Spread of Streptococcus suis sequence type 7, China.Streptococcus suis Streptococcus suis is spherical, Gram-positive bacteria, and an important pathogen of pigs. Endemic in nearly all countries with an extensive pig industry, S. suis is also a zoonotic disease, capable of transmission to humans from pigs. sequence type (ST) 7 has been spreading throughout China. To determine events associated with its emergence, we tested 114 isolates. In all 106 ST7 strains responsible for human outbreaks and sporadic infections, the tetracycline-resistance gene, tetM, was detected on the conjugative transposon transposon /trans·po·son/ (trans-po´zon) a small mobile genetic (DNA) element that moves around the genome or to other genomes within the same cell, usually by copying itself to a second site but sometimes by splicing itself out of its Tn916. Horizontal transmission horizontal transmission n. Transmission of infection by contact. horizontal transmission Epidemiology The transmission of an infection from one to another person of the same generation in the same population. of tetM is suspected. ********** A large outbreak of Streptococcus suis serotype serotype /se·ro·type/ (ser´o-tip) the type of a microorganism determined by its constituent antigens; a taxonomic subdivision based thereon. se·ro·type n. See serovar. v. 2 infection emerged in the summer of 2005 in Sichuan Province, People's Republic People's Republic n. A political organization founded and controlled by a national Communist party. of China, and resulted in 215 cases and 38 deaths among humans (1). Sporadic infections were identified in 4 other provinces. A smaller, previously overlooked, outbreak occurred in Jiangsu Province in 1998; 25 cases and 14 deaths were reported (1,2). The causative caus·a·tive adj. 1. Functioning as an agent or cause. 2. Expressing causation. Used of a verb or verbal affix. caus agent of the Sichuan and Jiangsu outbreaks was identified as a clone of S. suis sequence type (ST) 7 (3). ST7 was first identified in 1996 in a patient with meningitis in Hong Kong Hong Kong (hŏng kŏng), Mandarin Xianggang, special administrative region of China, formerly a British crown colony (2005 est. pop. 6,899,000), land area 422 sq mi (1,092 sq km), adjacent to Guangdong prov. and later caused the 1998 outbreak in Jiangsu; it spread further to cause the largest outbreak in Sichuan in 2005 (3,4). The spread of S. suis ST7 across China underscores the need to better understand the genetic and ecologic events associated with its emergence as an important pathogen Pathogen Any agent capable of causing disease. The term pathogen is usually restricted to living agents, which include viruses, rickettsia, bacteria, fungi, yeasts, protozoa, helminths, and certain insect larval stages. in humans. The Study Using the MICroSTREP Plus system (Dade Behring, Deerfield, IL, USA), we tested 114 ST7 isolates from China and found that all isolates were resistant to tetracycline tetracycline (tĕ'trəsī`klēn), any of a group of antibiotics produced by bacteria of the genus Streptomyces. They are effective against a wide range of Gram positive and Gram negative bacteria, interfering with protein and susceptible to 12 of 13 antimicrobial antimicrobial /an·ti·mi·cro·bi·al/ (-mi-kro´be-al) 1. killing microorganisms or suppressing their multiplication or growth. 2. an agent with such effects. drugs. Of these 114, 6 were isolated in 2006, 84 were from human patients and 8 from diseased pigs in the 2005 Sichuan outbreak, 7 were from sporadic human cases and 3 from diseased pigs in other provinces in 2005, and 4 were from human patients and 2 from diseased pigs in the 1998 Jiangsu outbreak (Table 1). The isolates were susceptible to penicillin penicillin, any of a group of chemically similar substances obtained from molds of the genus Penicillium that were the first antibiotic agents to be used successfully in the treatment of bacterial infections in humans. , ampicillin ampicillin (ăm'pĭsĭl`ĭn), a penicillin-type antibiotic that is effective against both gram-negative microorganisms and gram-positive microorganisms such as Escherichia coli. , cefotaxime, ceftriaxone ceftriaxone /cef·tri·ax·one/ (cef?tri-ak´son) a semisynthetic, ß–resistant, third-generation cephalosporin effective against a wide range of gram-positive and gram-negative bacteria, used as the sodium salt. , cefepime, meropenem, levofloxacin, chloramphenicol chloramphenicol (klōr'ămfĕn`əkŏl'), antibiotic effective against a wide range of gram-negative and gram-positive bacteria (see Gram's stain). It was originally isolated from a species of Streptomyces bacteria. , erythromycin erythromycin (ĭrĭth'rōmī`sĭn), any of several related antibiotic drugs produced by bacteria of the genus Streptomyces (see antibiotic). , azithromycin, clindamycin, and vancomycin vancomycin (văn'kōmī`sĭn), antibiotic resembling penicillin in the way it acts. It is derived from the bacterium Streptomyces orientalis, which was isolated from soil of India and Indonesia. . In contrast, 7 of 12 S. suis serotype 2 strains from other countries and 18 of 34 serotype reference strains were resistant to tetracycline; 3 tetracycline-resistant strains were also resistant to erythromycin, azithromycin, and clindamycin. Multilocus sequence typing Multilocus sequence typing (MLST) is a technique in molecular biology for the typing of multiple loci. The procedure characterizes isolates of bacterial species using the DNA sequences of internal fragments of multiple (usually seven) housekeeping genes. analysis showed that of the 114 isolates from China, 106 were typed as ST7: 98 from the Sichuan and Jiangsu outbreaks, 5 from sporadic infections in other provinces in 2005 and 2006, and 3 from diseased pigs from other provinces in 2005. Of the other 8 isolates from sporadic cases in 2005 and 2006, 7 were ST1 and 1 was untypeable. Of the 12 serotype 2 strains from other countries, 8 were ST1 and 4 were ST25. Of the 34 serotype reference strains, serotype 2 strain R735 was ST1, 10 serotypes were untypeable, and 22 STs were identified as ST6 (serotypes 17 and 19), ST35, ST53-55, ST68-73, ST75-82, ST87, or ST91-2. Serotype 17 and 19 strains were identified as ST76 (Table 1) (5,6). PCR PCR polymerase chain reaction. PCR abbr. polymerase chain reaction Polymerase chain reaction (PCR) was used to screen all isolates for tetracycline resistance genes; primers specific for tetABCDEGKLMOQS were used (7,8). Of the 114 tetracycline-resistant isolates from China, 111 (all 106 ST7 strains and 5 of 7 ST1 strains) harbored the tetM gene. The tetO gene was carried by 1 ST1 and 1 sequence-untypeable strain. All 7 tetracycline-resistant serotype 2 strains from other countries and 16 of 18 tetracycline-resistant strains in the 34 reference serotypes carried the tetO gene (Table 1) (5,6). The only other tetM-positive strain was from serotype 13, an ST71 isolated from a diseased pig in Denmark (Table 1). The PCR results were confirmed by sequencing the PCR-synthesized fragments. To further characterize the tetM genes, the open reading frame (ORF) was completely sequenced by using 16 selected strains: 9 isolates from humans and 1 from a pig from the Sichuan outbreak; 3 from sporadic infections in Guangxi, Jiangsu, and Guangdong; 1 from a diseased pig in Jiangxi Province in 2005; and 2 from the Jiangsu outbreak in 1998 (Table 1). Sequence alignments showed 2 groups (GenBank accession nos. EF 101931, EF016118). The first group comprised 15 of the 16 isolates typed as ST7 (3). The second group had only 1 isolate, GX1, typed as ST1 (3). The sequences of tetM gene for ST7 (strain SC84) and ST1 (GX1) were 1,920 and 1,917 bp, respectively, with 90 nt variations between the 2 sequences leading to 32 aa changes. Comparison of the 53 tetM sequences with those from public databases showed that the tetM of S. suis SC84 was most related to Enterococcus faecium Enterococcus faecium A nosocomial pathogen resistant to most antibiotics–eg, penicillin, teicoplanin, aminoglycosides, glycopeptides; ID of E faecium in a clinical specimen requires Pt isolation with barrier precautions. isolate 9830470-4 plasmid plasmid Genetic element not