Printer Friendly
The Free Library
14,709,465 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Sequence analysis of the ribosomal DNA internal transcribed spacers and 5.8S ribosomal RNA gene in representatives of the clam family veneridae (Mollusca: Bivalvia).


ABSTRACT The first and second internal transcribed spacer ITS (for internal transcribed spacer) refers to a piece of non-functional RNA situated between structural ribosomal RNAs (rRNA) on a common precursor transcript. Read from 5' to 3', this polycistronic rRNA precursor transcript contains the 5' external transcribed sequence (5' ETS),  (ITS1 and ITS2) regions of the ribosomal DNA Not to be confused with Reformed Druids of North America.
Ribosomal DNA (rDNA) are sequences encoding ribosomal RNA. These sequences regulate amplification and transcription initiation and contain transcribed and nontranscribed spacer segments.
 from six species, Meretrix meretrix, Cyclina sinensis, Mercenaria mercenaria, Protothaca jedoensis, Dosinia corrugata and Ruditapes philippinarum, in the family Veneridae were PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
 amplified and sequenced. The size of the ITS1 sequence ranged from 522-900 bp, which was the largest range so far reported for a bivalve bivalve, aquatic mollusk of the class Pelecypoda ("hatchet-foot") or Bivalvia, with a laterally compressed body and a shell consisting of two valves, or movable pieces, hinged by an elastic ligament.  species, with GC contents from 57.66% to 65.62%. The size of the ITS2 sequence ranged from 281-412 bp, with GC contents from 65.21% to 67.87%. Extensive sequence variation and obvious length polymorphisms were noted for both regions in these species, and ITS2 sequence similarity was higher than that of ITS1 across species. The complete sequences of 5.8S ribosomal RNA ribosomal RNA
n.
See rRNA.


ribosomal RNA (rī´bōsō´m
 gene were obtained by assembling ITS1 and ITS2 sequences, and the sequence length in all species was 157 bp. The phylogenetic tree phylogenetic tree

Diagram showing the evolutionary interrelations of a group of organisms that usually originated from a shared ancestral form. The ancestor is in the tree trunk; organisms that have arisen from it are placed at the ends of tree branches.
 of Veneridae clams was reconstructed by using ITS2 containing partial sequences of both 5.8S and 28S rDNA, and corresponding sequence information in Arctica islandica (Dahlgren et al. 2000) as an outgroup species. Tree topologies indicated that P. jedoensis has a closer relationship with M. mercenaria than with other species.

KEY WORDS: Veneridae, rDNA, internal transcribed spacer, 5.8S rRNA gene, phylogenetic phy·lo·ge·net·ic
adj.
1. Of or relating to phylogeny or phylogenetics.

2. Relating to or based on evolutionary development or history.
 analysis, species identification

INTRODUCTION

The internal transcribed spacers (ITSs) of nuclear ribosomal DNA (rDNA) is one of the most extensively sequenced molecular markers, and the region is a component of a rDNA cistron cistron /cis·tron/ (sis´tron) the smallest unit of genetic material that must be intact to transmit genetic information; traditionally synonymous with gene.

cis·tron
n.
, which consists of 18S, ITS1, 5.8S, ITS2 and 28S. ITSs exist in several hundred copies in most eukaryotes. They are located in one or several loci loci

[L.] plural of locus.

loci Plural of locus, see there
 and distributed in one or several chromosomes. The nuclear rDNA copies within a genome can be highly homogeneous because of concerted evolution of intra and interchromosomal loci. ITS1 and ITS2 are noncoding regions located in rDNA between 18S and 5.8S rRNA genes, and between 5.8S and 28S rRNA genes, respectively (Insua et al. 2003, Jansen et al. 2006, Won & Renner 2005).

Because ITSs sequences show more divergence than their flanking coding regions and are easily amplified, they are routinely used to distinguish related species and to infer phylogenetic relationships from populations to families and even higher taxonomic levels (Coleman & Vacquier 2002). In bivalve mollusks, a variety of methods, such as PCR amplification alone, PCR amplification followed by restriction analysis or sequencing was used to differentiate related species (Ding et al. 2004, Fernandez et al. 2001, Insua et al. 2003, Kenchington et al. 2002, Lopez-pinon et al. 2002, Yu et al. 2000) and exploring the phylogenetic relationship (He et al. 2005, King et al. 1999, Vidigal et al. 2000, Vidigal et al. 2004, Yu et al. 2001) among bivalve species.

The family Veneridae is a group of bivalve mollusks prevalent in seawater seawater

Water that makes up the oceans and seas. Seawater is a complex mixture of 96.5% water, 2.5% salts, and small amounts of other substances. Much of the world's magnesium is recovered from seawater, as are large quantities of bromine.
 all over the world. There are more than 500 species, many of which are commercially valuable and ecologically crucial because of their dominance in benthic ben·thos  
n.
1. The collection of organisms living on or in sea or lake bottoms.

2. The bottom of a sea or lake.



[Greek.
 communities. A study of the phylogenesis phy·lo·gen·e·sis
n.
See phylogeny.
 of Veneridae was carried out using partial sequence of the mitochondrial mitochondrial

pertaining to mitochondria.


mitochondrial RNAs
a unique set of tRNAs, mRNAs, rRNAs, transcribed from mitochondrial DNA by a mitochondrial-specific RNA polymerase, that account for about 4% of the total cell RNA that
 16S rRNA gene (Canapa et al. 2003).

The purpose of this study is to amplify and sequence the ITS1 and ITS2 regions of 6 Veneridae species, Meretrix meretrix, Cyclina sinensis, Mercenaria mercenaria, Protothaca jedoensis, Dosinia corrugata and Ruditapes philippinarum, to provide the basic characteristics of these sequences and to assess the similarity among species. The results from this study will provide useful information in species identification and phylogenetic analysis of Veneridae clams.

MATERIALS AND METHODS

Sample Collection and DNA Extraction DNA extraction is a routine procedure to collect DNA for subsequent molecular or forensic analysis. Outline of a DNA extraction
There are three basic steps in a DNA extraction, the details of which may vary depending on the type of sample and any substances that may
 

Specimens of Meretrix meretrix and Cyclina sinensis were collected from Dalian, Liaoning province, China, and Mercenaria mercenaria, Protothaca jedoensis, Dosinia corrugata and Ruclitapes philippinarum belonging to five subfamilies of Veneridae, from Lianyungang, Jiangsu province. Total genomic DNA genomic DNA
n.
The full complement of DNA contained in the genome of a cell or organism.
 was extracted from approximately 50 mg of adductor muscle Noun 1. adductor muscle - a muscle that draws a body part toward the median line
adductor

skeletal muscle, striated muscle - a muscle that is connected at either or both ends to a bone and so move parts of the skeleton; a muscle that is characterized by
 following a modified CTAB CTAB Clear to auscultation bilaterally, see there  protocol (Winnepenninckx et al. 1993). Briefly, the tissue was incubated for 15 min at 55[degrees]C in 600 [micro]l CTAB buffer containing 25 [micro]l 10 mg/mL proteinase proteinase /pro·tein·ase/ (pro´ten-as?) endopeptidase.

pro·tein·ase
n.
A protease that begins the hydrolytic breakdown of proteins usually by splitting them into polypeptide chains.
 K, homogenized ho·mog·e·nize  
v. ho·mog·e·nized, ho·mog·e·niz·ing, ho·mog·e·niz·es

v.tr.
1. To make homogeneous.

2.
a. To reduce to particles and disperse throughout a fluid.

b.
 with a pestle pestle /pes·tle/ (pes´'l) an implement for pounding drugs in a mortar.

pes·tle
n.
A club-shaped, hand-held tool for grinding or mashing substances in a mortar.
, and incubated for an additional 60 min. After extractions with saturated phenol phenol (fē`nōl), C6H5OH, a colorless, crystalline solid that melts at about 41°C;, boils at 182°C;, and is soluble in ethanol and ether and somewhat soluble in water.  and then chloroform chloroform (klôr`əfôrm) or trichloromethane (trī'klôrōmĕth`ān), CHCl3 : isoamyl alcohol (24:1), genomic DNA was ethanol-precipitated, resuspended in 50-[micro]l TE (10 mM Tris-HCl, pH 8.0, 1 mM EDTA EDTA: see chelating agents. ) and stored at -20[degrees]C for future use.

PCR Amplification and Sequencing

ITS1 region was amplified using ITS1-F (5'- GGTGAACCTGCGGATGGA-3') and ITS1-R (5'- GCTGGCTGCGCTCTTCAT-3') as primers, which anneal To take the brittleness out of metal, plastic or certain carbon composites. Performed in the preparation of new products or in their restoration, annealing is accomplished via a heat treating process.  to the 3' end of 18S ribosomal RNA gene and the 5.8S ribosomal RNA gene, respectively. ITS2 region was amplified using ITS2-F (5'- ATGAAGAGCGCAGCCAGC-3') and ITS2-R (5'- GGCTCTTCCCGCTTCACTC-3') as primers, which anneal to the 5.8S ribosomal RNA gene and the 5' end of 28S ribosomal RNA gene, respectively. Approximate locations of primers are shown in Figure 1. Two pairs of primer were designed based on sequence information obtained from GenBank (AY498751, AF202106, AF131019, AY 198756, AF 120559) using PrimerSelect software (DNAStar package version 5.01). PCRs were set up in a 50-[micro]L volume reaction mixture composed of 2 [micro]L genomic DNA (50 ng/[micro]L), 5.0 [micro]L 10x buffer (20 mM [Mg.sup.2+]), 1.0 [micro]L dNTP (10 mM each), 1.0 [micro]L each primer (25 [micro]M), 0.4 [micro]L AmpliTag DNA polymerase DNA polymerase /DNA po·lym·er·ase/ (pah-lim´er-as) any of various enzymes catalyzing the template-directed incorporation of deoxyribonucleotides into a DNA chain, particularly one using a DNA template.  (5U/[micro]L BBI BBI Blockbuster Inc. (stock symbol)
BBI Berlin Brandenburg International (Airport)
BBI Broadband-Interactive
BBI Browser-Based Interface
BBI Best Brains Inc.
) and dd[H.sub.2]O to 50 [micro]L. Amplifications were carried out in a BIO-RAD thermal cycler The Thermal cycler (also known as a thermocycler, PCR machine or DNA amplifier) is a laboratory apparatus used for PCR. The device has a thermal block with holes where tubes with the PCR reaction mixtures can be inserted.  (iCycler), using the reaction settings as follows: initial denaturation denaturation, term used to describe the loss of native, higher-order structure of protein molecules in solution. Most globular proteins exhibit complicated three-dimensional folding described as secondary, tertiary, and quarternary structures.  at 94[degrees]C for 4 min, followed by 35 cycles of denaturing for 40 s at 94[degrees]C, annealing annealing (ənēl`ĭng), process in which glass, metals, and other materials are treated to render them less brittle and more workable.  for 30 s at 55[degrees]C, extension for 60 s at 72[degrees]C and a final extension for 7 min at 72[degrees]C. All amplified fragments were selected by 2% w/v agarose agarose

more highly purified form of agar with similar uses to agar and widely used in the separation of nucleic acid fragments.
 gels electrophoresis. The ITS1 and ITS2 regions were PCR amplified from at least 10 individuals from each of six species, but only two PCR products were selected and delivered to Shanghai Sangon Biological Engineering & Technology and Service Co. Ltd. (Shanghai, China) for sequence. The sequence was conducted in both forward and reverse directions using the amplification primers by ABI Abi (ā`bī) [short for Abijah], in the Bible, King Hezekiah's mother.


(Application Binary Interface) A specification for a specific hardware platform combined with the operating system.
 prism 377 automatic DNA sequencer A DNA sequencer is an instrument used to automate the DNA sequencing process.

DNA sequencers have become more important due to large genomics projects and the need to increase productivity.
.

[FIGURE 1 OMITTED]

Sequence Analysis

The forward and reverse sequences were assembled using SeqManII software in DNAStar Package version 5.01 to obtain ITS1 and ITS2 sequences, and each of the different sequences was registered as an ITS1 or ITS2 haplotype haplotype /hap·lo·type/ (-tip) the group of alleles of linked genes, e.g., the HLA complex, contributed by either parent; the haploid genetic constitution contributed by either parent.

hap·lo·type
n.
 in GenBank. Each newly determined sequence was checked against exiting haplotypes using DNAstar and then the sequence was registered as a new haplotype. Because ITS1-R and ITS2-F primers anneal to the same region in 5.8S rDNA (Fig. 1), ITS1 and ITS2 can be assembled into an ITS, and the complete sequence of 5.8S ribosomal RNA gene can be obtained. The boundaries of the coding and spacer regions were determined by comparison with the sequence information of Arctica islandica (GenBank accession No. AF 202106). The sequences were edited and analyzed using the program EditSeq. ITS sequences containing the 5.8S ribosomal RNA gene across six species were aligned using program MegAlign of DNAStar package using the Clustal W method. The trees were produced by Neighbor-Joining (NJ) and Maximum parsimony Maximum parsimony, often simply referred to as "parsimony," is a non-parametric statistical method commonly used in computational phylogenetics for estimating phylogenies. Under maximum parsimony, the preferred phylogenetic tree is the tree that requires the least number of  (MP) methods using MEGA software Version 3.1 (Kumar et al. 2004).

RESULTS

The ITS1 and ITS2 regions were PCR amplified and sequenced among six species, the ITS1 and ITS2 were assembled into a single ITS sequence. For M. meretrix, M. mercenaria, D. corrugata and R. philippinarum, the identical ITS sequences were detected between 2 individuals within a species and named haplotypes WD1, YLI YLI Youth Leadership Initiative
YLI Youth Leadership Institute (San Francisco, CA)
YLI You Love It
, BL1, FL1, respectively. For other species, C. sinensis and P. jedoensis, the ITS sequence were different between 2 individuals within a species and were named haplotypes QD1, QD2 for C. sinensis, and JL1, JL2 for P. jedoensis. Figure 2 showed the alignment of the ITS sequences including 5.8S rDNA, spanning 18S and 28S rDNA among eight haplotypes from six Veneridae species, and Table 1 displayed the length and GC contents of ITS1, 5.8S ribosomal DNA, and ITS2, and GenBank accession number.

[FIGURE 2 OMITTED]

Sequence Analysis of the First Internal Transcribed Spacer

The length of ITS1 sequence ranged from 522 bp to 900 bp, and GC contents from 57.66% to 65.62% in six species (Table 1). As seen in Table 1 interspecific in·ter·spe·cif·ic  
adj.
Arising or occurring between species.



interspecific also interspecies  

Arising or occurring between species.

Adj. 1.
 ITS1 sequences showed remarkable divergence and obvious length polymorphism polymorphism, of minerals, property of crystallizing in two or more distinct forms. Calcium carbonate is dimorphous (two forms), crystallizing as calcite or aragonite. Titanium dioxide is trimorphous; its three forms are brookite, anatase (or octahedrite), and rutile. . The GC contents in ITS1 were higher than AT contents in all species. M. meretrix had the longest ITS1 sequence (900 bp) with 61.67% GC contents, and two trinucleotide tri·nu·cle·o·tide
n.
A triplet of nucleotides; a codon.
 microsatellites [(AGT AGT antiglobulin test. ).sub.n] were observed (Fig. 2). As well, a repeat sequence [(AGT).sub.n] GAAAAA(G)GCGAAGGAGCCGCTGGCCCTTC was found occurring twice in ITS1 region in this species. D. corrugata had the shortest ITS1 sequence (522 bp) with 57.66% GC contents. P. jedoensis, M. mercenaria, R. philippinarum and C. sinensis had intermediate ITS1 size, 864 bp, 679 bp, 632 bp and 585 bp, respectively. A dinucleotide dinucleotide /di·nu·cleo·tide/ (di-nldbomack´le-o-tid?) one of the cleavage products into which a polynucleotide may be split, itself composed of two mononucleotides.

di·nu·cle·o·tide
n.
 microsatellite See miniaturized satellite.  [(TA).sub.n] was observed in the ITS1 region of C. sinensis (Fig. 2).

ITS1 sequences of six species were aligned. The percentages of sequence divergence and identity were showed in Table 2. Interspecific ITS1 sequence divergences were very high, because of the presence of transition, transversion trans·ver·sion
n.
Eruption of a tooth in a position normally occupied by another.


transversion,
n eruption of a tooth in the wrong position
 and indels (insertions/ deletions). The percentages of interspecific sequence divergence were from 27.2% (M. mercenaria and P. jedoensis) to 102.6% (M. meretrix and R. philippinarum). P. jedoensis exhibited 0.1% intraspecific in·tra·spe·cif·ic   also in·tra·spe·cies
adj.
Arising or occurring within a species: intraspecific competition.
 sequence divergence between two individuals. For other species, M. meretrix, C. sinensis, M. mercenaria, D. corrugata and R. philippinarum, the ITS1 sequence was identical between two individuals within a species.

We found one relatively conserved motif in the ITS1 region across the six species of Veneridae (Fig. 2), with a size of 54 bp showed 18 polymorphic polymorphic - polymorphism  sites, 12 of which were transition and six were transversion.

Sequence Analysis of the Second Internal Transcribed Spacer

The length of ITS2 sequences ranged from 281 bp to 412 bp and GC contents from 65.21% to 67.87% (Table 1). The interindividual variation for ITS2 was detected in both P. jedoensis and C. sinensis. In contrast, M. meretrix, M. mercenaria, D. corrugata and R. philippinarum had the same ITS2 sequences in two individuals. The GC contents of ITS2 sequences were higher than AT contents in all species. M. meretrix had the longest ITS2 sequence (412 bp) with 65.29% GC content, P. jedoensis had the shortest ITS2 sequence (281 bp to 282 bp) with 67.38% to 67.62% GC contents; C. sinensis, M. mercenaria, D. corrugata and R. philippinarum had intermediate ITS2 sequence (Table 1). A quadrunucleotide microsatellite [(AGCG AGCG Australian GNSS Coordinating Group ).sub.n] in M. meretrix and three dinucleotied microsatellites [(AG).sub.n] in M. meretrix, R. philippinarum and D. corrugata were observed (Fig. 2)

ITS2 regions from 8 haplotypes in six species were aligned. Percentages of sequence divergence and identity were listed in Table 3. ITS2 showed remarkable interspecific sequence divergences and obvious length polymorphism but to less compared with ITS1. Percentages of interspecific sequence divergence were from 21.6% (P. jedoensis and M. mercenaria) to 80.7% (M. meretrix and C. sinensis). Intraspecific sequence divergences in ITS2 region between two individuals were detected in C. sinensis (0.5%) and P. jedoensis (1.1%). For other species, M. meretrix, M. mercenaria, D. corrugata and R. philippinarum, the ITS2 sequence was identical between two individuals within a species.

We also detected two relatively conserved motifs in ITS2 region across six species (Fig. 2). The first relatively conserved motif with a size of 31 bp displayed five transition or transversion polymorphic sites, and the second with a size of 24 bp showed three transition or transversion polymorphic sites.

Sequence Analysis of the 5.8S Ribosomal RNA Gene

Through assembling ITS1 and ITS2 sequences, we obtained complete sequences of the 5.8S ribosomal RNA gene of six Veneridae species. The length of the 5.8S ribosomal RNA gene was 157 bp in all species (Fig. 2), and the GC contents ranged from 57.96% to 58.60% depending on species. The sequence divergences ranged from 0.0% to 6.0% across six species (Table 4). The 5.8S rRNA genes contained 10 polymorphic sites in these species, four of which were transition and six were transversion. Moreover, P. jedoensis, M. mercenaria, D. corrugata and R. philippinarum showed identical 5.8S rDNA sequence.

Phylogenetic Analysis in Terms of ITS2 Containing Partial 5.8S and 28S Ribosomal RNA Gene Sequences

Using ITS2 spanning 5.8S and 28S rDNA sequences as a molecular marker, the phylogenetic tree of Veneridae clam was constructed using Arctica islandica (GenBank accession number AF202106) as an outgroup species with Neighbor-Joining (NJ) and Maximum parsimony (MP) methods (Fig. 3).

[FIGURE 3 OMITTED]

The topology of the tree by MP method was similar to that by NJ method. Tree topologies showed that six Veneridae species were in the same group and forming a clade clade Cladus, subtype Genetics A branch of biological taxa or species that share features inherited from a common ancestor; a single phylogenetic group or line. See Inheritance, Species. . In Veneridae, P. jedoensis was first grouped with M. mercenaria with a high bootstrap See boot.

(operating system, compiler) bootstrap - To load and initialise the operating system on a computer. Normally abbreviated to "boot". From the curious expression "to pull oneself up by one's bootstraps", one of the legendary feats of Baron von Munchhausen.
 value of 94% in MP tree and 99% in NJ tree and then formed a clade with D.corrugata with a lower bootstrap value of 66% in MP tree and 80% in NJ tree; in contrast, M. meretrix, C. sinensis and R. philippinarum formed a monophyletic monophyletic /mono·phy·let·ic/ (mon?o-fi-let´ik) descended from a common ancestor or stem cell.

mon·o·phy·let·ic
adj.
1. Descended or derived from one original stock or source.
 group. This indicated that P. jedoensis and M. mercenaria has a closer relationship than other species.

In contrast to ITS2, the construction of phylogeny using ITS1 was not applicable because of some disadvantages, such as ITS1 length variation, the presence of tandem repeated sequences, and large number of indels. ITS1 sequences analysis, using MP and NJ methods, gave poor resolution in genus level. Therefore ITS1 was not used for phylogenetic analysis.

DISCUSSION

The current study provided information about the nucleotide sequences of ITS1 and ITS2 regions, complete sequence of the 5.8S ribosomal RNA gene in six Veneridae clams (M. meretrix, C. sinensis, M. mercenaria, P. jedoensis, D. corrugata and R. philippinarum). Their characteristics and variation were demonstrated through PCR amplification and sequencing. The length of ITS1 in the family Veneridae were longer than that in four Pectinidae scallop scallop or pecten, marine bivalve mollusk. Like its close relative the oyster, the scallop has no siphons, the mantle being completely open, but it differs from other mollusks in that both mantle edges have a row of steely blue "eyes" and  with size 209 bp to 276 bp for ITS1 and 270 bp to 294 bp for ITS2 (Insua et al. 2003), respectively. It should be noted that the length range in ITS1 reported in the current study was among the largest observed in bivalves. The size of ITS is species-dependent and the difference could be significant among species. The largest ITS1, such as that in Ladybird beetle Exocomus quadripustulatus, was as long as 2572 bp (Von der Schulenburg et al. 2001), and the shortest one only 70 bp to 80 bp in Acropora species (Odorico & Miller 1997). Depending on species, the length of ITS2 can be twice or more that of ITS1 (Dahlgren et al. 2000, Fernandez et al. 2001, Yu et al. 2000), both situation, the length of ITS1 similar to ITS2 or larger than ITS2 were also reported (Chen et al. 2002, Coleman & Vacquier 2002). The GC contents ranged from 57.66% to 65.62% for ITS1 and from 65.21% to 67.87% for ITS2 in Veneridae tested in the current study. These species had higher GC contents than other bivalve species. For instance, the GC contents in Pectinidae scallop were 43% to 49% for ITS1 or 44% to 49% for ITS2 (Insua et al. 2003) and 51.9% to 55.5% for ITS2 in Pearl Oyster (He et al. 2005). A frequent characteristic of spacers is a balanced GC content between ITS1 and ITS2, and this also occurs in the Veneridae spacers, this fact could indicate the coevolution co·ev·o·lu·tion  
n.
The evolution of two or more interdependent species, each adapting to changes in the other. It occurs, for example, between predators and prey and between insects and the flowers that they pollinate.
 between the two spacers at the level of base composition.

Both ITS1 and ITS2 regions in family Veneridae exhibit extensive sequence variation and obvious length polymorphisms, as is similar to Crustacea Eriocheir formoca (Chu et al. 2001) and other bivalves (Ding et al. 2004). In this study, the construction of topology in Veneridae clam using ITS1 sequence information is not applicable because of the high length variation, the presence of tandem repeated sequences and large number of indels in ITS1. However, it may be useful in phylogentic analysis at lower taxonomic levels, such as subspecies subspecies, also called race, a genetically distinct geographical subunit of a species. See also classification. , breeds or population levels. In contrast, the interspecific ITS2 sequence similarity in these species were higher than that of ITS1, and considering the length of ITS2 were shorter than that of ITS1, providing advantage and convenience in designing primers and sequencing, ITS2 is an ideal candidate for the study of genetic structure in Veneridae. The further study on the efficiency for combing the method in the current study with other techniques, such as PCR-RFLP PCR-RFLP Polymerase Chain Reaction–Restriction Fragment Length Polymorphism , is promising.

In this study, a relatively conserved motif in ITS1 region and two relatively conserved motifs in ITS2 region were found in these species. This indicated that these motifs might be involved in certain nucleotide acid-related functions, such as in rRNA processing (Insua et al. 2003). Beside, two trinucleotide microsatelillites [(AGT).sub.n] in M. meretrix and a dinucleotide microsatelillite [(TA).sub.n] in C. sinensis were found locating in ITS1 region, and a quadrunucleotide microsatellite [(AGCG).sub.n] and three dinucleotied microsatellites [(AG).sub.n] was found locating ITS2 region. These microsatellites may be served as good markers in future studies. In the bivalve species, a dincleotide microsatellite [(GT).sub.n] and a trinucleotide microsatellite [(TAC 1. TAC - Translator Assembler-Compiler. For Philco 2000.
2. TAC - Terminal Access Controller.
).sub.n] were found in ITS sequence of Lasmigona (King et al., 1999), but so far there has been no report from Veneridae.

Although interindividual sequence divergences in ITS1 and ITS2 regions were detected in C. sinensis (0.3% for ITS2) and P. jedoensis (0.1% for ITS1 and 0.6% for ITS2). Because of the presence of polymerase and sequencing error, the sequences cannot be thought as different only if when sequence divergence more than 0.9% (Kong et al. 2002), C. sinensis and P. jedoensis showed no intraspecific variations in ITS1 and ITS2. The 5.8S ribosomal RNA genes were highly conserved across these species studied in the current study, and had a length of 157 bp, which was reported in other bivalves, such as Pectinidae scallop species (A. opercularis, M. varia var·i·a  
n.
A miscellany, especially of literary works.



[Latin, from neuter pl. of varius, various.]
, H. distortus, P. maximus) (Insua et al. 2003) and Arctica islandica (Dahlgren et al. 2000).

The spacer regions, ITS1 and ITS2, of the rDNA are widely and routinely used in analysis of species relationships by using a phylogenetic reconstruction method in various organisms. It was successfully applied in analysis of phylogenetic relationship among the Biomphalaria species and among Pearl Oysters, and the conclusions from phylogenetic tree were well in agreement with those from analysis based on morphological systematics systematics: see classification.  and other molecular techniques, such as polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is  and restriction fragment length polymorphism restriction fragment length polymorphism
n. Abbr. RFLP
Intraspecies variations in the length of DNA fragments generated by the action of restriction enzymes and caused by mutations that alter the sites at which these enzymes act, changing
 analysis (He et al. 2005, Vidigal et al. 2000, Vidigal et al. 2004). Our study demonstrated that ITS1 provided weak phylogenetic signal in discrimination of Veneridae, whereas, ITS2 regions were effective in identifying phylogenetic relationships among Veneridae species. In this study, the tree obtained by ITS2 sequence analysis revealed that P. jedoensis and M. mercenaria, belonging to subfamilies Chioninae, has a close relationship than other species, belonging to subfamilies Meretricinae, Tapetinae and Cyclininae. Phylogenetic analysis of ITS2 sequences through both methods generated trees with similar topologies that were very concurrent with the morphological taxonomy proposed by Keen. Therefore ITS2 sequence characteristics are an efficient tool in reconstruction of evolutionary relationship among these organisms, and they can be applied in establishment of species relationship, or reevaluation of the traditional taxonomy.

ACKNOWLEDGMENTS

The authors thank Dr. Liu FJ in The Institute of Environmental and Human Health, Texas Tech University, USA, for advice on this paper, and Mr. Wang HZ in Zhewang Agricultural Technology Service Center of Ganyu County, Lianyungang, Jiangsu province, China, for providing the M. mercenaria samples. This Work was jointly supported by National Key Technologies R & D Program in the 10th five-year plan of China (2004BA526B0403), Jiangsu Key Laboratory of Marine Biotechnology (2006HS001), Natural Science Foundation Program (Z2004024) and Start-up Package Program for attracting talented people (KK03035) from HuaiHai Institute of Technology (HHIT).

LITERATURE CITED

Canapa, A., S. Schiaparelli, I. Marota & M. Barucca. 2003. Molecular data from the 16S rRNA gene for the phylogeny of Veneridae (Mollusca: Bivalvia). Mar. Biol. 142(6):1125-1130.

Chen, C. A., C. P. Chen, T. Y. Fan, J. K. Yu & H. L. Hsieh. 2002. Nucleotide sequence of ribosomal internal transcribed spacers and their utility in distinguishing closely related Perenereis polychaets (Annelida; Polychaeta; Nereididae). Mar. Biotechnol. 4:17-29.

Chu, K. H., C. P. Li & H. Y. Ho. 2001. The first internal transcribed spacer (ITS1) of ribosomal DNA as a molecular marker for phylogenetic and population analyses in Crustacea. Mar. Biotechnol. 3:355-361.

Coleman, A. W. & V. D. Vacquier. 2002. Exploring the phylogenetic utility of ITS sequences for animals: a test case for abalone abalone (ăbəlō`nē), popular name in the United States for a univalve gastropod mollusk of the genus Haliotis, members of which are also called ear shells, or sea ears, as their shape resembles the human ear.  (Haliotis). J. Mol. Evol. 54:246-257.

Dahlgren, T. G., J. R. Weinberg & K. M. Halanych. 2000. Phylogeography of the ocean quahog quahog: see clam.
quahog

Thick-shelled edible clam of the U.S. The northern quahog (Mercenaria mercenaria), also known as the cherrystone, littleneck, or hard-shell clam, is 3–5 in. (8–13 cm) long.
 (Arctica islandica): influences of paleoclimate on genetic diversity and species range. Mar. Biol. 137:487-495.

Ding, X. L., M. X. He, F. J. Deng & X. Y. Zhang. 2004. 18S-ITS1 sequence of rRNA in bivalves and its application in phylogenetic analysis. Hereditas (Beijing) 26(3):319-324.

Fernandez, A., T. Garcia, L. Asensio, M. A. Rodriguez, I. Gonzalez, P. E. Hernandez & R. Martin. 2001. PCR-RFLP analysis of the internal transcribed spacer (ITS) region for identification of 3 clam species. J. Food Sci. 66:657-661.

He, M. X., L. M. Huang, J. H. Shi & Y. P. Jiang. 2005. Variability of ribosomal DNA ITS-2 and its utility in detecting genetic relatedness of Pearl Oyster. Mar. Biotechnol. 7(1):40-45.

Insua, A., M. J. Lopez-pinon & R. Freire. 2003. Sequence analysis of the ribosomal DNA internal transcribed spacer region in some scallop species (Mollusca: Bivalvia: Pectinidae). Genome 46:595-604.

Jansen, G., S. Devaere, P. H. H. Weekers & D. Adriaens. 2006. Phylogenetic relationships and divergence time estimate of African angulliform Catfish (Siluriformes: Clariidae) inferred from ribosomal gene and spacer sequences. Mol. Phylogenet. Evol. 38:65-78.

Kenchington, E., C. J. Bird, J. Osborne & M. Reith. 2002. Novel repeat elements in the nuclear ribosomal RNA operon of the flat oysters flat oysters

Ostrea spp.
 Ostrea edulis C. Linnaeus, 1785 and O. angasi Sowerby, 1871. J. Shellfish Res. 212:697-705.

King, T. L., M. S. Eackles, B. Gjetvaj & W. R. Hoeh. 1999. Intraspecific phylogeography of Lasmigona subviridis (Bivalvia: Unionidae): conservation implications of range discontinuity. Mol. Ecol. 8:S65-S78.

Kong, X. Y., L. S. Zhang, Z. N. Yu, Y. J. Liu & Q. Y. Wang. 2002. Sequence of ribosomal internal transcribed spacer regions and mitochondrial gene fragments in Crassostrea gigas. J Fishery Sci China 9(4): 304-308.

Kumar, S., K. Tamura & M. Nei. 2004. MEGA3: Integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief. Bioinform. 5:150-163.

Lopez-pinon, M. J., A. Insua & J. Mendez. 2002. Identification of four scallop species using PCR and restriction analysis of the ribosomal DNA internal transcribed spacer region. Mar. Biotechnol. 4:495-502.

Odorico, D. M. & D. J. Miller. 1997. Variation in the ribosomal internal transcribed spacers and 5.8S rDNA among five species of Acropora (Cnidaria Scleractinia): patterns of variation consistent with reticulate re·tic·u·late  
adj.
Resembling or forming a net or network: reticulate veins of a leaf.

v. re·tic·u·lat·ed, re·tic·u·lat·ing, re·tic·u·lates

v.tr.
1.
 evolution. Mol. Biol. Evol. 14:465-473.

Vidigal, T. H. D. A., J. C. Kissinger & R. L. Caldeira. 2000. Phylogenetic relationships among Brazilian Biomphalaria species (Mollusca Planorbidae) based upon analysis of ribosomal ITS-2 sequence. Parasitology Parasitology

The scientific study of parasites and of parasitism. Parasitism is a subdivision of symbiosis and is defined as an intimate association between an organism (parasite) and another, larger species of organism (host) upon which the parasite is
 121:611-620.

Vidigal, T. H. D. A., L. Spatz, J. C. Kissinger, R. A. F. Redondo, E. C. R. Pires, A. J. G. Simpson & O. S. Carvalho. 2004. Analysis of the first and second internal transcribed spacer sequences of the ribosomal DNA in Biomphalaria tenagophila complex (Mollusca: Planorbidae). Mem Inst Oswaldo Cruz, Rio de Janeiro Rio de Janeiro, city, Brazil
Rio de Janeiro (rē`ō də zhänā`rō, Port. rē` thĭ zhənĕē`r
 99(2):153-158.

Von der Schulenburg, J. H. G., J. M. Hancock, A. Pagnamenta, J. J. Sloggett, M. E. N. Majerus & G. D. D. Hurst. 2001. Extreme length and length variation in the first ribosomal internal transcribed spacer of ladybird beetles (Coleoptera; Coccinellidae). Mol. Biol. Evol. 18:648-660.

Winnepenninckx, B., T. Backeljau & R. De Wachter. 1993. Extraction of high molecular weight DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 from mollusks. Trends Genet genet: see civet. . 9:407.

Won, H. & S. S. Renner. 2005. The internal transcribed spacer of nuclear ribosomal DNA in the gymnosperm gymnosperm: see angiosperm.
gymnosperm

Any woody plant that reproduces by means of a seed (or ovule) in direct contact with the environment, as opposed to an angiosperm, or flowering plant, whose seeds are enclosed by mature ovaries, or fruits.
 Gnetum. Mol. Phylogenet. Evol. 36:581-597.

Yu, E. T., M. A. Juinio-Menez & V. D. Monje. 2000. Sequence variation in the ribosomal DNA internal transcribed spacer of Tridacna crocea. Mar. Biotechnol. 2:511-516.

Yu, Z. N., X. Y. Kong, Z. M. Zhuang, Y. S. Lin & L. S. Song. 2001. Sequence study and potential uses of ribosomal DNA internal transcribed spacers in scallop Chlamys farreri. J Fishery Sci China 8(1): 6-9.

CHENG HAN-LIANG, (1) * MENG MENG Master of Engineering Degree  XUE-PING, (1) JI HONG-JU, (2) DONG ZHI-GUO (1) AND CHEN SHU-YIN (2)

(1) HuaiHai Institute of Technology, Jiangsu Key Laboratory of Marine Biotechnology, Lianyungang 222005, P.R. China; (2) Institute of Marine Fisheries, Jiangsu Province, Nantong 226007, P. R. China

* Corresponding author. E-mail: CHL CHL crown-heel length. 3139@163.com
TABLE 1.
The length and GC contents of ITS1, 5.8S ribosomal DNA, and ITS2
in eight haplotypes from six species

                                               ITSI

                                          Length     GC
Species (Sample size)         Haplotype    (bp)     (%)

Meretrix meretrix (2)            WD1       900     61.67
Cyclina sinensis (2)             QD1       585     61.03
                                 QD2       585     61.03
Mercenaria mercenaria (2)        YL1       679     63.03
                                 JL1       864     65.62
Protothaca jedoensis (2)         JL2       864     65.51
Dosinia corrugata (2)            BL1       522     57.66
Ruditapes philippinarum (2)      FL1       632     63.92

                                    5.8S rDNA           ITS2

                               Length       GC     Length     GC
Species (Sample size)           (bp)       (%)      (bp)     (%)

Meretrix meretrix (2)            157      58.60     412     65.29
Cyclina sinensis (2)             157      58.60     386     66.06
                                 157      58.60     388     65.21
Mercenaria mercenaria (2)        157      57.96     361     67.87
                                 157      57.96     282     67.38
Protothaca jedoensis (2)                            281     67.62
Dosinia corrugata (2)            157      57.96     294     66.33
Ruditapes philippinarum (2)      157      57.96     379     67.28

Species (Sample size)         GenBank accession number

Meretrix meretrix (2)         DQ132788, DQ191390
Cyclina sinensis (2)          DQ132787, DQ191387
                              DQ132787, DQ191388
Mercenaria mercenaria (2)     DQ132789, DQ191391
                              DQ220290, DQ191389
Protothaca jedoensis (2)      DQ220291, DQ132791
Dosinia corrugata (2)         DQ346656
Ruditapes philippinarum (2)   DQ399404

TABLE 2.
Percentage of sequence divergence (below triangle) and identity (above
triangle) of ITS1 sequences across seven haplotypes from six species
by Clustal W method

         Species               1       2       3       4

1 Meretrix meretrix           ***     31.8    31.8    28.7
2 Cyclina sinensis QD1        91.7    ***     35.4    33.5
3 Mercenaria mercenaria       96.8    46.9    ***     45.4
4 Protothaca jedoensis JL1    88.9    50.4    27.2    ***
5 Protothaca jedoensis JL2    88.4    50.8    27.4     0.1
6 Dosinia corrugata           96.0    43.5    28.2    40.6
7 Ruditapes philippinarum    102.6    63.3    58.4    52.1

         Species               5       6       7

1 Meretrix meretrix           28.8    31.0    27.2
2 Cyclina sinensis QD1        33.5    35.6    30.8
3 Mercenaria mercenaria       45.1    48.5    30.2
4 Protothaca jedoensis JL1    99.9    41.8    32.0
5 Protothaca jedoensis JL2    ***     41.8    32.0
6 Dosinia corrugata           40.2    ***     31.2
7 Ruditapes philippinarum     52.5    66.0    ***

TABLE 3.
Percentage of sequence divergence (below triangle) and identity (above
triangle) of ITS2 sequences across eight haplotypes from six species
by Clustal W method

  Haplotypes                    1      2      3      4

1 Meretrix meretrix          ***    35.8   36.5   34.3
2 Cyclina sinensis QD1       80.7   ***    96.6   40.1
3 Cyclina sinensis QD2       79.7    0.5   ***    40.3
4 Mercenaria mercenaria      61.3   56.4   56.7   ***
5 Protothaca jedoensis JL1   46.8   48.1   47.6   22.6
6 Protothaca jedoensis JL2   47.0   49.2   48.6   21.6
7 Dosinia corrugata          55.2   52.6   53.0   27.0
8 Ruditapes philippinarum    72.8   72.0   71.8   51.4

  Haplotypes                    5      6      7      8

1 Meretrix meretrix          37.8   39.0   39.7   33.2
2 Cyclina sinensis QD1       39.9   41.8   37.6   39.2
3 Cyclina sinensis QD2       39.6   42.6   37.6   37.9
4 Mercenaria mercenaria      53.0   52.8   62.4   39.2
5 Protothaca jedoensis JL1   ***    97.2   50.9   42.4
6 Protothaca jedoensis JL2    1.1   ***    52.1   42.9
7 Dosinia corrugata          24.5   23.3   ***    44.1
8 Ruditapes philippinarum    47.6   47.1   49.8   ***

TABLE 4.
Percentage of sequence divergences (below triangle) and base variation
(above triangle, transitions/transversions) of 5.8S rDNA across six
species by Clustal W method

         Species             1       2         3         4

1 Meretrix meretrix         ***   9 (3/6)   7 (3/4)   7 (3/4)
2 Cyclina sinensis          6.0     ***     4 (2/2)   4 (2/2)
3 Mercenaria mercenaria     4.6     2.6       ***     0(0/0)
4 Protothaca jedoensis      4.6     2.6       0.0       ***
5 Dosinia corrugata         4.6     2.6       0.0       0.0
6 Ruditapes philippinarum   4.6     2.6       0.0       0.0

         Species                     5         6

1 Meretrix meretrix               7 (3/4)   7 (3/4)
2 Cyclina sinensis                4 (2/2)   4 (2/2)
3 Mercenaria mercenaria           0 (0/0)   0 (0/0)
4 Protothaca jedoensis            0 (0/0)   0 (0/0)
5 Dosinia corrugata                 ***     0 (0/0)
6 Ruditapes philippinarum           0.0       ***
COPYRIGHT 2006 National Shellfisheries Association, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2006, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Author:Chen, Shu-Yin
Publication:Journal of Shellfish Research
Date:Dec 1, 2006
Words:4861
Previous Article:Effect of microalgal concentration and water temperature on the physiology of the Caribbean scallops Argopecten nucleus and Nodipecten nodosus.
Next Article:Ampelisca amphipod tube mats may enhance abundance of northern quahogs Mercenaria mercenaria in muddy sediments.
Topics:



Related Articles
Genetic Variation in Pneumocystis carinii Isolates from Different Geographic Regions: Implications for Transmission.(Statistical Data Included)
Using DNA Microarrays to Study Host-Microbe Interactions.
Silent nucleotide polymorphisms and a phylogeny for mMycobacterium tuberculosis.(Research)
Phylogenetic relationships among the Decabrachia cephalopods inferred from mitochondrial DNA sequences.
Lack of genetic divergence in nuclear and mitochondrial DNA between subspecies of two Haliotis species.
The case for sequencing the Pacific oyster genome.
Chromosomal mapping of 5S ribosomal RNA genes in the eastern oyster, Crassostrea virginica Gmelin by fluorescence in situ hybridization.
Ultrastructure of spermatogenesis in the white clam Chione californiensis (Broderip, 1835) (Mollusca: Pelecypoda).
Restriction enzyme digestion chromosome banding on two commercially important venerid bivalve species: ruditapes decussatus and Cerastoderma edule.
Phylogenetic relationships among nine scallop species (Bivalvia: Pectinidae) inferred from nucleotide sequences of one mitochondrial and three...

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles