include only genes differentially expressed [greater than or equal to]
2-fold in livers of rats exposed to PeCDF and PCB126 compared with
control animals. The color key indicates the magnitude of change.
Italicized genes were previously shown to respond to dioxin. Accession
numbers and gene names are from GenBank
(http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=nucleotide).

Genes upregulated by dioxin-like chemicals

Acc. no.   Gene name                                   TCDD    PeCDF

E00778     cytochrome P450, family l,
           subfamily a, polypeptide 1                 676.2    524.3
AI176856   cytochrome P450, subfamily 1,
           subfamily b polypeptide 1                  676.3    493.3
U23055     C-CAM4 protein                             133.4     37.4
U40836     Cytochrom c oxidase subunit VIII-H          94.0     16.2
J02679     NAD(P)H dehydrogenase, quinone 1             9.3     10.5
U75411     Ig non-productively rearranged
           lambda-chain                                 7.9      4.8
AI145167   Adenylate cyclase-associated protein 2      53.6     10.9
D38061     UDP glycosyltransferase 1 family,
           polypeptide A6                              19.3      5.1
S56936     UDP glycosyltransferase 1 family,
           polypeptide A6                               7.4      3.3
K03241     cytochrome P450, 1a2                         3.7      3.8
M57682     Calcium channel, voltage-dependent,
           L type, alpha 1D subunit                     3.6      3.1
M91235     Similar to VL30 element                      6.4      4.3
X15705     Testis-specific hsp-related gene hst70       5.3      4.9
AF053101   Paired box gene 4                            2.4      6.7
D44591     Nitric oxide synthase 2, inducible           2.2      2.4
M12492     Type II beta regulatory subunit of
           cAMP-dependent protein kinase                2.9      2.1
AA818604   Heat shock 70kD protein 1A                   2.9      3.2

Acc. no.   Gene name                                 PCB126   PCB153

E00778     cytochrome P450, family l,
           subfamily a, polypeptide 1                 325.6      1.4
AI176856   cytochrome P450, subfamily 1,
           subfamily b polypeptide 1                  317.1      2.0
U23055     C-CAM4 protein                              25.1      1.0
U40836     Cytochrom c oxidase subunit VIII-H          14.0      1.0
J02679     NAD(P)H dehydrogenase, quinone 1             6.7      2.6
U75411     Ig non-productively rearranged
           lambda-chain                                 3.0      1.5
AI145167   Adenylate cyclase-associated protein 2       7.0      1.1
D38061     UDP glycosyltransferase 1 family,
           polypeptide A6                               3.0      2.1
S56936     UDP glycosyltransferase 1 family,
           polypeptide A6                               2.0      1.1
K03241     cytochrome P450, 1a2                         2.9      1.6
M57682     Calcium channel, voltage-dependent,
           L type, alpha 1D subunit                     2.7      1.3
M91235     Similar to VL30 element                      4.7      2.6
X15705     Testis-specific hsp-related gene hst70       3.7      2.0
AF053101   Paired box gene 4                            2.0      1.2
D44591     Nitric oxide synthase 2, inducible           2.1      1.3
M12492     Type II beta regulatory subunit of
           cAMP-dependent protein kinase                2.4      1.1
AA818604   Heat shock 70kD protein 1A                   2.5      1.1

Genes downregulated by dioxin-like chemicals

Acc. no.   Gene name                                   TCDD    PeCDF

L25633     Regulated endocrine-specific protein 18     -4.0     -3.5
L23I28     RT1 class Ib gene. H2-TL-like,
           grc region (N1)                             -2.4     -2.9
U26663     Prostaglandin F receptor                    -3.1     -2.9
AA875577   Dapper 2 homolog                            -7.9    -10.3
X65036     Integrin alpha 7                            -5.2     -5.7
AF037072   Carbonic anhydrase 3                        -8.7     -4.2
D86745     Nuclear receptor subfamily 0.
           group B, member 2                           -4.8     -7.4
AA892799   Similar to glyoxylate
           reductase/hydroxypyruvate reductase         -3.1     -3.5
L41686     MegflO                                      -3.6     -5.9
AA891785   NADP+specific isocitrale
           dehydrogenase                               -4.0     -4.0
AI234828   immununoglobulin alpha heavy
           chain (partial)                             -4.0     -6.0
X12748     epidermal growth factor                     -4.8     -5.9
X16262     Myosin heavy chain 11                       -3.0     -3.4
Y09333     Mitochondrial acyl-CoA thioesterase 1       -3.7     -2.6

