Printer Friendly
The Free Library
22,719,120 articles and books

Rickettsia parkeri in Uruguay.



To the Editor: During 1990 in Uruguay, a rickettsiosis rickettsiosis /rick·ett·si·o·sis/ (ri-ket?se-o´sis) infection with rickettsiae.

rick·ett·si·o·sis
n.
Infection with Rickettsia bacteria.
 in the spotted fever group was presumptively diagnosed for 3 patients who had fever, an initial small maculopapulous lesion at the site of a tick bite on the scalp, and subsequent regional lymphadenopathy lymphadenopathy /lym·phad·e·nop·a·thy/ (-op´ah-the) disease of the lymph nodes.

angioimmunoblastic lymphadenopathy , angioimmunoblastic lymphadenopathy with dysproteinemia
. Microimmunofluorescent serologic se·rol·o·gy  
n. pl. se·rol·o·gies
1. The science that deals with the properties and reactions of serums, especially blood serum.

2.
 assay, with Rickettsia conorii as the sole antigen source, gave positive results for all patients, and these infections were presumptively identified as spotted fever caused by R. conorii (1). During 1993-1994, a total of 23 patients who had a history of tick bite, some of whom had exanthema exanthema /ex·an·the·ma/ (eg?zan-the´mah) pl. exanthemas, exanthem´ata   [Gr.] exanthem.

exanthema su´bitum
 and inoculation eschars, were identified from Canelones County, Uruguay. These patients had antibodies against R. conorii, according to microimmunofluorescence testing; however, R. conorii was again the sole antigen source used in the assay (2). Because 1 of the major limitations of serologic testing for diagnosis of rickettsioses Rickettsioses

Often severe infectious diseases caused by several diverse and specialized bacteria, the rickettsiae and rickettsia-like organisms. The best-known rickettsial diseases infect humans and are usually transmitted by parasitic arthropod vectors.
 is the cross-reactivity between different Rickettsia rickettsia (rĭkĕt`sēə), any of a group of very small microorganisms, many disease-causing, that live in vertebrates and are transmitted by bloodsucking parasitic arthropods such as fleas, lice (see louse), and ticks.  species, the association of R. conorii with the spotted fever group cases in Uruguay was considered inappropriate (3). In addition, R. conorii has never been found in the Western Hemisphere (3).

Amblyomma triste triste  
adj.
Sad; wistful.



[Middle English, from Old French, from Latin tristis.]

triste
Adjective

Old-fashioned sad [French]
, a neotropical tick species with a variety of hosts, is the main tick species that feeds on humans in Uruguay and the primary candidate vector for tickborne rickettsioses in that country (4). A recent investigation demonstrated DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 of R. parkeri in A. triste ticks collected from humans and animals, indicating that this rickettsia could be the pathogenic agent of spotted fever group rickettsioses in Uruguay (5). In the United States, where A. maculatum ticks infected with R. parkeri have been reported since the 1930s, the role of this rickettsial rickettsial /rick·ett·si·al/ (ri-ket´se-al) pertaining to or caused by rickettsiae.

rick·ett·si·al
adj.
Relating to, or caused by a member of the genus Rickettsia.
 agent as a human pathogen was confirmed only recently (3). Our study is the first to isolate R. parkeri from A. triste collected in Uruguay and confirms the presence of this emerging pathogen in South America.

During September 2004, 78 adult flat ticks (25 males, 53 females) identified as A. triste were collected from vegetation in the suburban area of Toledo Chico (34[degrees]44'53"S, 56[degrees]06' 19"'W) in Canelones County, southern Uruguay. At the laboratory, the legs of live ticks were extirpated for DNA extraction, and the tick bodies were immediately frozen at -80[degrees]C. Each group of legs from 1 tick was subjected to DNA extraction by boiling at 100[degrees]C for 20 min as described (6). DNA extracted from each tick was tested by PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
 by using primers CS-78 and CS-323 (Table), which targeted a 401-bp fragment of the citrate synthase gene (gltA) of possibly all Rickettsia species (7). For 2 ticks (1 male, 1 female) that had positive results with PCR testing, Rickettsia isolation in cell culture was attempted by using the shell vial technique with the following modifications: Vero cells inoculated with tick body homogenate homogenate /ho·mog·e·nate/ (ho-moj´in-at) material obtained by homogenization.

homogenate

material obtained by homogenization.
 were incubated at 28[degrees]C; the level of infection of cells was monitored by Gimenez staining of scraped cells from the inoculated monolayer mon·o·lay·er
n.
1. A film or layer one molecule thick formed at the interface between water and either oil or air by a substance such as a partially esterified fatty acid that contains both hydrophobic and hydrophilic groups in the same
; and a rickettsial isolate was considered established after 3 passages, each reaching >90% of infected cells (7).