contained within a chromosome. It occurs in many bacterial strains. Plasmids are circular DNA molecules that replicate independently of the bacterial chromosome. They are not essential for the bacterium but may give it a selective advantage. pYA470-4 (DQ223243) (7). The tetM sequence of S. suis ST1 strain GX1 was most closely related to S. pneumoniae Tn916-like/Tn2009 (AY466395) and to Gardnerella vaginali (U58986) (Figure 1) (9). Because the gene tetM is reported to be associated with transposon Tn916, we designed 24 pairs of primers targeting its 24 ORFs based on published Tn916 sequences (Table 2). The complete sequence of Tn916 from SC84 was obtained by sequencing the PCR-synthesized fragments. Between Tn916 of SC84 and plasmid pYA470-4 of E. faecium, we observed 133 nt variations, 91 of which were in the tetM gene, 3 in the integrase gene, 1 in excisionase gene, and 38 in 10 additional ORFs. PCR showed that 111 isolates from China and 1 from Denmark have intact Tn916 (Table 1). The most recognized virulence Virulence The ability of a microorganism to cause disease. Virulence and pathogenicity are often used interchangeably, but virulence may also be used to indicate the degree of pathogenicity. genes of S. suis, including mrp, sly, and ef were detected by PCR in all 114 Chinese isolates tested in this study. Of the 12 serotype 2 strains from other countries, 6 of 8 ST1 strains were positive for all 3 virulence genes. However, none of the 4 ST25 strains tested positive (Table 1). Of the 34 serotype reference strains, serotype 2 strain R735 was positive for mrp and sly. The sly gene was detected in 10 reference strains that were typed serotype 1/2 as untypeable, serotype 2 as ST1, serotype 4 as ST54, 5 as ST53, 7 as untypeable, 13 as ST71, 14 as ST6, 16 as ST73, 17 as ST76, and 18 as ST79 (Table 1). [FIGURE 1 OMITTED] To determine the significance of horizontal gene transfer “HGT” redirects here. For other uses, see HGT (disambiguation). Horizontal gene transfer (HGT), also Lateral gene transfer (LGT), is any process in which an organism transfers genetic material to another cell that is not its offspring. of Tn916 with the tetM and virulence genes, we constructed a rooted phylogenetic tree phylogenetic tree Diagram showing the evolutionary interrelations of a group of organisms that usually originated from a shared ancestral form. The ancestor is in the tree trunk; organisms that have arisen from it are placed at the ends of tree branches. by using the maximum-parsimony method. The sequence of S. pneumoniae R6 was chosen as the outgroup that is closely related to S. suis (10). The data suggest S. suis ST7 evolved originally from ST1 and ST48. The horizontal transfer of tested virulence genes and tetM occurred in various stages of the evolution of S. suis and played a major role in the emergence of ST1 and ST7 (Figure 2). Conclusions We report that S. suis ST7 was responsible for 2 large outbreaks and sporadic infections in several provinces of China and has recently acquired the tetracycline resistance gene, tetM, associated with the conjugative transposon Tn916 (3, 7). Horizontal transfer of Tn916 with the tetM gene occurred in at least 3 STs located at various stages in the constructed phylogenetic tree and played a central role in the evolution of the epidemic S. suis ST7 clone. All 3 virulence genes tested in this study were shown to be transferred horizontally (11-13). [FIGURE 2 OMITTED] Our data support the contention that Tn916 with tetM acts as an important selective factor that provides considerable advantages for the clone emergence and spread of S. suis ST7 (3). The widespread use of tetracycline in swine feed could provide the selective pressure for clone amplification and spreading, thus contributing to the outbreak of S. suis ST7 through Tn916 (14). The countrywide spread of S. suis ST7-tetM represents a model of selective pressure leading to the emergence of a bacterium as a virulent vir·u·lent adj. 1. Extremely infectious, malignant, or poisonous. Used of a disease or toxin. 2. Capable of causing disease by breaking down protective mechanisms of the host. Used of a pathogen. 3. pathogen in humans. The case of S. suis ST7 is a sign that pathogens present in food animals can result in substantial public health problems if no action is taken to prevent the indiscriminate in·dis·crim·i·nate adj. 1. Not making or based on careful distinctions; unselective: an indiscriminate shopper; indiscriminate taste in music. 2. use of antimicrobial drugs in animal feed (15). This work was supported by grants (2005CB522904 and 2003BA712A02 to J.X.) from the Ministry of Science and Technology, People's Republic of China. References (1.) Yu H, Jing jing (jing) [Chinese] one of the basic substances that according to traditional Chinese medicine pervade the body, usually translated as "essence"; the body reserves or constitutional makeup, replenished by food and rest, that supports H, Chen Z, Zheng H, Zhu X, Wang H, et al. Human Streptococcus suis outbreak, Sichuan, China. Emerg Infect Dis. 2006;12:914-20. (2.) Zhu F, Yang H, Hu X, Wang H, Wang G, Song Y, et al. Homogeneity Homogeneity The degree to which items are similar. study on the Streptococcus suis isolated from human and swine [in Chinese]. Zhonghua Liu Xing Liu Xing (Traditional: 劉星; Simplified: 刘星; Pinyin: Liú Xīng; born December 10, 1984) is a Chinese professional Go player. Biography Liu started to learn Go at the age of 6. Bing Xue Za Zhi. 2000;21:427-9. (3.) Ye C, Zhu X, Jing H, Du H, Segura M, Zheng H, et al. Streptococcus suis sequence type 7 outbreak, Sichuan, China. Emerg Infect Dis. 2006;12:1203-8. (4.) King SJ, Leigh JA, Heath PJ, Luque I, Tarradas C, Dowson CG, et al. Development of a multilocus sequence typing scheme for the pig pathogen Streptococcus suis: identification of virulent clones and potential capsular cap·su·lar adj. Of, relating to, or resembling a capsule. Adj. 1. capsular - resembling a capsule; "the capsular ligament is a sac surrounding the articular cavity of a freely movable joint and attached to the bones" serotype exchange. J Clin Microbiol. 2002;40: 3671-80. (5.) Gottschalk M, Higgins R, Jacques M, Mittal KR, Henrichsen J. Description of 14 new capsular types of Streptococcus suis. J Clin Microbiol. 1989;27:2633-6. (6.) Gottschalk M, Higgins R, Jacques M, Beaudoin M, Henrichsen J. Characterization of six new capsular types (23 through 28) of Streptococcus suis. J Clin Microbiol. 1991;29:2590-4. (7.) Agerso Y, Pedersen AG, Aarestrup FM. Identification of Tn5397-like and Yn916-like transposons Transposons Types of transposable elements which comprise large discrete segments of deoxyribonucleic acid (DNA) capable of moving from one chromosome site to a new location. and diversity of the tetracycline resistance gene tet(M) in enterococci enterococci bacteria in the genus Enterococcus. from humans, pigs and poultry. J Antimicrob Chemother. 2006;57:832-9. (8.) Ng LK, Martin I, Alfa M, Mulvey M. Multiplex See multiplexing. PCR for the detection of tetracycline resistant genes 20. Mol Cell Probes. 2001;15: 209-15. (9.) Morse SA, Johnson SR, Biddle JW, Roberts MC. High-level tetracycline resistance in Neisseria gonorrhoeae Neisseria gon·or·rhoe·ae n. Gonococcus. Neisseria gonorrhoeae The bacterium that causes gonorrhea. It cannot survive for any length of time outside the human body. is result of acquisition of streptococcal streptococcal /strep·to·coc·cal/ (-kok´al) pertaining to or caused by a streptococcus. Streptococcal (Streptococcus) Pertaining to any of the Streptococcus bacteria. tetM determinant 4. Antimicrob Agents Chemother. 1986;30:664-70. (10.) Hoskins J, Alborn WE Jr, Arnold J, Blaszczak LC, Burgett S, DeHoff BS, et al. Genome of the bacterium Streptococcus pneumoniae Streptococcus pneu·mo·ni·ae n. Pneumococcus. Streptococcus pneumoniae Microbiology A pathogenic streptococcus with 90 serotypes associated with pneumonia, bacteremia, meningitis Transmission Person to person Incidence strain R6. J Bacteriol. 2001;183:5709-17. (11.) Okwumabua O, O'Connor M, Shull E. A polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is (PCR) assay specific for Streptococcus suis based on the gene encoding See encode. the glutamate dehydrogenase Glutamate dehydrogenase is an enzyme, present in mitochondria of eukaryotes, as are some of the other enzymes required for urea synthesis, that converts glutamate to α-Ketoglutarate, and vice versa. . FEMS FEMS Federation of European Microbiological Societies FEMS Federation of European Materials Societies FEMS Fabrication Engineering Management System FEMS Facility Equipment Maintenance System (PMEL/TMDE) Microbiol Lett. 2003;218:79-84. (12.) Silva LM, Baums CG, Rehm T, Wisselink HJ, Goethe R, Valentin-Weigand P. Virulence-associated gene profiling of Streptococcus suis isolates by PCR. Vet Microbiol. 2006;115:117-27. (13.) Wisselink HJ, Joosten JJ, Smith HE. Multiplex PCR assays for simultaneous detection of six major serotypes and two virulence-associated phenotypes of Streptococcus suis in tonsillar tonsillar /ton·sil·lar/ (ton´si-lar) of or pertaining to a tonsil. ton·sil·lar or ton·sil·lar·y adj. Of or relating to a tonsil, especially the palatine tonsil. specimens from pigs. J Clin Microbiol. 2002;40:2922-9. (14.) Klare I, Konstabel C, Badstubner D, Werner G, Witte W. Occurrence and spread of antibiotic resistances antibiotic resistance, n the ability of certain strains of microorganisms to develop resistance to antibiotics. antibiotic resistance in Enterococcus faecium 6. Int J Food Microbiol. 2003;88:269-90. (15.) Yang H, Chen S, White DG, Zhao S Zhao can mean:
Changyun Ye,* ([dagger])(1) Xuemei Bai, ([dagger]) (1) Ji Zhang, ([dagger]) (1) Huaiqi Jing, ([dagger]) (1) Han Zheng Han Zheng (Chinese: ) (born in Cixi, Zhejiang province, April 1954) is the current mayor of Shanghai, the 13th to serve in the position since the founding of the People's Republic of China. , * (1) Huamao Du, ([dagger]) Zhigang Cui, ([dagger]) Shouying Zhang, ([dagger]) Dong Jin, * Yanmei Xu, * Yanwen Xiong, * Ailan Zhao, * Xia Luo, * Qiangzheng Sun, * Marcelo Gottschalk, ([double dagger double dagger n. A reference mark (  ) used in printing and writing. Also called diesis.Noun 1. ]) and Jianguo Xu * ([dagger]) * State Key Laboratory for Infectious Disease Infectious disease A pathological condition spread among biological species. Infectious diseases, although varied in their effects, are always associated with viruses, bacteria, fungi, protozoa, multicellular parasites and aberrant proteins known as prions. Prevention and Control, Beijing, People's Republic of China; ([dagger]) National Institute for Communicable Disease communicable disease n. A disease that is transmitted through direct contact with an infected individual or indirectly through a vector. Also called contagious disease. Control and Prevention, Changping, People's Republic of China; and ([double dagger]) Universite de Montreal, Montreal, Quebec, Canada (1) These authors contributed equally to this article. Address for correspondence: Jianguo Xu, National Institute of Communicable Disease Control and Prevention, Chinese Center for Disease Control and Prevention Noun 1. Center for Disease Control and Prevention - a federal agency in the Department of Health and Human Services; located in Atlanta; investigates and diagnoses and tries to control or prevent diseases (especially new and unusual diseases) CDC , PO Box 5, Changping, Beijing 102206, People's Republic of China; email: xujg@public.bta.net.cn Dr Ye is a microbiologist at the State Key Laboratory for Infectious Disease Prevention and Control, Beijing. Her main research interest is emerging infectious diseases An emerging infectious disease (EID) is an infectious disease whose incidence has increased in the past 20 years and threatens to increase in the near future. EIDs include diseases caused by a newly identified microorganism or newly identified strain of a known microorganism (e.g. . She is a group leader for the study of S. suis infection in China.
Table 1. Source, serotype, sequence type, and tetracycline-resistant
genes in Streptococcus suis strains *
Year of
No. Place of isolation Serotype
strains Source (no.) isolation (no.) (no.)
98 outbreak-associated ST7 strains in China
84 Human Sichuan, 2005 2
patients China
8 Diseased Sichuan, 2005 2
pigs China
4 Human Jiangsu, 1998 4
patients China
2 Diseased Jiangsu, 1998 2
pigs China
8 ST7 strains isolated from sporadic cases in China
5 Human 6 provinces, 2005 (2) 2
patients China 2006 (3)
3 Diseased Jiangxi, 2005 2
pigs China
7 ST1 and 1 untypeable strain isolated from sporadic cases in China
5 Human Guizhou, 2005 2 (4)
patients Guangxi (4) 14
3 Human 3 provinces 2006 2
patients
12 serotype 2 strains from other countries
5 Human Netherlands NA 2
patients (2), France
(3)
3 Diseased Netherlands, NA 2
pigs France,
England
4 Human Canada (3), NA 2
patients (2), England
healthy pigs,
diseased
pigs
34 serotype reference strains
1 Human Netherlands NA 14
patients
1 Diseased pig Denmark NA 13
25 Diseased Canada (11), NA 1/2, 2-12,
pigs Denmark (5), 15-16,
Netherlands 22-30,
(9) 32, 34
2 Diseased Canada, NA 20, 31
calves United States
1 Diseased Canada NA 33
lamb
4 Healthy pigs Canada NA 17-19, 21
tet gene
No. (no. Tn916
strains Source (no.) ST (no.) positive) (no.)
98 outbreak-associated ST7 strains in China
84 Human ST7 tetM (84) Intact
patients (84)
8 Diseased ST7 tetM (8) Intact
pigs (8)
4 Human ST7 tetM (4) Intact
patients (4)
2 Diseased ST7 tetM (2) Intact
pigs (2)
8 ST7 strains isolated from sporadic cases in China
5 Human ST7 tetM (5) Intact
patients (5)
3 Diseased ST7 tetM (3) Intact
pigs (3)
7 ST1 and 1 untypeable strain isolated from sporadic cases in China
5 Human ST1 tetM (4) Intact
patients (4)
3 Human ST1 (2) tetO (2) Intact
patients UT tetM (1)
12 serotype 2 strains from other countries
5 Human ST1 tetO (3)
patients
3 Diseased ST1
pigs
4 Human ST25 tetO (4)
patients (2),
healthy pigs,
diseased
pigs
34 serotype reference strains
1 Human ST6
patients
1 Diseased pig ST71 tetM Intact
25 Diseased ST1, ST35, tetO (11)
pigs ST53-55, ST68,
ST69, ST72-73,
ST75, ST77-78,
ST80-82, ST87,
ST91-92, UT (7)
2 Diseased ST70 (1), UT (1) tetO (1)
calves
1 Diseased UT
lamb
4 Healthy pigs ST76 (2), ST79, tetO (4)
UT
Virulence genes (no.)
No.
strains Source (no.) cps2j mrp sly ef
98 outbreak-associated ST7 strains in China
84 Human + + + +
patients (84) (84) (84) (84)
8 Diseased + (8) + (8) + (8) + (8)
pigs
4 Human + (4) + (4) + (4) + (4)
patients
2 Diseased + (2) + (2) + (2) + (2)
pigs
8 ST7 strains isolated from sporadic cases in China
5 Human + (5) + (5) + (5) + (5)
patients
3 Diseased + (3) + (3) + (3) + (3)
pigs
7 ST1 and 1 untypeable strain isolated from sporadic cases in China
5 Human + (4) + (4) + (4) + (4)
patients
3 Human + (3) + (3) + (3) + (3)
patients
12 serotype 2 strains from other countries
5 Human + (5) + (5) + (5) + (4)
patients
3 Diseased + (3) + (3) + (3) + (2)
pigs
4 Human + (4) -- -- --
patients (2),
healthy pigs,
diseased
pigs
34 serotype reference strains
1 Human -- -- + --
patients
1 Diseased pig -- -- + --
25 Diseased + (2) + (2) + (7) + (1)
pigs
2 Diseased -- -- -- --
calves
1 Diseased -- -- -- --
lamb
4 Healthy pigs -- -- + (2) --
* ST, sequence type; tet, tetracycline; UT, untypeable by multilocus
sequence typing; NA, not available.
Table 2. Primers used to detect tet genes and conjugative transposon
Tn916 in Streptococcus suis *
Gene Primers (5' [right arrow] 3')
tetA GCTACATCCTGCTTGCCTTC; CATAGAT000CGTGAAGAGG
tetB TTGGTTAGGGGCAAGTTTTG; GTAATGGGCCAATAACACCG
tetC CTTGAGAGCCTTCAACCCAG; ATGGTCGTCATCTACCT000
tetD AAACCATTACGGCATTCTGC; GACCGGATACACCATCCATC
tetE AAACCACATCCTCCATACGC; AAATA000CACAACCGTCAG
tetG GCTCGGTGGTATCTCTGCTC; AGCAACAGAATCGGGAACAC
tetK TCGATAGGAACAGCAGTA; CAGCAGATCCTACTCCTT
tetL TCGTTAGCGTGCTGTCATTC; GTATCCCACCAATGTAGCCG
tetM GTGGACAAAGGTACAACGAG; CGGTAAAGTTCGTCACACAC
tetO AACTTAGGCATTCTGGCTCAC; T000ACTGTTCCATATCGTCA
tetQ TTATACTTCCTCCGGCATCG; ATCGGTTCGAGAATGTCCAC
tetS CATAGACAAGCCGTTGACC; ATGTTTTTGGAACGCCAGAG
ORF24 ATGAGGTGTCTATTTTTTTA; TTATT000TGAATGAATGTT
ORF 23 AATTTGTGATTCCCAACATG; CGTCAGCATGTAAAAGGTAA
ORF 22 ATGATGAGATTAGCAAATGG; CTATTTGTCTTGTGT000TT
ORF 21 TTTCATTTTACGATAGCGTC; GTCGCCTGCGTGGACTGTCT
ORF 20 ATGCTGTTTGATTATGTAAG; TTATTTTTTTGTTGTTATCA
ORF 19 ATGAATTTTGGACAAAACCT; TTAAGCACCAATAAT000AT
ORF 18 TTTAGGCAAATACAATGAGG; GATTGGTTGAGATAAACGTT
ORF 17 ATGGGATTTTTGAAATCGTC; TTAATTGGATAT000ATAAA
ORF 16 ATGGCATATCCAATTAAATA; TTACACCTCTTTTCGCACAG
ORF 15 ATGTGAAACCATCAATAGTA; TCATCTGAAAATAAAAT000
ORF 14 ATGAAGTTGAAAACTTTAGT; TCATTGTTTGATTCGTCCTG
ORF 13 AGAAAAACAGATACCAAAGG; CGTTCTTTTCAAGTACCAAA
ORF 12-tetM ATGCTTTGTATGCCTATGGT; CTAAGTTATTTTATTGAACA
ORF 5-10 ATTATAAACTACAAGTGGAT; TTCGTTTAATCTGAATACGA
Xis-Tn ATGAAGCAGACTGACATTCC; TTCGTTTAATCTGAATACGA
Int-Tn GACTGGAGAGAGCCAACGAA; CATCATGCCGTTGTAATCAC
Annealing
Gene Product size, bp temperature, [degrees]C
tetA 210 55
tett3 659 55
tetC 418 55
tetD 787 55
tetE 278 55
tetG 468 55
tetK 169 55
tetL 267 55
tetM 406 55
tetO 515 55
tetQ 904 55
tetS 667 55
ORF24 120 52
ORF 23 315 52
ORF 22 387 52
ORF 21 1,308 55
ORF 20 990 52
ORF 19 222 52
ORF 18 443 56
ORF 17 507 52
ORF 16 2,448 52
ORF 15 2,265 52
ORF 14 1,002 52
ORF 13 860 54
ORF 12-tetM 2,022 54
ORF 5-10 2,233 52
Xis-Tn 204 52
Int-Tn 925 54
* tet, tetracycline; ORF, open reading frame.
|
|
||||||||||||||||||||
Printer friendly
Cite/link
Email
Feedback
Reader Opinion