Acc. no.   Gene name                                 PCB126   PCB153

L25633     Regulated endocrine-specific protein 18     -3.2     -1.4
L23I28     RT1 class Ib gene. H2-TL-like,
           grc region (N1)                             -2.6     -1.1
U26663     Prostaglandin F receptor                    -2.1      1.4
AA875577   Dapper 2 homolog                            -2.8     -1.1
X65036     Integrin alpha 7                            -2.5     -1.3
AF037072   Carbonic anhydrase 3                        -2.8     -1.0
D86745     Nuclear receptor subfamily 0.
           group B, member 2                           -4.6     -1.3
AA892799   Similar to glyoxylate
           reductase/hydroxypyruvate reductase         -2.4      1.1
L41686     MegflO                                      -4.3     -1.3
AA891785   NADP+specific isocitrale
           dehydrogenase                               -2.1     -1.0
AI234828   immununoglobulin alpha heavy
           chain (partial)                             -2.9     -1.2
X12748     epidermal growth factor                     -5.5     -1.9
X16262     Myosin heavy chain 11                       -3.4     -1.5
Y09333     Mitochondrial acyl-CoA thioesterase 1       -3.3     -1.8

Table 1. Primer sequences for real-time RT-PCR.

GenBank
accession no. (a)          Gene          Primer sequences (5' to 3')

U09540              CVP181               CGTCTGATGCTTTCAGCAAAGG
                                         GCAGGCTTTCCAACTAAGCCAG
U23055              C-CAM4               CTCGTCTCCTCAGAGGGCAGATTC
                                         ACAGCGTCTACGGTGACTTGGG
AI145367            CAP2                 ATCACCGTCGATAACTGCAAG
                                         CCCATTACCTGGATCTGAATG
U46118              CYP3A9               CCACCAGCATGAAAGACATC
                                         GTCCTGTGGGTTGTTAAGGG
M63991              SERPIN7A             TCTGGCTCTAGCACCCAAAC
                                         GATCAAATGCTGGAAGCCC
M25890              SST                  CAGAACTGCTGTCTGAGCCC
                                         AGCTCCAGCCTCATCTCGTC
X65296              CES3                 GGCCATTTCTGAGAGTGGTGTG
                                         GCAGGCAATGAACCATAACAGC
V01270              Ribosomal 18S RNA    GAGCGAAAGCATTTGCCAAG
                                         GGCATCGTTTATGGTCGGAA

(a) From GenBank (http://www.ncbi.nlm.nih.gov/entrez/
query.fcgi?db_nucleotide)

Table 2. Summary of the 13-week dosimetry and liver pathology data from
the NTP cancer bioassay. (a)

                                       TCDD

                             Control       100 ng/kg/day

Liver levels (ng/g)           BLOQ       18.3 [+ or -] 0.8
Liver hypertrophy            1 (1.0)        10 * (2.3)
Multinucleated hepatocytes      0             3 (1.0)
Diffuse fatty change            0             2 (1.0)
Pigmentation                    0                0

                                        PeCDF

                             Control       200 ng/kg/day

Liver levels (ng/g)           BLOQ      132.9 [+ or -] 47.4
Liver hypertrophy               0            7 * (1.0)
Multinucleated hepatocytes      0                0
Diffuse fatty change            0             2 (1.0)
Pigmentation                    0             2 (1.0)

                                        PCB126

                             Control      1,000 ng/kg/day

Liver levels (ng/g)           BLOQ      412.6 [+ or -] 73.5
Liver hypertrophy               0           10 * (1.7)
Multinucleated hepatocytes      0                0
Diffuse fatty change            0                0
Pigmentation                    0                0

                                          PCB153

                             Control   1,000 [micro]g/kg/day

Liver levels (ng/g)           BLOQ     9,250 [+ or -] 2,061
Liver hypertrophy               0         9 * (1 .2)
Multinucleated hepatocytes      0             0
Diffuse fatty change            0             0
Pigmentation                    0             0

Abbreviations: BLOQ, below level of quantification; N/A, not
applicable.

(a) Dosimetry values are the mean [+ or -] SD of 10 rats per group.
Values for each pathologic end point represent the incidence or number
of rats (of 10) that exhibit the response. The mean severity score is
given in parentheses (1, minimal; 2, mild; 3, moderate; 4, marked).
* Statistically significant (p < 0.05) increase in the incidence of a
given pathologic response relative to the respective control group.

Table 3. Differential gene expression in liver from rats exposed
subchronically (13 weeks) to HAHs.