Rickettsiae were successfully isolated and established in Vero cell culture from the female tick. This isolate, designated as At5URG URG Urgent
URG Utility Retained Generation (utility industry)
URG Urogastrone
URG University Research Grant
URG You Are Gay
URG Underway Replenishment Group
URG University Research Glassware (Chapel Hill, NC) 
, has been deposited as a reference strain in the Rickettsial Collection of Faculty of Veterinary Medicine in the University of Sao Paulo. DNA extracted from infected cells of the third passage was tested by a battery of PCRs that used all primer pairs listed in the Table and targeted fragments of 3 rickettsial genes: gltA, ompB, and ompA. PCR products of expected size were obtained in all reactions and subjected to DNA sequencing as described (6). Fragments of 1,084, 775, and 491 nt of the gltA, ompB, and ompA genes, respectively, were obtained and showed 100% identity to the corresponding sequences available in GenBank (accession nos. U59732, AF123717, and U43802, respectively) for the Maculatum strain of R. parkeri from United States. Although isolation of Rickettsia from the male tick was unsuccessful, DNA extracted from remnants of the male and female ticks was tested by PCR (ompA, Table) and yielded product that after sequencing (491 nt) showed 100% identity to the R. parkeri sequence from GenBank (U43802).

These procedures enabled the identification of R. parkeri in 2.56% of the A. triste ticks from Uruguay. Previous findings of R. parkeri DNA in A. triste ticks from Uruguay (5) are corroborated cor·rob·o·rate  
tr.v. cor·rob·o·rat·ed, cor·rob·o·rat·ing, cor·rob·o·rates
To strengthen or support with other evidence; make more certain. See Synonyms at confirm.
 by our isolation of a Uruguayan strain of R. parkeri in cell culture. The only other country where R. parkeri has been previously reported is the United States, where it is associated with A. maculatum ticks and is the causative agent of an emerging rickettsiosis (3). As A. maculatum and A. triste are established in at least 12 other Latin American countries (10), the distribution of R. parkeri in the Americas is likely continental. Finally, our results corroborate To support or enhance the believability of a fact or assertion by the presentation of additional information that confirms the truthfulness of the item.

The testimony of a witness is corroborated if subsequent evidence, such as a coroner's report or the testimony of other
 recent reports (3,5) that suggest R. parkeri is the causative agent of previously reported cases of rickettsiosis in Uruguay.

This study was financially supported by Foundation of Support to the Research of the State of Sao Paulo (FAPESP FAPESP Fundacao de Amparo a Pesquisa do Estado de Sao Paulo (Brazil) ).

References

(1.) Conti-Diaz IA, Rubio I, Somma Moreira RE, Perez Bormida G. Rickettsioses cutaneo ganglionar por Rickettsia conorii en el Uruguay. Rev Inst Med Trop Sao Paulo. 1990;32:313-8.

(2.) Diaz IA. Rickettsioses caused by Rickettsia conorii in Uruguay. Ann N Y Acad Sci. 2003;990:264-6.

(3.) Parola P, Paddock CD, Raoult D. Tick-born rickettsioses around the world: emerging diseases challenging old concepts. Clin Microbiol Rev. 2005;18:719-56.

(4.) Venzal JM, Guglielmone AA, Estrada Pena A, Cabrera PA, Castro O. Ticks (Ixodida: Ixodidae) parasitising humans in Uruguay. Ann Trop Med Parasitol. 2003;97:769-72.

(5.) Venzal JM, Portillo A, Estrada-Pena A, Castro O, Cabrera PA, Oteo JA. Rickettsia parkeri in Amblyomma triste from Uruguay. Emerg Infect Dis. 2004;10: 1493-5.

(6.) Horta MC, Pinter A, Cortez A, Soares RM, Gennari SM, Schumaker TTS (1) See text-to-speech.

(2) (Transaction Tracking System) Software that monitors a transaction until completion. In the event of a hardware or software failure, it ensures that the database is brought back to its former state before the attempt to
, et al. Rickettsia felis (Rickettsiales: Rickettsiaceae) in Ctenocephalides felis felis (Siphonaptera: Pulicidae) in the State of Sao Paulo, Brazil. Arq Bras Med Vet Zoot 2005;57:321-5.

(7.) Labruna MB, Whitworth T, Horta MC, Bouyer DH, McBride JW, Pinter A, et al. Rickettsia species infecting Amblyomma cooperi ticks from an area in the State of Silo silo, watertight and airtight structure for making and storing silage. Silos vary in form from a covered pit, such as was used by the early Romans, to the modern storage tower, dating from the 19th cent.  Paulo, Brazil, where Brazilian spotted fever is endemic. J Clin Microbiol. 2004;42:90-8.

(8.) Roux Roux , Pierre Paul Émile 1853-1933.

French bacteriologist. His work with the diphtheria bacillus led to the development of antitoxins to neutralize pathogenic toxins.
 V, Raoult D. Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer membrane protein rOmpB (ompB). Int J Syst Evol Microbiol. 2000;50:1449-55.

(9.) Regnery RL, Spruill CL, Plikaytis BD. Genotypic identification of rickettsiae and estimation of intraspecies in·tra·spe·cif·ic   also in·tra·spe·cies
adj.
Arising or occurring within a species: intraspecific competition.

Adj. 1.
 sequence divergence for portions of two rickettsial genes. J Bacteriol. 1991;173:1576-89.

(10.) Guglielmone AA, Estrada-Pena A, Keirans JE, Robbins RG. Ticks (Acari: Ixodida) of the Neotropical Zoogeographic Region. International Consortium on Ticks and Tick-borne Diseases, Atalanta, Houten, The Netherlands; 2003.

Richard C. Pacheco, * Jose M. Venzal,([dagger]) Leonardo J. Richtzenhain, * and Marcelo B. Labruna *

* University of Sao Paulo, Sao Paulo, SP, Brazil; and ([dagger]) University of La Republica, Montevideo, Uruguay

Address for correspondence: Marcelo B. Labruna, Laboratorio de Doengas Parasitarias, Departamento de Medicina Veterinaria Preventiva e Saude Animal, Faculdade de Medicina Veterinaria e Zootecnia, Universidade de Sao Paulo, Av. Prof. Dr. Orlando Marques Marques may refer to:
  • marque, or brand name
  • Marqués, a surname
  • A Spanish form of Marquis.
  • ''Marques, a tall ship.
 de Paiva 87, Sao Paulo, SP, Brazil 05508-270; email: labruna@usp.br
Table. Primer pairs used for amplification of rickettsial genes

Primer   Genes and          Primer sequences          Fragment size
pairs     primers         (5' [right arrow] 3')       (nucleotides)

            gltA
1          CS-78         GCAAGTATCGGTGAGGATGTAAT           401
           CS-323     GCTTCCTTAAAATTCAATAAATCAGGAT
2          CS-239       GCTCTTCTCATCCTATGGCTATTAT          834
          CS-1069         CAGGGTCTTCGTGCATTTCTT
            ompB
3         120-M59          CCGCAGGGTTGGTAACTGC             862
          120-807         CCTTTTAGATTACCGCCTAA
            ompA
4        Rr190.70p        ATGGCGAATATTTCTCCAAAA            530
         Rr190.602n       AGTGCAGCATTCGCTCCCCCT

Primer   Genes and
pairs     primers               Reference

            gltA
1          CS-78                    7
           CS-323                   7
2          CS-239                   7
          CS-1069                   7
            ompB
3         120-M59                   8
          120-807                   8
            ompA
4        Rr190.70p                  9
         Rr190.602n                 9
COPYRIGHT 2006 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2006, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:LETTERS
Author:Labruna, Marcelo B.
Publication:Emerging Infectious Diseases
Article Type:Letter to the editor
Date:Nov 1, 2006
Words:1291
Previous Article:Viruses from nonhuman primates.
Next Article:Influenza-related death rates for pregnant women.



Related Articles
Spotted-fever group Rickettsia in Dermacentor variabilis, Maryland.
Rickettsia parkeri in Amblyomma triste from Uruguay.
"Due to limited financial resources, we cannot help these people ...".
Rickettsial infection in animals and Brazilian spotted fever endemicity.
Steinbeck's green mentor.
Human infection with Rickettsia honei, Thailand.
Rickettsia massiliae human isolation.
Fatal human infection with Rickettsia rickettsii, Yucatan, Mexico.
Rickettsia parkeri infection after tick bite, Virginia.
Gulf Coast ticks (Amblyomma maculatum) and Rickettsia parkeri, United States.

Terms of use | Copyright © 2014 Farlex, Inc. | Feedback | For webmasters