Spotted fever group and typhus group rickettsioses in humans, South Korea.The presence of the nucleic acid nucleic acid, any of a group of organic substances found in the chromosomes of living cells and viruses that play a central role in the storage and replication of hereditary information and in the expression of this information through protein synthesis. of the spotted fever spot·ted fever n. A tick typhus caused by Rickettsia rickettsii, such as Rocky Mountain spotted fever. spotted fever Rocky Mountain spotted fever, see there group (SPG SPG - System Program Generator. A compiler-writing language. ["A System Program Generator", D. Morris et al, Computer J 13(3) (1970)]. ) and typhus typhus, any of a group of infectious diseases caused by microorganisms classified between bacteria and viruses, known as rickettsias. Typhus diseases are characterized by high fever and an early onset of rash and headache. group (TG) rickettsiae was investigated in 200 serum specimens seropositive seropositive /se·ro·pos·i·tive/ (-poz´i-tiv) showing positive results on serological examination; showing a high level of antibody. se·ro·pos·i·tive adj. for SFG SFG StanCorp Financial Group SFG San Francisco Giants (baseball team) SFG Special Forces Group SFG Sum Frequency Generation SFG Square Foot Gardening SFG Symmetrical Field Geometry (JBL speaker technology) rickettsiae by multiplex-nested polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is with primers derived from the rickettsial rickettsial /rick·ett·si·al/ (ri-ket´se-al) pertaining to or caused by rickettsiae. rick·ett·si·al adj. Relating to, or caused by a member of the genus Rickettsia. outer membrane protein B gene. The DNA DNA: see nucleic acid. DNA or deoxyribonucleic acid One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes. of SFG, TG, or both rickettsiae was amplified in the 24 serum specimens, and sequence analysis showed Rickettsia conorii Rickettsia co·no·ri·i n. A bacterium that causes boutonneuse fever in humans. , R. japonica japonica (jəpŏn`əkə): see quince; camellia. , and R. fefis in the specimens. R. conorii and R. typhi were found in 7 serum specimens, which indicated the possibility of dual infection in these patients. These findings suggest that several kinds of rickettsial diseases, including boutonneuse fever bou·ton·neuse fever n. A tick-borne disease seen primarily in the Mediterranean and South Africa, caused by Rickettsia conori, and characterized by rash, fever, headache, and muscle and joint pain. , rickettsialpox, R. felis infection, and Japanese spotted fever, as well as scrub typhus scrub typhus: see rickettsia; typhus. and murine typhus murine typhus n. A comparatively mild, acute, endemic form of typhus caused by the microorganism Rickettsia typhi, transmitted from rats to humans by fleas and characterized by fever, headache, and muscular pain. Also called endemic typhus. , are occurring in Korea. ********** Human rickettsioses Rickettsioses Often severe infectious diseases caused by several diverse and specialized bacteria, the rickettsiae and rickettsia-like organisms. The best-known rickettsial diseases infect humans and are usually transmitted by parasitic arthropod vectors. , known to occur in Korea, include mainly scrub typhus, murine typhus, and epidemic typhus epidemic typhus n. A form of typhus characterized by high fever, mental and physical depression, and macular and papular eruptions; it is caused by Rickettsia prowazekii and transmitted by body lice. . Scrub typhus, caused by Orientia tsutsugamushi Orientia tsutsugamushi obligately intracellular bacteria that cause scrub typhus in humans and many small feral mammals, especially rodents and occasionally dogs. , a major rickettsial disease in Korea, is transmitted through the bites of mite larvae Larvae, in Roman religion Larvae: see lemures. . An earlier study by Choi and colleagues reported that 34.3% of febrile febrile /feb·rile/ (feb´ril) pertaining to or characterized by fever. feb·rile adj. Of, relating to, or characterized by fever; feverish. hospital patients in autumn were seropositive for the disease (1). Rickettsia rickettsia (rĭkĕt`sēə), any of a group of very small microorganisms, many disease-causing, that live in vertebrates and are transmitted by bloodsucking parasitic arthropods such as fleas, lice (see louse), and ticks. typhi, transmitted by the fleas of various rodents, causes murine typhus, which is a milder form of typhus than human typhus (2). The first patient with murine typhus in Korea was reported in 1959. Two cases of routine typhus confirmed by culture were reported since 1988 (3,4), and now [greater than or equal to] 200 cases of murine typhus are presumed to occur annually in South Korea. Epidemic typhus is caused by R. prowazekii and is transmitted by the body louse body louse n. A parasitic louse that infests the body and clothes of humans. (5). The disease is fatal in 10% to 30% of patients, depending on underlying diseases and the nutritional state of the host (2). The disease appeared after the end of the Korean War Korean War, conflict between Communist and non-Communist forces in Korea from June 25, 1950, to July 27, 1953. At the end of World War II, Korea was divided at the 38th parallel into Soviet (North Korean) and U.S. (South Korean) zones of occupation. . Since 1951, however, no other cases have been reported in Korea (6). Spotted fever group (SFG) rickettsioses are associated with arthropods, such as ticks, mites, and fleas (2). SFG comprises several divergent lineages: the R. rickettsii group, R. japonica, R. montana, the R. massiliae group, R. helvetica, R. felis, and the R. akari group (2). Recently, the nucleic acids Nucleic acids The cellular molecules DNA and RNA that act as coded instructions for the production of proteins and are copied for transmission of inherited traits. of R. japonica and R. rickettsii were found in Haemaphysalis longicornis in Korea (7). A previous seroepidemiologic study demonstrated that SFG rickettsioses were highly likely in Korea (8). No clinical human case of SFG rickettsioses, however, has been reported in Korea until now. In this study, to check whether SFG rickettsioses were present in humans, serum specimens from patients with acute febrile disease were studied by using molecular sequence based identification techniques. We report the presence of the rompB gene of SFG rickettsiae, similar to R. akari, R. conorii, R. japonica, and R. felis, in serum specimens from Korean patients with acute febrile disease. The nucleic acids of both R. conorii and R. typhi were found to coexist in 7 serum specimens. This study presents the first molecular evidence of SFG rickettsioses in humans. Materials and Methods Rickettsial Strains The following strains were obtained from the American Type Culture Collection American Type Culture Collection (ATCC) is a private, not-for-profit biological resource center whose mission focuses on the acquisition, authentication, production, preservation, development and distribution of standard reference microorganisms, cell lines and other materials for (ATCC ATCC American Type Culture Collection, see there ; Manassas, VA, USA): R. typhi Wilmington (VR-144), R. prowazekii Breinl (VR-142), R. akari MK (VR- 148), R. japonica YH (VR- 1363), R. conorii Indian Tick Typhus tick typhus n. Any of various tick-borne rickettsial diseases identified by their immunological reactions and, in some cases, by their pathogenicity. (VR-597), and R. sibirica 246 (VR-151). These rickettsial agents were propagated in Vero (CRL-1586) or L929 (CCL-1) cell monolayers. Serum Samples and Serologic Testing The serum specimens analyzed in this study were obtained from South Korean patients with acute febrile illness acute febrile illness A nonspecific term for an illness of sudden onset accompanied by fever from 1993 to 1999. The specimens were submitted to the Institute of Endemic Disease Endemic disease An infectious disease that occurs frequently in a specific geographical locale. The disease often occurs in cycles. Influenza is an example of an endemic disease. at Seoul National University's Medical Research Center for laboratory diagnosis for scrub typhus, leptospirosis leptospirosis (lĕp'təspīrō`sĭs), febrile disease caused by bacteria of the genus Leptospirae. The disease occurs in dogs, cattle, pigs, sheep, goats, and horses and is transmissible to humans. , and hemorrhagic fever with renal syndrome hemorrhagic fever with renal syndrome n. See epidemic hemorrhagic fever. caused by hantavirus hantavirus, any of a genus (Hantavirus) of single-stranded RNA viruses that are carried by rodents and transmitted to humans when they inhale vapors from contaminated rodent urine, saliva, or feces. There are many strains of hantavirus. . Some of the serum specimens were used for the nucleic acid detection study of SFG rickettsial agents. The rationale for selecting the samples for polymerase chain reaction (PCR PCR polymerase chain reaction. PCR abbr. polymerase chain reaction Polymerase chain reaction (PCR) ) analysis included the presence of immunoglobulin (Ig) M antibodies with titers from 1:40 to 1:160 against any of the tested antigens in the samples. Serologic testing was performed by indirect immunofluorescence assay (IFA Immunofluorescent assay (IFA) A blood test sometimes used to confirm ELISA results instead of using the Western blotting. In an IFA test, HIV antigen is mixed with a fluorescent compound and then with a sample of the patient's blood. ) with a panel of 4 SFG rickettsial antigens, R. japonica, R. akari, R. conorii, and R. sibirica, as previously described (8). Oligonucleotide Primers The oligonucleotide primers used for priming the PCRs are shown in Table 1. The primers were developed on the basis of the rompB gene sequences of R. conorii strain Seven (GenBank accession no. AF 123721), and the citrate synthase (gltA) gene sequence of R. prowazekii (GenBank accession no. M17149) was synthesized. The selection of the primers was based on the "primer 3" program (http://www-genome.wi.mit.edu/cgi-bin/primer/ primer3 www.cgi/), to obtain the optimal melting temperature and GC content and to avoid hairpin hairpin a secondary structure that occurs in single-strand RNA during protein synthesis in which the strand turns back on itself. The structure is the result of base pairing and hydrogen bond formation. loop structures. The selected sequences were analyzed through the BLAST program (http://www.ncbi.nlm.nih.gov/BLAST). Detection of rompB Gene in Human Sera DNA for PCR analysis was extracted from 200 [micro]L of serum samples by using QIAamp Blood Mini Kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer's instructions. SFG and typhus group (TG) rickettsia rompB gene in human sera were detected with multiplex nested PCR. The primary amplification of the specimen was performed in a final reaction volume of 50 [micro]L. The reaction mixture contained 5 [micro]L of prepared DNA sample, 20 pmol of rompB outer forward primer (OF) and outer reverse primer (OR), 200 [micro]M of deoxynucleoside triphosphate triphosphate /tri·phos·phate/ (tri-fos´fat) a salt containing three phosphate radicals. tri·phos·phate n. A salt or ester containing three phosphate groups. mixture (dNTP, Takara, Otsu, Japan), 1 x PCR buffer, 1.25 U Taq polymerase (Takara EX Taq, Takara), and distilled water. First, PCR reactions were incubated at 95[degrees]C for 5 min, subjected to 35 cycles of 95[degrees]C for 15 s, 54[degrees]C for 15 s, and 72[degrees]C for 30 s, and final extension at 72[degrees]C for 3 min in a GeneAmp PCR system 9600 (Perkin-Elmer Applied Biosystems, Foster City, CA, USA). After this, 2 [micro]L of the amplified product was again amplified in a nested fashion with inner primer sets (rompB SFG IF, rompB SFG/TG IR, and rompB TG IF). The nested PCR reaction mixture contained 10 pmol of each primer in a PCR premixture tube (AccuPower PCR PreMix premix a finite mixture of nutritional supplements such as minerals and vitamins, usually combined with a carrier and ready for mixing with a total ration. , Bioneer Corp., Daejon, Korea) that contained 1 U of Taq DNA polymerase DNA polymerase /DNA po·lym·er·ase/ (pah-lim´er-as) any of various enzymes catalyzing the template-directed incorporation of deoxyribonucleotides into a DNA chain, particularly one using a DNA template. , 250 [micro]mol/L each of dNTP, 50 mmol/L of Tris-HCl (pH 8.3), 40 mmol/L of KCl, 1.5 mmol/L of Mg[Cl.sub.2], and gel loading dye. The volume was then adjusted to 20 [micro]L with distilled water. Nested PCR reactions were incubated at 95[degrees]C for 5 min, subjected to 35 cycles of 95[degrees]C for 15 s, 56[degrees]C for 15 s, and 72[degrees]C for 30 s, and final extension at 72[degrees]C for 3 min. PCR amplification of the gltA gene of SFG and TG rickettsiae was performed by using the oligonucleotide pairs RpCS.877p and RpCS.1,258n for the primary PCR amplification and RpCS.896p and RpCS.1,233n for the secondary amplification. The primary PCR cycling condition consisted of incubation at 95[degrees]C for 5 min, then 35 cycles each of 15 s at 95[degrees]C, 15 s at 54[degrees]C, and 30 s at 72[degrees]C, followed by a final extension cycle of 3 min at 72[degrees]C. The nested PCR cycling condition consisted of incubation at 95[degrees]C for 5 min, then 35 cycles each of 15 s at 95[degrees]C, 15 s at 54[degrees]C, and 30 s at 72[degrees]C, followed by a final extension cycle of 3 min at 72[degrees]C. To avoid cross-contamination, 3 separate rooms with entirely separate equipment and solutions were used. Thus, the handling and treatment of samples and the addition of a template, the handling of DNA-free PCR reagents, and the post-PCR work were strictly separated. Aerosol-resistant tips (Axigen Scientific, Inc., Union City, CA, USA) were used for the handling of all reagents in the PCR study. The amplification products were visualized by electrophoresis on a 1.5% agarose agarose more highly purified form of agar with similar uses to agar and widely used in the separation of nucleic acid fragments. gel stained with ethidium bromide (0.5 [micro]g/mL) and using 1 x TAE TAE Trans-Asia-Europe TAE Tasa Anual Equivalente (Spanish: Equivalent Annual Interest Rate) TAE Thomas Alva Edison TAE Telekommunikations Anschluss Einheit (German: telecommunication connection unit) migration buffer (pH 8.0; 40 mmol/L Tris-acetate, 1 mmol/L EDTA EDTA: see chelating agents. ). Restriction Fragment Length Polymorphism restriction fragment length polymorphism n. Abbr. RFLP Intraspecies variations in the length of DNA fragments generated by the action of restriction enzymes and caused by mutations that alter the sites at which these enzymes act, changing (RFLP RFLP abbr. restriction fragment length polymorphism RFLP restriction fragment length polymorphism. RFLP ) Analysis The PCR products were purified by using an AccuPrep PCR purification kit (Bioneer Corp.), according to the manufacturer's instructions. Restriction endonuclease restriction endonuclease one of over 200 enzymes isolated from bacteria that cleave any DNA molecule at specific sites which are usually palindromes of 4 to 10 or so nucleotides to yield a collection of restriction DNA fragments that can be separated, usually by electrophoresis in digestions were performed with 10 [micro]L of amplified products by using AluI (New England Biolabs New England Biolabs (NEB) produces and supplies reagents for the life science industry. NEB offers a large selection of recombinant and native enzymes for genomic research. It also offers products in the areas related to proteomics and drug discovery. , Beverly, MA, USA). The digested DNA was resolved by electrophoresis through a 10% polyacrylamide gel pol·y·a·cryl·a·mide gel n. A hydrated polymer consisting of a long chain of amide groups, used as a medium for substances that undergo gel electrophoresis. at 100 V for 4 h in a 1 x TBE buffer (pH 8.0; 90 mmol/L Tris-borate, 2 mmol/L EDTA), and was visualized after staining with ethidium bromide. Cloning, Sequencing, and Analysis of Nucleotide All positive PCR products were cloned by using pGEM-T Easy Vector System I (Promega). Verifying whether the clones contained inserts was accomplished by digestion of plasmid DNA with EcoRI (New England Biolabs) and separation in 1.5% agarose gels. Plasmids containing DNA inserts were sequenced for both strands by using Big Dye Terminator Sequence Kit and ABI Abi (ā`bī) [short for Abijah], in the Bible, King Hezekiah's mother. (Application Binary Interface) A specification for a specific hardware platform combined with the operating system. Prism 377 Automated DNA Sequencer (Perkin-Elmer Applied Biosystems), according to the manufacturer's protocol. The obtained sequences, except for the primer regions, were aligned with the corresponding sequences of other rickettsiae deposited in the GenBank database to identify known sequences with a high degree of similarity using multisequence alignment programs, the Phydit software (10), and the MegAlign software package (Windows version 3.12e; DNASTAR, DYNASTAR Inc., Madison, WI, USA). Phylogenetic trees were generated by using the neighbor-joining algorithms and the Jukes Jukes: see Dugdale, Richard Louis. and Cantor matrix. Bootstrap See boot. (operating system, compiler) bootstrap - To load and initialise the operating system on a computer. Normally abbreviated to "boot". From the curious expression "to pull oneself up by one's bootstraps", one of the legendary feats of Baron von Munchhausen. analysis was performed to investigate the stability of the trees obtained through the neighbor-joining method. The percentages of similarity were determined using the FASTA FASTA Fraternidad de Agrupaciones Santo Tomás de Aquino (Spanish: Fraternity of St Thomas Aquinas Groups ) FASTA Federal Acquisition Streamlining Act FASTA Fresno Area Substitute Teachers Association network service (European Bioinformatics Institute The European Bioinformatics Institute (EBI) is a centre for research and services in bioinformatics, and is part of European Molecular Biology Laboratory (EMBL). It is a pioneer of novel and developmental bioinformatics research. Fasta Service; available from http://www.ebi.ac.uk/fasta). Nucleotide Sequence Accession Numbers Used GenBank accession numbers of the rompB gene sequences used for sequence comparisons are AB003681 for R. japonica, AF123705 for R. aeschlimannii, AF123706 for R. africae, AF123707 for R. akari, AF123708 for Astrakhan Astrakhan, city, Russia Astrakhan (ăs`trəkăn, Rus. ä`strəkhənyə), city (1990 pop. 521,000), capital of Astrakhan region, SE European Russia. rickettsia strain A-167, AF123709 for R. australis, AF123711 for R. honei strain RB, AF 123712 for Israeli tick typhus rickettsia, AF 123714 for R. massiliae, AF123715 R. mongolotimonae, AF123716 for R. montanensis, AF123717 for R. parkeri, AF123719 for R. rhipicephali, AF123721 for R. conorii strain Seven, AF123722 for R. sibirica, AF123723 for R. slovaca, AF123725 for R. helvetica, AF 182279 for R. felis, AF211820 for R. prowazekii strain Florida, AF211821 for R. prowazekii strain Virginia, AF123718 for R. prowazekii, AF161079 for R. prowazekii, AF479763 for R. amblyommii strain WB-8-2 rompB pseudogene pseu·do·gene n. A segment of DNA resembling a gene but lacking a genetic function. pseudogene a nonfunctional DNA sequence, nearly homologous to a functional gene. , AY260451 for R. heilongjiangensis, AY260452 for R. hulinensis, L04661 for R. typhi crystalline surface layer protein (slpT) gene, and X16353 for R. rickettsii. The Gen Bank accession number of the gltA gene sequence used for developing primers is M17149 for R. prowazekii. Results Multiplex Nested PCR Amplification of rompB Gene Nested PCR assay, with primer pairs rompB OF and rompB OR in primary reactions and rompB SFG IK rompB SFG/TG IR, and rompB TG IF in multiplex-nested reactions, was performed to identify the unknown rickettsial agents in the seropositive serum specimens and to differentiate between SFG and TG rickettsiae in terms of size. When the primers previously mentioned were used, the nested PCR assay generated [approximately equal to] 420 bp for SFG rickettsiae and about 230 bp for TG rickettsiae. The negative controls consistently failed to yield detectable PCR products, whereas the positive controls always gave the expected PCR products. Overall, 200 serum specimens from febrile patients from all areas of South Korea were tested. After the nested PCR was performed, the expected rompB gene products were obtained from 24 seropositive serum samples. Figure 1 shows the result of electrophoresis of 24 PCR-amplified samples. Of the 24 amplified products, 16 showed the electrophoretic pattern of 1 DNA band of [approximately equal to] 420 bp, which corresponded to SFG. The amplified size of only 1 sample was [approximately equal to] 230 bp for TG. The 7 other amplified products showed an electrophoretic pattern of 2 bands of [approximately equal to] 420 bp for SFG and 230 bp for TG. Therefore, the 23 amplified products corresponding to SFG rickettsial agents were named H1 product, while the 8 products corresponding to TG were named H2 product. The H1 products included H1 to H24 (except H19), while the H2 products were H3-2, H7-2, H8-2, H13-2, H14-2, H15-2, H18-2, and H19 (Figure 1). [FIGURE 1 OMITTED] RFLP Analysis and Sequencing Analysis RFLP analysis of the 23 H1 products corresponding to SFG rickettsial agents using AluI demonstrated that the restriction patterns of 17 H1 products were identical with that of R. conorii, 2 with that of R. akari, 1 with that of R. japonica, and 3 with that of R. felis (Figure 2). RFLP analysis of the 8 H2 products corresponding to TG rickettsial agents by using AluI showed that the restriction patterns of all the H2 products were identical with that of R. typhi (Figure 3). [FIGURES 2-3 OMITTED] Sequencing Analysis To identify the SFG and TG rickettsiae detected in human serum specimens, nucleotide sequences of the PCR-amplified products were determined and compared with partial rompB gene sequences of various rickettsial agents obtained from the GenBank database. Table 2 shows the similarity between the partial rompB gene sequences of various rickettsial agents and 6 of the sequenced H1 products (clones H1, H3, H5, H10, H20, and H22). Clones H1, H3, and H20 showed 100%, 99.72%, and 98.87% degrees of similarity to R. conorii, respectively. Clone H10 showed 100% similarity to R. japonica, and clone H5 showed 100% similarity to R. akari. In particular, clone H22 showed 99.44% similarity to R. felis. All the compared H1 products showed low levels of similarity (70.90%-74.01%) to the TG species. The clones that clustered partially with the rompB gene of R. conorii were differentiated in 3 groups by their levels of similarity: group 1 (12 H1 products with 100% similarity), group 2 (4 H1 products with 99.72% similarity), and group 3 (1 H1 product with 98.87% similarity). Clones H22, H23, and H24 clustered as the R. felis group. Table 3 shows the similarity between the partial rompB gene sequences of various rickettsial species and H2 product sequences. All H2 products showed low levels of similarity (67.05%-69.94%) to SFG rickettsial species, such as R. sibirica, R. akari, R. conorii, R. felis, and R. japonica. They also showed high levels of similarity (93.64%-100%) to TG rickettsial species, such as R. prowazekii and R. typhi. The H2 products' levels of similarity to R. typhi ranged from 99.42% to 100%. A neighbor-joining analysis based on partial rompB gene sequences demonstrated that 17 H1 products formed a cluster with R. conorii, 2 with R. akari, 1 with R. japonica, and 3 with R. felis (data not shown). The analysis of the 8 H2 product sequences showed that the sequences of all H2 products formed a cluster with R. typhi and were separated from the SFG rickettsial strains (data not shown). Nested PCR Amplification of gltA Gene The results of the multiplex nested PCR of the rompB gene were confirmed by a second PCR assay with specific primer pairs RpCS.877p and RPCS.1,258 in primary reactions and RpCS.896p and RpCS.1,233 in nested reactions. The primer sets generated [approximately equal to] 338 bp for SFG and TG rickettsiae. The expected size of the gltA gene fragment was generated in 22 of 24 samples that were positive for the PCR detection of the rompB gene (Figure 4). All positive PCR products were cloned, and their sequences were determined. Since the PCR assay using primer sets for the amplification of the gltA gene could not discriminate between the SFG rickettsia and TG rickettsia by size difference, the sequences of 3 clones for each PCR product were determined. The results of the sequencing analysis for gltA-PCR amplifications were identical to those of the analysis of the rompB-PCR product (data not shown). Seven samples that were positive for both the rompB genes of R. conorii and R. typhi were also positive for both of their gltA genes (data not shown). [FIGURE 4 OMITTED] Discussion SFG and TG rickettsial infections occur worldwide and may cause serious diseases in humans. These pathogenic bacteria Pathogenic bacteria Bacteria that produce illness. Mentioned in: Gastroenteritis are transmitted to people by arthropod arthropod Any member of the largest phylum, Arthropoda, in the animal kingdom. Arthropoda consists of more than one million known invertebrate species in four subphyla: Uniramia (five classes, including insects), Chelicerata (three classes, including arachnids and horseshoe vectors, such as ticks, fleas, and lice. In this study, multiplex-nested PCR was conducted to detect and identify SFG and TG rickettsial antigens in patient sera with positive results from the serosurvey. The rompB gene domain II region, which is a highly conserved region of rompB, was targeted for PCR amplification for the specific detection of SFG and TG rickettsiae. Amplified DNA sequences were analyzed by using nucleotide-sequencing methods, and RFLP analysis was used to confirm the PCR results. The results indicated the presence of several SFG rickettsiae, R. conorii, R. akari, R. japonica, and R. felis, in the serum specimens. The results were also confirmed by a second PCR with specific primer pairs for the gltA gene and by sequence analysis of its DNA amplicons. For the first time, SFG rickettsiae in human serum specimens in South Korea have been reported. R. akari is a member of the spotted fever group rickettsiae and is a causative agent of rickettsial pox pox (poks) any eruptive or pustular disease, especially one caused by a virus, e.g., chickenpox, cowpox, etc. pox n. 1. , a disease transmitted by the bite of Allodermanyssus sanguineus, a mite ectoparasite ec·to·par·a·site n. A parasite that lives on the surface or exterior of the host organism, such as an ectophyte or an ectozoon. ec of the domestic mouse (Mus muscularis) (2). The disease was first described in New York City New York City: see New York, city. New York City City (pop., 2000: 8,008,278), southeastern New York, at the mouth of the Hudson River. The largest city in the U.S. in 1946. R. akari was isolated from the Korean vole vole, name for a large number of mouselike rodents, related to the lemmings. Most range in length from 3 1-2 to 7 in. (9–18 cm) and have rounded bodies with gray or brown coats, blunt muzzles, small ears concealed in the long fur, and short tails. in 1957. The previous seroepidemiologic study conducted by the authors on 3,401 patients with febrile disease indicated that the seropositive rate was 16.24% for the rickettsial antigen through IFA. R. conorii is an etiologic agent of the Mediterranean spotted fever or boutonneuse fever (2). Our previous study indicated that the seropositive rate was 14.34% for the antigen. R. japonica, the causative agent of Oriental spotted fever, was first isolated from a patient with febrile, exanthematous exanthematous /ex·an·them·a·tous/ (eg?zan-them´ah-tus) characterized by or of the nature of an eruption or rash. exanthematous characterized by or of the nature of an eruption or rash. illness in Japan in 1985 (2). The disease is now endemic in the southwestern part of Japan, where >100 cases have been described (2). Previous studies showed the presence of nucleic acids of R. japonica and R. rickettsii in H. longicornis by PCR. Our seroepidemiologic study demonstrated that the seropositive rate was 19.9%. Although no clinical human case of SFG rickettsioses has been reported in Korea until now, this study's findings strongly suggest the prevalence of SFG rickettsiosis rickettsiosis /rick·ett·si·o·sis/ (ri-ket?se-o´sis) infection with rickettsiae. rick·ett·si·o·sis n. Infection with Rickettsia bacteria. in Korea. R. felis is an emerging pathogen emerging pathogen Public health Any pathogen that ↑ incidence of an epidemic outbreak Examples Cryptosporidium, E coli O157:H7, Hantavirus, multidrug resistant pneumococci, vancomycin-resistant enterococci. See Emergent disease. responsible for fleaborne spotted fever and had been considered a member of the TG rickettsiae based on its reactivity with anti--R. typhi antibodies. A genetic analysis of the 16S rRNA, citrate synthase, rompA, and rompB genes, however, placed R. felis as a member of SFG. R. felis has been reported in various countries, including the United States, Mexico, Brazil, Germany, and France (11,12). In Asia, the first case of R. felis infection was reported in 2003 (13). R. typhi was also among those detected in the SFG rickettsiae in the febrile disease patients' sera. Fleas are also found to be vectors for R. typhi (2). Of major importance to the epidemiology of the rickettsioses caused by R. typhi and R. felis is the maintenance of both rickettsial agents in their hosts by transovarial transmission, and the fact that neither organism is lethal for fleas (14). Finally, we report the presence of both R. conorii and R. typhi in serum from Korean patients. Sera from patients with SFG rickettsiosis have been reported to react with TG rickettsiae by using serologic se·rol·o·gy n. pl. se·rol·o·gies 1. The science that deals with the properties and reactions of serums, especially blood serum. 2. analysis methods (15). The serum specimens from patients with TG rickettsiosis were also demonstrated to contain cross-reactive antibodies against SFG rickettsiae (15,16). In a previous study, approximately one third of specimens seropositive for antibodies against SFG rickettsiae had antibodies against TG rickettsiae (unpub. data). Therefore, the multiplex-nested PCR was designed to detect and differentiate SFG rickettsial agents from TG rickettsial agents in the patient serum specimens with positive results from the serosurvey with SFG rickettsial antigens. SFG rickettsiae and TG rickettsiae were differentiated in terms of the size of amplified products. PCR results also confirmed the RFLP and sequencing analysis, in sera taken from 7 patients, both SFG and TG rickettsial antigens were detected, which indicated dual infection. Previously, a case of dual infection with Ehrlichia chaffeensis and an SPG rickettsia was reported in a human patient. Cases of dual infection with Bartonella clarridgeiae and B. henselae in cats have also been reported, as well as infection with the 2 different genotypes of B. henselae (17,18). A recent report suggested that coinfection of R. felis with either B. clarridgeiae or B. quintana in fleas may cause dual infection in a human that comes in contact with flea feces (14). These reports support this study's findings regarding the dual infection of SFG and TG rickettsiae in 7 patients. The differences between R. conorii and R. typhi vectors, however, still cannot be explained, and further studies are needed. In conclusion, this study confirmed, by using PCR-based amplification methods, that several SFG rickettsiae, R. conorii, R. akari, R. japonica, and R. felis, existed in the sera of Korean patients with febrile episodes. Our findings indicate that SFG rickettsiae, including R. felis, should be used in serologic tests on Korean patients suspected of having rickettsiosis. TG rickettsiae existed in 8 patients, and 7 of them were also infected with R. conorii. The evidence of double infection is expected to help describe the cross-reactivity between the patient sera of SFG rickettsioses and TG rickettsioses.
Table 1. Oligonucleotide primers for
amplification of partial rickettsial genes
Target
Primer rickettsia group Gene
rompB OF SFG and TG rompB ([dagger])
rompB OR SFG and TG rompB
rompB SFG IF SFG rompB
rompB SFG/TG IR SFG and TG rompB
rompB TG IF TG rompB
RpCS.877p ([section]) SFG and TG gltA ([double dagger])
RpCS.1,258n ([section]) SFG and TG gltA
RpCS.896p SFG and TG gltA
RpCS.1,233n SFG and TG gltA
Primer Position Nucleotide sequence (5'-3')
rompB OF 3,620-3,643 GTAACCGGAAGTAATCGTTTCGTAA
rompB OR 4,131-4,109 GCTTTATAACCAGCTAAACCACC
rompB SFG IF 3,652-3,674 GTTTAATACGTGCTGCTAACCAA
rompB SFG/TG IR 4,077-4,057 GGTTTGGCCCATATACCATAAG
rompB TG IF 3,828-3,850 AAGATCCTTCTGATGTTGCAACA
RpCS.877p ([section]) 877-895 GGGGGCCTGCTCACGGCGG
RpCS.1,258n ([section]) 1,258-1,237 ATTGCAAAAAGTACAGTGAACA
RpCS.896p 896-915 GGCTAATGAAGCAGTGATAA
RpCS.1,233n 1,233-1,215 GCGACGGTATACCCATAGC
* SFG, spotted fever group; TG, typhus group; OR,
outer reverse primer, OF, outer forward primer.
([dagger]) Oligonucleotide primer sequences derived
from Rickettsia conodi genes (accession no. AF123721).
([double dagger]) Oligonucleotide primer sequences derived
from R. prowazekii genes (accession no. M17149).
([section]) Primer sequences derived from (9).
Table 2. Similarity matrix between partial rompB gene sequence
of various rickettsial strains and nested polymerase chain
reaction (H1 products)
1 * 2 3 4
1 --
2 93.79 --
3 96.05 94.92 --
4 91.81 96.89 92.94 --
5 92.94 98.59 94.07 96.61
6 74.01 73.16 74.29 72.32
7 72.03 70.9 72.32 70.34
H1
([dagger]) 93.79
([double
dagger]) 100 94.92 96.89
H3 93.5 99.72 94.63 96.61
H5 100 93.79 96.05 91.81
H10 91.81 96.89 92.94 100
H20 92.66 98.87 93.79 96.33
H22 95.76 94.63 99.44 92.66
5 6 7 H1 ([dagger])
1
2
3
4
5 --
6 73.45 --
7 71.19 93.22 --
H1 ([dagger]) 98.59 73.16 70.9 --
H3 98.31 72.88 70.62 99.72
H5 92.94 74.01 72.03 93.79
H10 96.61 72.32 70.34 96.89
H20 97.46 72.6 70.34 98.87
H22 93.79 74.01 72.03 94.63
H3 H5 H10 H20 H22
1
2
3
4
5
6
7
H1 ([dagger])
H3 --
H5 93.5 --
H10 96.61 91.81 --
H20 98.59 92.66 96.33 --
H22 94.35 95.76 92.66 93.5 --
* 1, partial rompB of Rickettsia akari (AF123707), 2; R. conorii
(AF123721); 3, R. felis (AF182279); 4, R. japonica (AB003681);
5, R. sibirica (AF12322); 6, R. prowazekii (AF211820); 7, R.
typhi (L04661).
([dagger]) H, H1 products amplified from patient sera.
([double dagger]) The similarity values (%) on the lower left are
the levels of similarity between partial rompB gene sequences.
Table 3. Similarity matrix between partial rompB gene sequence
of various rickettsial strains and nested polymerase chain reaction
(H2 products) [Table is separated into 2 parts because of print
limitations; see 1-piece version available at http://www.cdc.gov/
ncidod/eid/vol11no02/04-0603.htm#table3]
1 * 2 3 4 5
1 * --
2 92.49 --
3 98.84 93.64 --
4 94.8 95.38 95.95 --
5 95.38 90.17 96.53 92.49 ([double dagger]) --
6 67.63 70.52 67.63 68.79 67.05
7 67.63 70.52 67.63 68.79 67.05
8 67.63 70.52 67.63 68.79 67.05
9 67.63 70.52 67.63 68.79 67.05
10 67.63 69.94 67.63 69.36 67.05
H8-2 ([dagger]) 67.63 69.94 67.63 69.36 67.05
H13-2 67.05 69.36 67.05 68.79 66.47
H14-2 67.63 69.94 67.63 69.36 67.05
H15-2 67.63 69.94 67.63 69.36 67.05
H18-2 68.21 70.52 68.21 69.94 67.63
H19 67.63 69.94 67.63 69.36 67.05
H3-2 67.63 69.94 67.63 69.36 67.05
H7-2 67.63 69.94 67.63 69.36 67.05
6 7 8 9 10 *
1 *
2
3
4
5
6 --
7 100 --
8 100 100 --
9 100 100 100 --
10 94.22 94.22 94.22 94.22 --
H8-2 ([dagger]) 94.22 94.22 94.22 94.22 100
H13-2 93.64 93.64 93.64 93.64 99.42
H14-2 94.22 94.22 94.22 94.22 100
H15-2 94.22 94.22 94.22 94.22 100
H18-2 93.64 93.64 93.64 93.64 99.42
H19 94.22 94.22 94.22 94.22 100
H3-2 94.22 94.22 94.22 94.22 100
H7-2 94.22 94.22 94.22 94.22 100
H8-2 ([dagger]) H13-2 H14-2 H15-2
1 *
2
3
4
5
6
7
8
9
10
H8-2 ([dagger]) --
H13-2 99.42 --
H14-2 100 99.42 --
H15-2 100 99.42 100 --
H18-2 99.42 98.84 99.42 99.42
H19 100 99.42 100 100
H3-2 100 99.42 100 100
H7-2 100 99.42 100 100
H18-2 H19 H3-2 H7-2
1 *
2
3
4
5
6
7
8
9
10
H8-2 ([dagger])
H13-2
H14-2
H15-2
H18-2 --
H19 99.42 --
H3-2 99.42 100 --
H7-2 99.42 100 100 --
* 1, partial rompB genes of Rickettsia sibirica (AF12322);
2, R. akari (AF123707), 3; R. conorii (AF123721); 4, R.
felis (AF182279); 5, R. japonica (AB003681); 6, R. prowazekii
(AF211820); 7, R. prowazekii (AF123718); 8, R. prowazekii
(AF161079); 9, R. prowazekii (AF211821); 10, R. typhi (L04661).
([dagger]) H, H2 products amplified from patient sera.
([double dagger]) The similarity values (%) on the lower left
are the levels of similarity between partial rompB gene sequences
and the values (bp) on the upper right are the number of different
bases out of compared total bases in partial rompB gene sequences.
This study was supported by a grant from the Korea Health 21 Research and Development Project, Ministry of Health and Welfare The Ministry of Health and Welfare is a branch of the government of South Korea. External links
• • , Republic of Korea (01-PJ10-PG6-01GM01-0004). This study was conducted in the Department of Microbiology, College of Medicine, Konkuk University. Dr. Choi is a postdoctoral fellow in the Department of Microbiology, College of Medicine, Konkuk University, Choong-cheongbuk-do, Korea. This work is part of her doctoral thesis. Her research focuses on the serologic and molecular epidemiology of various rickettsial diseases and the development of diagnostic tools. References (1.) Choi MS, Park SK, Chang WJ, Huh MS, Kim HR, Han TH, et al. A seroepidemiological survey on the scrub typhus in Korea, 1994. J Korean Soc Microbiol. 1994;30:593-602. (2.) Raoult D, Roux Roux , Pierre Paul Émile 1853-1933. French bacteriologist. His work with the diphtheria bacillus led to the development of antitoxins to neutralize pathogenic toxins. V. Rickettsioses as paradigms of new or emerging infectious diseases. Clin Microbiol Rev. 1997; 10:694-719. (3.) Kim YW, Cho MK, Min CH, Yoon CS. Isolation and characterization of Rickettsia typhi from patients in Korea. J Korean Soc Microbiol. 1988;23:265-75. (4.) Song JW, Baek LJ, Lee YJ, Song KJ, Han SH. Seroepidemiologic analysis of acute rebrile illness from Korea in 1996. J Korean Soc Virol. 1998;28:377-82. (5.) Gross L. How Charles Nicolle of the Pasteur Institute discovered that epidemic typhus is transmitted by lice: reminiscence from my years at the Pasteur Institute in Paris. Proc Natl Acad Sci U S A. 1996;93:10539-40. (6.) Chung HY. Suspected human infectious diseases in Korea; Rickettsial infections. Korean J Infect Dis. 1985;18:93-7. (7.) Lee JH, Park HS, Jung KD, Jang WJ, Koh SE. Kang SS, et al. Identification of spotted lever group rickettsiae detected from Haemaphysalis longicornis in Korea. Microbiol Immunol. 2003;47:301-4. (8.) Jang WJ, Kim JH, Choi YJ, Jung KD, Kim YG, Lee SH, et al. First serologic evidence of human spotted fever group rickettsiosis in Korea. J Clin Microbiol. 2004;42:2310-3. (9.) Roux V, Rydkina E, Eremeeva M, Raoult D. Citrate synthase gene comparison, a new tool for phylogenetic phy·lo·ge·net·ic adj. 1. Of or relating to phylogeny or phylogenetics. 2. Relating to or based on evolutionary development or history. analysis, and its application for the rickettsiae. Int J Syst Bacteriol. 1997:47:252-61. (10.) Chun J. Computer-assisted classification and identification of actinomycetes Actinomycetes A heterogeneous collection of bacteria that form branching filaments. The actinomycetes encompass two different groups of filamentous bacteria: the actinomycetes per se and the nocardia/streptomycete complex. . [Ph.D. thesis]. Newcastle Tyne, United Kingdom: University of Newcastle University of Newcastle can refer to:
(11.) Zavala-Velazquez JE, Ruiz-Sosa JA, Sanchez-Elias RA, Becerra-Carmona G, Walker DH. Rickettsia felis rickettsiosis in Yucatan. Lancet. 2000;356:1079-80. (12.) Richter J, Fournier PE, Petridou J, Haussinger D, Raoult D. Rickettsia felis infection acquired in Europe and documented by polymerase chain reaction. Emerg Infect Dis. 2002;8:207-8. (13.) Parola, P, Miller RS, McDaneiel P, Telford SR 3rd, Rolain JM, Wongsrichanalai C, et al. Emerging rickettsioses of the Thai-Myanmar border. Emerg Infect Dis. 2003;9:592-5. (14.) Rolain JM, Franc M, Davousr B, Raoult D. Molecular detection of pathogenic Bartonella and Rickettsia in cat fleas from France. Emerg Infect Dis. 2003;9:338-42. (15.) Hechemy KE, Raoult D, Fox J, Han Y, Elliotte LB, Rawlings J. Cross-reaction of immune sera from patients with rickettsial disease. J Med Microbiol. 1989;29:199-202. (16.) Uchiyama T, Zhao L, Yan Y, Uchida T. Cross-reacttivity of Rickettsia japonica and Rickettsia typhi demonstrated by immunofluorescence Immunofluorescence A technique that uses a fluorochrome to indicate the occurrence of a specific antigen-antibody reaction. The fluorochrome labels either an antigen or an antibody. and Western immunoblotting immunoblotting, n the immunologic methods for isolating and quantitatively measuring immunoreactive substances. When used with immune reagents such as monoclonal antibodies, the process is known generically as Western blot analysis. . Microbiol Immunol. 1995;39:951-7. (17.) Gurfield AN, Boulouis HJ, Chomel BB, Kasten RW, Heller R, Bouillin C, et al. Epidemiology of Bartonella infection in domestic cats in France. Vet Microbiol. 2001;80:185-98. (18.) Abbott RC, Chomel BB, Kasten RW, Floyd-Hawkins KA, Kikuchi Y, Koehler JE, et al. Experimental and natural infection with Bartonella henselae in domestic cats. Comp Immunol Microbiol Infect Dis. 1997:20:41-51. Address for correspondence: Ik-Sang Kim, Department of Microbiology and Immunology, Seoul National University Not to be confused with the University of Seoul. Seoul National University (SNU) is a national research university in Seoul, South Korea. Founded in 1946, SNU was the first national university in South Korea, and served as a model for the many national and public College of Medicine and institute of Endemic Disease, Seoul, 110-799, Republic of Korea; fax: 82-43-851-9329; email: molecule@plaza.snu.ac.kr (1) Y.-J. Choi and W.-J. Jang contributed equally to this work. Yeon-Joo Choi, * (1) Won-Jong Jang, (1) * Jong-Hyun Kim, * Ji-Sun Ryu Ryū (竜 or りゅう or リュウ Ryū , * Seung-Hyun Lee, * Kyung-Hee Park, * Hyung-Suk Paik, (([dagger]) Young-Sang Koh, ([double dagger]); Myung-Sik Choi, ([section]) and Ik-Sang Kim ([section]) * Konkuk University, Choongbuk, Republic of Korea; ([dagger]) Pusan National University History Pusan National University (PNU) was founded on May 1946 in Pusan, Korea's second largest metropolis, by Korean government,which has been established five months earlier than Seoul National University in Seoul. , Pusan, Republic of Korea; ([double dagger]) Cheju National University Cheju National University is the smallest one among 10 major national universities in Korea along with Seoul National University, Pusan National University Kyungpook National University, Chonnam National University, Chungnam National University, Chonbuk National University, College of Medicine, Jeju, Republic of Korea; and ([section]) Seoul National University College of Medicine and Institute of Endemic Disease, Seoul, Republic of Korea |
|
||||||||||||||||||||

Printer friendly
Cite/link
Email
Feedback
Reader Opinion