                         TCDD                      PeCDF

CYP1B1
  RT-PCR         256 (236.3 to 277.3)       59.7 (48.3 to 73.8)
  Microarray    676.3 (470.8 to 881.8)     493.3 (310.1 to 676.5)
C-CAM4
  RT-PCR           4.1 (3.8 to 4.4)           2.5 (2.3 to 2.7)
  Microarray    133.4 (112.1 to 154.7)      37.4 (25.5 to 49.3)
CAP2
  RT-PCR        168.9 (147.9 to 192.9)      20.2 (17.8 to 22.9)
  Microarray      53.6 (31.1 to 76.1)         10.9 (4 to 17.8)
CYP3A9
  RT-PCR       -1024 (-1201.8 to -872.5)     -4.2 (-5 to -3.5)
  Microarray    -35.4 (-53.4 to -17.4)      -2.3 (-3.3 to -1.3)
SERPIN7A
  RT-PCR        -26.6 (-30.2 to -23.4)      -29.9 (-32 to -27.9)
  Microarray     -11.5 (-17.2 to -5.81      -2.7 (-3.6 to -1.8)
SST
  RT-PCR        -36.8 (-46.4 to -29.1)       -1.6 (-2 to -1.2)
  Microarray      -8 (-10.5 to -5.5)        -8.3 (-11.1 to -5.5)
CES3
  RT-PCR          -4.8 (-5.2 to -4.4)       -2.8 (-2.5 to -3.1)
  Microarray      -8.1 (-9.9 to -6.3)       -2.8 (-3.8 to -1.8)

                        PCB126                     PCB153

CYP1B1
  RT-PCR         106.4 (98.2 to 115.3)        -1.2 (-1.6 to 1)
  Microarray     317.1 (41.1 to 593.1)         2.1 (1 to 3.2)
C-CAM4
  RT-PCR           3.5 (2.6 to 4.7)           -1.1 (-1.3 to 1)
  Microarray       25.1 (4 to 46.2)          1.1 (-0.7 to 1.5)
CAP2
  RT-PCR         119.4 (104 to 137.2)       -1.3 (-1.5 to -1.1)
  Microarray        7.6 (2 to 13.2)          1.1 (-0.8 to 1.4)
CYP3A9
  RT-PCR        -28.5 (-30.2 to -26.9)      -1.8 (-2.1 to -1.5)
  Microarray      -4.5 (-5.8 to -2.2)         1.6 (0.8 to 2.4)
SERPIN7A
  RT-PCR          -8.4 (-12 to -5.9)          -1.2 (-1.5 to 1)
  Microarray       -4 (-4.9 to -3.1)          1.6 (1.3 to 1.9)
SST
  RT-PCR          -1.5 (-1.6 to -1.4)        -3 (-3.5 to -2.5)
  Microarray      -6.4 (-9.4 to -3.4)       -9.5 (-10.1 to -8.9)
CES3
  RT-PCR          -1.4 (-1.5 to -1.3)         2.4 (2.1 to 2.6)
  Microarray       -4 (-4.4 to -3.6)           1.3 (1 to 1.6)

The average changes in hepatic mRNA for TCDD, PeCDF, PCB126, or
PCB153 exposures compared with vehicle exposure were determined
by real-time RT-PCR to validate microarray results. Each value
represents the average ([+ or -] 1 standard deviation) of three
independent RNA pools (RT-PCR) or three independent GeneChips
(microarray). Real-time RT-PCR values were normalized to 18S
ribosomal RNA as described in "Materials and Methods."


REFERENCES

ATSDR. 1998. Toxicological Profile for Chlorinated chlorinated /chlo·ri·nat·ed/ (klor´i-nat?ed) treated or charged with chlorine.

chlorinated

charged with chlorine.


chlorinated acids
some, e.g.
 Dibenzo-p-dioxins (Update). Atlanta, GA:Agency for Toxic Substances and Disease Registry, U.S. Department of Health and Human Services Noun 1. Department of Health and Human Services - the United States federal department that administers all federal programs dealing with health and welfare; created in 1979
Health and Human Services, HHS
.

Becher 14, Steindorf K, Flesch-Janys D. 1998. Quantitative cancer risk assessment for dioxins using an occupational cohort. Environ Health Perspect 106(suppl 2):663-670.

Bishay K, Ory K, Lebeau J, Levalois C, Olivier M-F M-F Monday Through Friday , Chevillard S. 2000. DNA damage-related gene expression as biomarkers to assess cellular response after gamma irradiation of a human lymphoblastoid cell line. Oncogene oncogene

Gene that can cause cancer. It is a sequence of DNA that has been altered or mutated from its original form, the proto-oncogene (see mutation). Proto-oncogenes promote the specialization and division of normal cells.
 19:916-923.

Bunger MK, Moran SM, Glover E, Thomae TL, Lahvis GP, Lin BC, et al. 2003. Resistance to 2,3,7,8-tetrachlorodibenzo-p-dioxin toxicity and abnormal liver development in mice carrying a mutation in the nuclear localization sequence of the aryl hydrocarbon receptor. J Biol Chem 278:17767-17774.

Cheung PH, Thompson NL, Earley K, Culic O, Hixon D, Lin S-H. 1993. Cell-CAM105 isoforms with different adhesion functions are coexpressed in adult rat tissues and during liver development. J Biol Chem 268:6139-6146.

Connor K, Safe S, Jefcoate CR, Larsen M. 1995. Structure-dependent induction of CYP2B CYP2B Cytochrome P450 2B  by polychlorinated biphenyl congeners in female Sprague-Dawley rats. Biochem Pharmacol 50:1913-1920.

Dalton TP, Puga A, Shertzer HG. 2002. Induction of cellular oxidative stress by aryl hydrocarbon receptor activation. Chem Biol Interact 141:77-95.

Denison MS, Pandini A, Nagy SR, Baldwin EP, Bonati L. 2002. Ligand binding and activation of the Ah receptor. Chem Biol Interact 141:3-24.

Earley K, Weiping L, Yuhong Q, Thompson NL, Chou J, Hixson DC, et al. 1996. Identification of a new isoform of cell-cell adhesion molecule 105 (C-CAM), C-CAM4: a secretory protein with only one Ig domain. Biochem J 315:799-806.

Fingerhut MA, Halperin WE, Marlow DA, Piacitelli LA, Honchar PA, Sweeney MH, et al. 1991. Cancer mortality in workers exposed to 2,3,7,8-tetrachlorodibenzo-p-dioxin. N Engl J Med 324:212-218.

Finley BL, Connor KT, Scott PK. 2003. The use of toxics equivalency factor distributions in probabilistic risk assessments for dioxins, furans, and PCBs. J Toxicol Environ Health 66:533-550.

Fisher MT, Nagarkatti M, Nagarkatti PS. 2004. Combined screening of thymocytes using apoptosis-specific cDNA array and promoter analysis yields novel gene targets mediating TCDD-induced toxicity. Toxicol Sci 78:116-124.

Flesch-Janys B, Steindorf K, Gurn P, Becher H. 1998. Estimation of the cumulated exposure to polychlorinated dibenzo-p-dioxins/furans and standardized mortality ratio The standardized mortality ratio or SMR in epidemiology is the ratio of observed deaths to expected deaths according to a specific health outcome in a population and serves as an indirect means of adjusting a rate.  analysis of cancer mortality by dose in an occupationally exposed cohort. Environ Health Perspect 106(suppl 2):655-662.

Frueh FW, Hayashibara KC, Brown PO, Whitlock JP Jr. 2001. Use of cDNA microarrays to analyze dioxin-induced changes in human liver gene expression. Toxicol Lett 122:189-203.

Gu YZ, Hogenesch JB, Bradfield CA. 2000. The PAS superfamily superfamily /su·per·fam·i·ly/ (soo´per-fam?i-le)
1. a taxonomic category between an order and a family.

2.
: sensors of environmental and developmental signals. Annu Rev Pharmacol Toxicol 40: 519-561.

Hahn ME. 2002. Aryl hydrocarbon receptors: diversity and evolution. Chem Biol Interact 141:131-160.

Hassoun EA, Al-Ghafri M, Abushaban A. 2003. The role of antioxidant enzymes in TCDD-induced oxidative stress in various brain regions of rats after subchronic exposure. Free Radic Biol Med 35:1028-1036.

Heijne WH, Stierum RH, Slijper M, van Bladeren, PJ, van Ommen B. 2003. Toxicogenomics of bromobenzene hepatotoxicity: a combined transcriptomics and proteomics approach. Biochem Pharmacol 65:857-875.

Ihaka R, Gentleman R. 1996. R: a language for data analysis and graphics. J Comput Graph Stat 5: 299-314.

Imasato AC, Han J, Kai H, Cato ACB ACB American Council of the Blind
ACB Asia Commercial Bank
ACB America's Community Bankers
ACB Adjusted Cost Base
ACB Alliance for the Chesapeake Bay
ACB Amphibious Construction Battalion (US Navy)
ACB Australian Cricket Board
, Akira S, Li J-D. 2002. Inhibition of p38 MAPK MAPK Mitogen-Activated Protein Kinase
MAPK Map Kinase
 by glucocorticoids Glucocorticoids
Any of a group of hormones (like cortisone) that influence many body functions and are widely used in medicine, such as for treatment of rheumatoid arthritis inflammation.
 via induction of MAPK phosphatase-1 enhances nontypeable Haemophilus influenzae-induced expression of toll-like receptor 2. J Biol Chem 277:47444-47450.

Jonsson A, Gustafsson O, Axelman J, Sundberg H. 2003. Global accounting of PCBs in the continental shelf sediments. Environ Sci Technol 37:245-255.

Kimbrough R. 1995. Polychlorinated biphenyls (PCBs) and human health: an update. Crit Rev Toxicol 25:133-163.

Kociba RJ, Keeler Keel´er

n. 1. One employed in managing a Newcastle keel; - called also keelman ltname>.
2. A small or shallow tub; esp., one used for holding materials for calking ships, or one used for washing dishes, etc.
 PA, Park CN, Gehring PJ. 1976. 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD): results of a 13-week oral toxicity study. Toxicol Appl Pharmacol 35:553-574.

Kociba RJ, Keyes DG, Beyer JE, Barreon RM, Wade CE, Dittenber BA, et al. 1978. Results of a two-year chronic toxicity and oncogenicity oncogenicity The capacity to induce tumors  study of 2,3,7,8-tetrachlorodibenzo-p-dioxin in rats. Toxicol Appl Pharmacol 46:279-303.

Krogaenas AK, Nafstad I, Skare JU, Farstad W, Hafne AL. 1998. In vitro reproductive toxicity of polychlorinated biphenyls congeners 153 and 126. Reprod Toxicol 12:575-580.

Kuchenhoff A, Eckard R, Buff K, Fischer B. 1999. Stage-specific effects of defined mixtures of polychlorinated biphenyls on in vitro development of rabbit preimplantation embryos. Mol Reprod Dev 54:126-134.

Leach SO, Scatena CD, Keefer CJ, Goodman HA, Song SY, Yang L, et al. 1998. Negative regulation of wee1 expression and Cdc2 phosphorylation phosphorylation, chemical process in which a phosphate group is added to an organic molecule. In living cells phosphorylation is associated with respiration, which takes place in the cell's mitochondria, and photosynthesis, which takes place in the chloroplasts.  during p53-mediated growth arrest and apoptosis. Cancer Res 58:3231-3236.

Lila T, Drubin DG. 1997. Evidence for physical and functional interactions among two Saccharomyces Saccharomyces: see yeast.  cerevisiae SH3 domain proteins, an adenylyl cyclase-associated protein and the actin cytoskeleton. Mol Biol Cell 8:367-385.

Lin SH, Chen G, Earley K, Luo W, Chou J. 1998. Demonstration of adhesion activity of the soluble Ig-domain protein C-CAM4 by attachment to the plasma membrane. Biochem Biophys Res Comm 245:472-477.

Manjunath 6S, Dufresne MJ. 1988. Evidence that 2,3,7,8-tetrachlorodibenzo-p-dioxin induces NADPH NADPH the reduced form of NADP.

NADPH
n.
The reduced form of NADP.



NADPH

reduced form of nicotinamide adenine dinucleotide phosphate (NADP) used in a number of reductive synthesis such as fatty
 cytochrome c (P-450) reductase reductase /re·duc·tase/ (-tas) a term used in the names of some of the oxidoreductases, usually specifically those catalyzing reactions important solely for reduction of a metabolite.  in rat hepatoma hepatoma /hep·a·to·ma/ (hep?ah-to´mah)
1. a tumor of the liver.

2. hepatocellular carcinoma (malignant h.).


hep·a·to·ma
n. pl.
 cells in culture. Cell Biol Int Rep 12:41-51.

Martinez JM, Afshari CA, Bushel bushel: see English units of measurement.  PR, Masuda A, Takahashi T, Walker NJ. 2002. Differential toxicogenomic responses to 2,3,7,8-tetrachlorodibenzo-p-dioxin in malignant and nonmalignant human airway epithelial cells. Toxicol Sci 69:409-423.

McGregor DB, Partensky C, Wilbourn J, Rice JM. 1998. An IARC evaluation of polychlorinated dibenzo-p-dioxins and polychlorinated dibenzofurans as risk factors in human carcinogenesis car·ci·no·gen·e·sis
n.
The production of cancer.



carcinogenesis

production of cancer.


biological carcinogenesis
viruses and some parasites are capable of initiating neoplasia.
. Environ Health Perspect 106(suppl 2):755-760.

Mimura J, Fujii-Kuriyama Y. 2003. Functional role of AhR in the expression of toxic effects by TCDD. Biochim Biophys Acta 1619:263-268.

NTP. 2004a. Toxicology and Carcinogenesis Studies of 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) (CAS No. 1746-01-6)in Female Harlan Sprague-Dawley Rats (Gavage gavage /ga·vage/ (gah-vahzh´) [Fr.]
1. forced feeding, especially through a tube passed into the stomach.

2. superalimentation.


ga·vage
n.
1.
 Studies). Technical Report 521 (Draft). Research Triangle Park Research Triangle Park, research, business, medical, and educational complex situated in central North Carolina. It has an area of 6,900 acres (2,795 hectares) and is 8 × 2 mi (13 × 3 km) in size. Named for the triangle formed by Duke Univ. , NC:National Toxicology Program.

NTP. 2004b. Toxicology and Carcinogenesis Studies of 2,3,4,7,8-Pentachlorodibenzofuran (PeCDF) (CAS No. 57117-31-4)in Female Harlan Sprague-Dawley Rats (Gavage Studies). Technical Report 525 (Draft). Research Triangle Park, NC:National Toxicology Program.

NTP. 2004c. Toxicology and Carcinogenesis Studies of 3,3',4,4',5-Pentachlorobiphenyl (PCB 126) (CAS No. 57465-28-8) in Female Harlan Sprague-Dawley Rats (Gavage Studies). Technical Report 520 (Draft). Research Triangle Park, NC:National Toxicology Program.

Pavlidis P, Noble WS. 2001. Analysis of strain and regional variation in gene expression in mouse brain. Genome Biol 2:0042.1-0042.15.

Pitt JA, Buckalew AR, House DE, Abbott BD. 2000. Adrenocorticotropin adrenocorticotropin /adre·no·cor·ti·co·trop·in/ (-kor?ti-ko-tro´pin) corticotropin.

ad·re·no·cor·ti·co·trop·in or ad·re·no·cor·ti·co·troph·in
n.
See ACTH.
 (ACTH ACTH: see adrenocorticotropic hormone.
ACTH
 in full adrenocorticotropic hormone

Polypeptide hormone made in the pituitary gland.
) and corticosterone corticosterone (kôr'təkōstĕr`ōn), steroid hormone secreted by the outer layer, or cortex, of the adrenal gland. Classed as a glucocorticoid, corticosterone helps regulate the conversion of amino acids into carbohydrates and  secretion by perifused pituitary and adrenal glands from rodents exposed to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Toxicology 151:25-35.

Poulsen HE, Jensen BR, Weimann A, Jensen SA, Sorensen M, Loft S. 2000. Antioxidants Antioxidants
Substances that reduce the damage of the highly reactive free radicals that are the byproducts of the cells.

Mentioned in: Aging, Nutritional Supplements

antioxidants,
n.
, DNA damage and gene expression. Free Radic Res 33(suppl):S33-S39.

Puga A, Maier A, Medvedovic M. 2000. The transcriptional signature of dioxin in human hepatoma HepG2 cells. Biochem Pharmacol 60:1129-1142.

Quant K, Frech K, Karas H, Wingender E, Werner T. 1995. MatInd and MatInspector--new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Res 23:4878-4884.

Raychaudhuri S, Stuart JM, Altman RB. 2000. Principal components analysis to summarize microarray experiments: application to sporulation sporulation /spor·u·la·tion/ (spor?u-la´shun) formation of spores.

spor·u·la·tion
n.
The production or release of spores.



sporulation

formation of spores or sporozoites.
 time series. Pac Symp Biocomput 455-466.

Reiners JJ, Jones CL, Hong N, Clift RE, Elferink C. 1997. Downregulation of aryl hydrocarbon receptor function and cytochrome P450 1A1 induction by expression of Ha-ras oncogenes oncogenes

1. genes carried by tumor viruses that are directly and solely responsible for the neoplastic transformation of host cells. Many oncogenes function after integration into the DNA of the host cell and some up-regulate normal downstream host cell genes to cause neoplasia.
. Mol Carcinog 19:91-100.

Ringberg A, Anagnostaki L, Anderson H, Idvall I, Ferno M. 2001. South Sweden Breast Cancer Group. Cell biological factors in ductal carcinoma in situ ductal carcinoma in situ Intraductal carcinoma, DIN 3 Surgical oncology A localized form of breast CA, in which malignant cells are confined to the duct wall; DCIS has a heterogeneous biologic behavior and morphology, and is detectable by mammography Epidemiology  (DCIS DCIS ductal carcinoma in situ.
DCIS Ductal carcinoma in situ, see there
) of the breast--relationship to ipsi-lateral local recurrence and histopathological characteristics. Eur J Cancer 37:1514-1522.

Rozen S, Skaletsky HJ. 2000. Primer3 on the WWW WWW or W3: see World Wide Web.


(World Wide Web) The common host name for a Web server. The "www-dot" prefix on Web addresses is widely used to provide a recognizable way of identifying a Web site.
 for general users and for biologist programmers. In: Bioinformatics Methods and Protocols: Methods in Molecular Biology (Krawetz S, Misener S, eds). Totowa, NJ:Humana Press, 365-386.

Saeed Al, Sharov V, White J, Li J, Liang W, Bhagabati N, et al. 2003. TM4: a free, open-source system for microarray data management and analysis. Biotechniques 34:374-378.

Safe S. 1994. Polychlorinated biphenyls (PCBs): environmental impact, biochemical and toxic responses and implications for risk assessment. Crit Rev Toxicol 24:87-147.

Schrenk D. 1998. Impact of dioxin-type induction of drug-metaboizing enzymes on the metabolism of endo-and xenobiotics. Biochem Pharmacol 55:1155-1162.

Servillo G, Della Fazia MA, Sassone-Corsi P. 1998. Transcription factor CREM coordinates the timing of hepatocyte proliferation in the regenerating liver. Genes Dev 12:3639-3643.

Sheikh MS, Hollander MC, Fornance AJ Jr. 2000. Role of Gadd 45 in apoptosis. Biochem Pharmacol 59:43-45.

Shi LM, Fan Y, Lee JK, Waltham M, Andrews DT, Scherf U, et al. 2000. Mining and visualizing large anticancer drug discovery databases. J Chem Info Comp Sci 40:367-379.

Shima F, Yamawaki-Kataoka Y, Yanagihara C, Tamada M, Okada T, Kariya K, et al. 1997. Effect of association with adenylyl cyclase-associated protein on the interaction of yeast adenylyl cyclase with Ras protein. Mol Cell Biol 17:1057-1064.

Shridhar S, Farley A, Reid RL, Foster WG, Van Vugt DA. 2001. The effect of 2,3,7,8-tetrachlorodibenzo-p-dioxin on corticotrophin-releasing hormone, arginine vasopressin, and pro-opiomelanocortin mRNA levels in the hypothalamus of the cynomolgus monkey. Toxicol Sci 2:181-188.

Shubert DE, Chi LH, Manns DC, Olson JR. 2002. 17[beta]-Estradiol metabolism and EROD EROD Education Resource Organizations Directory
EROD Ethoxyresorufin-O-deethylation
EROD Early Return of Dependents
EROD Electronic Record of Deposit (pending tranfer) 
 activity in rat liver and lung as biomarkers of chronic exposure to TCDD and related compounds [Abstract]. Toxicol Sci 66(1-s):830.

Sills RC, Goldsworthy TL, Sleight SD. 1994. Tumor-promoting effects of 2,3,7,8-tetrachlorodibenzop-dioxin and phenobarbital phenobarbital /phe·no·bar·bi·tal/ (fe?no-bahr´bi-tal) a long-acting barbiturate, used as the base or sodium salt as a sedative, hypnotic, and anticonvulsant.

phe·no·bar·bi·tal
n.
 in initiated weanling weanling /wean·ling/ (wen´ling)
1. recently weaned.

2. a recently weaned infant.


weanling

see weaner.
 Sprague-Dawley rats: a quantitative, phenotypic, and ras p21 protein study. Toxicol Pathol 22: 270-281.

Smialowicz RJ, DeVito MJ, Riddle MM, Williams WC, Birnbaum LS. 1997. Opposite effects of 2,2',4,4',5,5'hexachlorobiphenyl and 2,3,7,8-tetrachlorodibenzo-p-dioxin on the antibody response to sheep erythrocytes Erythrocytes
Red blood cells.

Mentioned in: Bartonellosis

erythrocytes (ē·rithˑ·rō·sīts),
n.pl red blood cells.
 in mice. Fundam Appl Toxicol 37:141-149.

Setter TR, Greenlee WF. 1992. Classification of members of the Ah gene battery. Chemosphere chemosphere: see atmosphere.  25:223-226.

Swiston J, Hubberstey A, Yu G, Young, D. 1995. Differential expression of CAP and CAP2 in adult rat tissues. Gene 165:273-277.

Thompson NL, Panzica MA, Hull G, Lin S-H, Curran TR, Ruppuso PA, et al. 1993. Spatiotemporal spa·ti·o·tem·po·ral  
adj.
1. Of, relating to, or existing in both space and time.

2. Of or relating to space-time.



[Latin spatium, space + temporal1.
 expression of two cell-cell adhesion molecule 105 isoforms during liver development. Cell Growth Differ 4:257-268.

Tsai J, Sultana R, Lee Y, Pertea G, Karamycheva S, Antonescu V, et al. 2001. Resourcerer: a database for annotating an·no·tate  
v. an·no·tat·ed, an·no·tat·ing, an·no·tates

v.tr.
To furnish (a literary work) with critical commentary or explanatory notes; gloss.

v.intr.
To gloss a text.
 and linking microarray resources within and across species. Genome Biol 2:0002.1-0002.4.

Yechoor VK, Patti M-E, Saccone R, Kahn CR. 2002. Coordinated patterns of gene expression for substrate and energy metabolism in skeletal muscle of diabetic mice. Proc Natl Acad Sci USA 99: 10587-10592.

Van den Berg M, de Jongh J, Poiger H, Olson JR. 1994. The texicokinetics and metabolism of polychlorinated dibenzo-p-dioxins (PCDDs) and polychlorinated dibenzofurans (PCDFs) and their relevance for toxicity. CRC (Cyclical Redundancy Checking) An error checking technique used to ensure the accuracy of transmitting digital data. The transmitted messages are divided into predetermined lengths which, used as dividends, are divided by a fixed divisor.  Crit Rev Toxicol 24:1-74.

Van den Berg M, Birnbaum L, Bosveld ATC ATC Air Traffic Control
ATC Average Total Cost
ATC Certified Athletic Trainer
ATC At the Center (Hartford, Maine retreat center)
ATC Applied Technology Council
ATC All Things Considered
, Brunstrom B, Cook P, Feeley M, et al. 1998. Toxic equivalency factors (TEFs) for PCBs, PCDDs, PCDFs for humans and wildlife. Environ Health Perspect 106:775-791.

Whitlock JP Jr. 1999. Induction of cytochrome P4501A1. Annu Rev Pharmacol Toxicol 39:103-125.

Chad M. Vezina, (1) Nigel J. Walker, (2) and James R. Olson (3)

(1) University of Wisconsin-Madison “University of Wisconsin” redirects here. For other uses, see University of Wisconsin (disambiguation).
A public, land-grant institution, UW-Madison offers a wide spectrum of liberal arts studies, professional programs, and student activities.
, School of Pharmacy, Madison, Wisconsin, USA; (2) National Institute of Environmental Health Sciences The National Institute of Environmental Health Sciences (NIEHS) is one of 27 Institutes and Centers of the National Institutes of Health (NIH),which is a component of the Department of Health and Human Services (DHHS). The Director of the NIEHS is Dr. David A. Schwartz. , Research Triangle Park, North Carolina, USA; (3) University at Buffalo, Department of Pharmacology and Toxicology, Buffalo, New York, USA

Address correspondence to J. Olson, University at Buffalo, Department of Pharmacology and Toxicology, 102 Farber Hall, 3435 Main Street, Buffalo, NY 14214 USA. Telephone: (716) 8292319. Fax: (716) 829-2800. E-mail: jolson@buffalo.edu

Tissues for this study were provided to us by the National Toxicology Program as part of a series of chronic 2-year rat bioassays examining the relative potencies for carcinogenicity of individual and mixtures of dioxin-like compounds. These studies were supported in part by National Institute of Environmental Health Sciences ES09440, the University at Buffalo, and the Environment and Society Institute, University at Buffalo.

The authors declare they have no competing financial interests.

Received 13 May 2004; accepted 22 September 2004.
COPYRIGHT 2004 National Institute of Environmental Health Sciences
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2004, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Toxicogenomics
Author:Olson, James R.
Publication:Environmental Health Perspectives
Date:Nov 15, 2004
Words:10327
Previous Article:Renal toxicogenomic response to chronic uranyl nitrate insult in mice.(Toxicogenomics)
Next Article:Tools for genetic and genomic studies in emerging model organisms.(Fellowships, Grants, & Awards)



Related Articles
Differential effects of two lots of Aroclor 1254 on enzyme induction, thyroid hormones, and oxidative stress. (Articles).
Phenotypic anchoring: linking cause and effect. (NCT Update).
Tox/Path team takes on differential gene expression.(Environews: NCT update)
MIT toxicogenomics research program.(NIEHS News)
Dose-additive carcinogenicity of a defined mixture of "dioxin-like compounds".(Research)
Exocrine pancreatic pathology in female Harlan Sprague-Dawley rats after chronic treatment with 2,3,7,8-tetrachlorodibenzo-p-dioxin and dioxin-like...
It's all in the interaction: quantitating gene networks.(Environews / Science Selections)
Gene interaction network suggests dioxin induces a significant linkage between aryl hydrocarbon receptor and retinoic acid receptor...
Biokinetics and subchronic toxic effects of oral arsenite, arsenate, monomethylarsonic acid, and dimethylarsinic acid in v-Ha-ras transgenic (Tg.AC)...
Use of a physiologically based pharmacokinetic model for rats to study the influence of body fat mass and induction of CYP1A2 on the pharmacokinetics...

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles