Printer Friendly
The Free Library
14,716,650 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Rapid identification of emerging pathogens: coronavirus.


We describe a new approach for infectious disease Infectious disease

A pathological condition spread among biological species. Infectious diseases, although varied in their effects, are always associated with viruses, bacteria, fungi, protozoa, multicellular parasites and aberrant proteins known as prions.
 surveillance that facilitates rapid identification of known and emerging pathogens. The process uses broad-range polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is  (PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
) to amplify nucleic acid nucleic acid, any of a group of organic substances found in the chromosomes of living cells and viruses that play a central role in the storage and replication of hereditary information and in the expression of this information through protein synthesis.  targets from large groupings of organisms, electrospray ionization Electrospray ionization (ESI) is a technique used in mass spectrometry to produce ions. It is especially useful in producing ions from macromolecules because it overcomes the propensity of these molecules to fragment when ionized.  mass spectrometry mass spectrometry
 or mass spectroscopy

Analytic technique by which chemical substances are identified by sorting gaseous ions by mass using electric and magnetic fields.
 for accurate mass measurements of PCR products, and base composition signature analysis to identify organisms in a sample. We demonstrate this principle by using 14 isolates of 9 diverse Coronavirus coronavirus /co·ro·na·vi·rus/ (ko-ro´nah-vi?rus) any virus belonging to the family Coronaviridae.
Coronavirus /Co·ro·na·vi·rus/ (ko-ro´nah-vi?rus 
 spp., including the severe acute respiratory syndrome-associated coronavirus (SARS-CoV). We show that this method could identify and distinguish between SARS and other known CoV, including the human CoV 229E and OC43, individually and in a mixture of all 3 human viruses. The sensitivity of detection, measured by using titered SARSCoV spiked into human serum, was [approximately equal to]1 PFU/mL. This approach, applicable to the surveillance of bacterial, viral, fungal, or protozoal protozoal

pertaining to or caused by protozoa.


protozoal myeloencephalitis
see equine protozoal myeloencephalitis.

protozoal hepatitis
caused usually by Toxoplasma, Neospora, Leishmania.
 pathogens, is capable of automated analysis of >900 PCR reactions per day.

Nucleic acid tests for infectious diseases infectious diseases: see communicable diseases.  are primarily based on amplification methods that use primers and probes designed to detect specific organisms. Because prior knowledge of nucleic acid sequence information is required to develop these tests, they are not able to identify unanticipated, newly emergent, or previously unknown infectious organisms. Thus, the discovery of new infectious organisms still relies largely on culture methods and microscopy, which were as important in the recent identification of the severe acute respiratory syndrome-associated coronavirus (SARS-CoV) as they were in the discovery of HIV HIV (Human Immunodeficiency Virus), either of two closely related retroviruses that invade T-helper lymphocytes and are responsible for AIDS. There are two types of HIV: HIV-1 and HIV-2. HIV-1 is responsible for the vast majority of AIDS in the United States.  2 decades ago (1-4).

Broad-range polymerase chain reaction (PCR) methods provide an alternative to single-agent tests. By amplifying gene targets conserved across groups of organisms, broad-range PCR has the potential to generate amplification products across entire genera, families, or, as with bacteria, an entire domain of life. This strategy has been successfully used with consensus 16S ribosomal RNA ribosomal RNA
n.
See rRNA.


ribosomal RNA (rī´bōsō´m
 primers for determining bacterial diversity, both in environmental samples (5) and in natural human flora (6). Broad-range priming has also been described for detection of several viral families, including CoV (7), enteroviruses Enteroviruses
Viruses which live in the gastrointestinal tract. Coxsackie viruses, viruses that cause hand-foot-mouth disease, are an enterovirus.

Mentioned in: Hand-Foot-and-Mouth Disease
 (8), retroid viruses (9), and adenovirnses (10). The drawback of this approach for epidemiologic applications is that the analysis of PCR products for mixed amplified samples requires sequencing hundreds of colonies per reaction, which is impractical to perform rapidly or on large numbers of samples. New approaches to the parallel detection of multiple infectious agents include multiplexed PCR methods (11,12) and microarray strategies (13-15). Microarray strategies are promising because undiscovered organisms might be detected by hybridization hybridization /hy·brid·iza·tion/ (hi?brid-i-za´shun)
1. crossbreeding; the act or process of producing hybrids.

2. molecular hybridization

3.
 to probes designed to conserved regions of known families of bacteria and viruses.

We present an alternative approach for rapid, sensitive, and high-throughput detection of infectious organisms. We use broad-range PCR to generate amplification products from the broadest possible grouping of organisms, followed by electrospray ionization mass spectrometry and base composition analysis of the products (16,17). The base compositions of strategically selected regions of the genome are used to identify and distinguish organisms in the sample. Enhanced breadth of priming is achieved through the use of primers and probes containing 5-propynyl deoxycytidine and deoxyuridine nucleotides that offer increased affinity and base pairing base pairing Molecular biology The specific complementary hydrogen bonding of the bases–purines and pyrimidines—in a double stranded nucleic acid; BP results in formation of a double helix from 2 complementary single strands; in DNA the pairs are  selectivity (18,19). Positioning the 5-propynyl primidine-modified nucleotides at highly conserved positions enables priming at short consensus regions and significantly increases the extent to which broad groups of organisms can be amplified.

Materials and Methods

CoV Isolates and Broad-range PCR Primer Pairs

Table 1 lists all the CoV used in this study. Multiple sequence alignments of all available CoV nucleotide sequences from GenBank were scanned to identify pairs of potential PCR priming loci loci

[L.] plural of locus.

loci Plural of locus, see there
. Two target regions were selected in CoV ORF-lb (annotations based on Snijder et al. [20]), 1 in RNA-dependent RNA polymerase RNA polymerase
n.
A polymerase that catalyzes the synthesis of RNA from a DNA or RNA template.
 (RdRp) and the other in Nspl4 (Table 2). 5' propynyl-modified pyrimidine nucleotides (shown in bold) were positioned at universally conserved positions within these primers to extend the breadth of broad-range priming to allow efficient PCR from all CoV species tested.

For each primer region, a database of expected base compositions (A, G, C, and T base counts) from all known CoV sequences in GenBank was generated (data not shown) and used in the identification and classification of the test isolates. Several of the isolates used in this study did not have a genome sequence record in GenBank. Experimentally measured base compositions from these isolates were independently verified by sequencing [approximately equal to]500 bp regions that flanked both target regions used in this study (GenBank accession nos. AY874541 and AY878317-AY878324).

RNA RNA: see nucleic acid.
RNA
 in full ribonucleic acid

One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic
 Extraction, Reverse Transcription reverse transcription
n.
The process by which DNA is synthesized from an RNA template.
, and PCR

RNA was isolated from 250 [micro]L of CoV-infected cells or culture supernatant supernatant /su·per·na·tant/ (-na´tant) the liquid lying above a layer of precipitated insoluble material.

supernatant

the liquid lying above a layer of precipitated insoluble material.
 spiked with 3 [micro]g of sheared sheared  
adj.
Shaped or finished by shearing, especially cut or trimmed to a uniform length: a sheared fur coat.

Adj. 1.
 poly-A DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 using Trizol or Trizol LS, respectively (Invitrogen Inc., Carlsbad, CA, USA) according to according to
prep.
1. As stated or indicated by; on the authority of: according to historians.

2. In keeping with: according to instructions.

3.
 the manufacturer's protocol. Reverse transcription was performed by mixing 10 [micro]L of the purified RNA with 5 BL of water treated with diethyl pyrocarbonate (DEPC DEPC Diethyl Pyrocarbonate
DEPC Down East Partnership for Children
DEPC Data Evaluation and Publication Committee
, Sigma-Aldrich Co., St. Louis, MO, USA) containing 500 ng random primers, 1 [micro]g of sheared poly-A DNA, and 10 U SUPERaseln (Ambion Inc., Woodlands, TX, USA). The mixture was heated to 60[degrees]C for 5 min and then cooled to 4[degrees]C. Following the annealing annealing (ənēl`ĭng), process in which glass, metals, and other materials are treated to render them less brittle and more workable.  of the random primers to the RNA, 20 [micro]L of first-strand reaction mix consisting of 2x first-strand buffer (Invitrogen Inc.), 10 mmol/L DTT DTT Deloitte Touche Tohmatsu (Deloitte & Touch Global Operations)
DTT Dithiothreitol (cytology reagent)
DTT Digital Terrestrial Television
DTT Discrete Trial Training
, 500 [micro]mol/L deoxynucleoside triphosphates (dNTPs), and 7.5 U SuperScript Any letter, digit or symbol that appears above the line. For example, 10 to the 9th power is written with the 9 in superscript (109). Contrast with subscript.  II was added to the RNA primer mixture. The RNA was reversed transcribed for 45 min at 45[degrees]C. Various dilutions of the reverse transcription reaction mixes were used directly in the PCR reactions.

All PCR reactions were performed in 50 [micro]L with 96-well microtiter plates and M.J. Dyad dyad /dy·ad/ (di´ad) a double chromosome resulting from the halving of a tetrad.

dy·ad
n.
1. Two individuals or units regarded as a pair, such as a mother and a daughter.

2.
 thermocyclers (MJ Research, Waltham, MA, USA). The PCR reaction buffer consisted of 4 U Amplitaq Gold (Applied Biosystems Applied Biosystems, Inc. (formerly NASDAQ: ABIO) is the original name of a pioneer biotechnology company founded in 1981 in Foster City, California, among the Silicon Valley cities of the southern San Francisco Bay Area. , Foster City, CA USA), 1x buffer II (Applied Biosystems, Foster City, CA, USA), 2.0 mmol/L Mg[Cl.sub.2], 0.4 mol/L betaine betaine /be·ta·ine/ (be´tah-en) the carboxylic acid derived by oxidation of choline; it acts as a transmethylating metabolic intermediate and is used in the treatment of homocystinuria. , 800 [micro]mol/L dNTP mix, and 250 nmol/L propynecontaining PCR primers. The following PCR conditions were used to amplify CoV sequences: 95[degrees]C for 10 min followed by 50 cycles of 95[degrees]C for 30 s, 50[degrees]C for 30 s, and 72[degrees]C for 30 s. After PCR, the amplified products were desalted before analysis by electrospray ionization Fourier transform ion cyclotron resonance Fourier transform ion cyclotron resonance mass spectrometry, also known as Fourier transform mass spectrometry, is a type of mass analyzer (or mass spectrometer) for determining the mass-to-charge ratio (m/z) of ions based on the cyclotron frequency of the ions in a fixed  mass spectrometry (ESI-FTICR-MS) by methods described previously (21). A small oligonucleotide SH2 (CGTGCATGGCGG, Synthetic Genetics, San Diego San Diego (săn dēā`gō), city (1990 pop. 1,110,549), seat of San Diego co., S Calif., on San Diego Bay; inc. 1850. San Diego includes the unincorporated communities of La Jolla and Spring Valley. Coronado is across the bay. , CA, USA) was added as an internal mass standard (22); the final concentration of SH2 was 50 nmol/L.

Mass Spectrometry and Signal Processing See DSP.

The mass spectrometer used in this work is based on a Bruker Daltonics Bruker Daltonics is a global scientific instrument manufacturer. The company is a part of Bruker Biosciences Corporation (Nasdaq:BRKR) and specializes in mass spectrometry. The Bruker Daltonics headquarters are in Billerica, MA - USA and Bremen, Germany.  (Billerica, MA, USA) Apex II 70e ESIFTICR-MS that used an actively shielded 7 Tesla super-conducting magnet. All aspects of pulse sequence control and data acquisition were performed on a 1.1 GHz Pentium II The successor to the Pentium Pro from Intel. Pentium II refers to the CPU chip or the PC that uses it. Code named "Klamath," the Pentium II was a Pentium Pro with MMX multimedia instructions.  data station running Bruker's Xmass software (Bruker Daltonics). Inputs to the signal processor are the raw mass spectra for each of the parallel PCR reactions used to analyze a single sample. The ICR-2LS software package (23) was used to deconvolute the mass spectra and calculate the mass of the monoisotopic species using an "averagine" fitting routine (24) modified for DNA (Drader et al., unpub, data). Using this approach, monoisotopic molecular weights were calculated. The spectral signals were algorithmically processed to yield base composition data as described previously (25). The amplitudes of the spectra are calibrated cal·i·brate  
tr.v. cal·i·brat·ed, cal·i·brat·ing, cal·i·brates
1. To check, adjust, or determine by comparison with a standard (the graduations of a quantitative measuring instrument):
 to indicate the number of molecules detected in the mass spectrometer versus m/z and the m/z values are corrected by using internal mass standards. The algorithm computes the organism's identity and abundances consistent with observations over all the PCR reactions run on the input sample.

Results and Discussion

Detection of Individual CoV Isolates

For broad-range detection of all CoV, the 2 PCR primer target regions shown in Table 2 were used against each virus listed in Table 1. Resultant products were desalted and analyzed by FTICR-MS by methods described previously (21). The spectral signals were algorithmically processed to yield base composition data. Figure 1 shows a schematic representation of electrospray ionization, strand separation, and the actual charge state distributions of the separated sense and antisense strands of the PCR products from the RdRp primer pair for SARS-CoV. Due to the accuracy of FTICR-MS (mass measurement error [+ or -] 1 ppm), all detected masses could be unambiguously converted to the base compositions of sense and antisense strands (25).

[FIGURE 1 OMITTED]

One of the limitations of all molecular methods for detecting pathogens, including the one described here, is that unexpected variations in PCR primer target sequences in unknown species can lead to missed detection. To minimize this possibility, the primers designed in this study were selected on the basis of highly conserved regions identified by multiple sequence alignments of all previously known CoV species sequences. Further, we chose 2 amplification targets for redundant detection of the CoV and to have increased resolution to distinguish the different viral species. Both primer pairs were tested against multiple isolates from the 3 previously known CoV species groups and from SARS-CoV isolates.

The results from analysis of 14 CoV isolates are shown in Table 1. For both target regions, the measured signals agreed with compositions expected from the known CoV sequences in GenBank. Several of the isolates used in this study did not have a genome sequence record in GenBank. Nevertheless, we were able to amplify all test viruses and experimentally determine their base compositions. These experimentally determined base compositions were confirmed by sequencing (data not shown). Thus the strategy described here enables identification of organisms without the need for prior knowledge of the sequence, provided that the broad range primers do not fail to amplify the target because of excessive numbers of mismatches.

Multiple CoV Isolates in Mixture

To demonstrate the potential to detect multiple viruses in the same sample, as might occur during a coinfection, we pooled the viral extracts from 3 human CoV, HCoV229E, HCoV-OC43, and SARS-CoV, and analyzed the mixture. Signals from all 3 viruses were clearly detected and resolved in the mass spectra (Figure 2), which demonstrated that coinfections of >1 CoV species could be identified. We have previously determined that the system can reliably detect multiple species in ratios of [approximately equal to]l:1,000, while varying input loads from 10 to 10,000 organisms (data not shown).

[FIGURE 2 OMITTED]

Sensitivity

To determine sensitivity in a clinical sample, viable, titered SARS-CoV was added to human serum and analyzed in 2 ways. In the first, RNA was isolated from serum containing 2 concentrations of the virus (1.7 x [10.sup.5] and 170 PFU/mL), reverse transcribed to cDNA with random primers, and serially diluted (10-fold), before PCR amplification with both RdRp and Nspl4 primer sets. By using this approach, the assay was sensitive to [approximately equal to][10.sup.-2] PFU PFU

plaque-forming unit; in virology, areas of cell lysis (CPE) in monolayer cell culture, under overlay conditions, initiated by infection with a single virus particle.
 per PCR reaction ([approximately equal to]1.7 PFU/mL serum). We estimated the number of reverse-transcribed SARS genomes by competitive, quantitative PCR with a nucleic acid internal standard (data not shown). Analysis of ratios of mass spectral peak heights of titrations of the internal standard and the SARS cDNA showed that [approximately equal to]300 reverse-transcribed viral genomes were present per PFU, similar to the ratio of viral genome copies per PFU previously reported for RNA viruses RNA viruses,
n See viruses.
 (26). By using this estimate, PCR primers were sensitive to 3 genome equivalents per PCR reaction, which is consistent with previously reported detection limits for optimized SARS-specific primers (27,28). In the second method, we spiked 10-fold dilutions of the SARS virus into serum before RT-PCR RT-PCR

reverse transcriptase-polymerase chain reaction. See PCR1.
 and could reliably detect 1 PFU ([approximately equal to]300 genomes) per PCR reaction or 170 PFU (5.1 x 104 genomes) per mL serum. The discrepancy between the detection sensitivities in the 2 experimental protocols described above suggests that losses were associated with RNA extraction and reverse transcription when very little virus was present (<300 genome copies) in the starting sample in serum. This finding is consistent with results for direct measurement of RNA viruses from patient samples (26). Therefore, in a practical experimental analysis of a tissue sample, the limit of sensitivity was [approximately equal to]1 PFU per PCR reaction.

RNA Virus RNA virus
n.
Any of a group of viruses whose nucleic acid core is composed of RNA, including the picornaviruses, retroviruses, and paramyxoviruses.
 Classification with Base Compositions

We have described a novel approach using base composition analysis for viral identification. However, since RNA virus nucleotide sequences mutate mu·tate  
intr. & tr.v. mu·tat·ed, mu·tat·ing, mu·tates
To undergo or cause to undergo mutation.



[Latin m
 over time within the functional constraints allowed by selection pressure (29), the utility of this method to correctly classify RNA viruses depends on the resolution needed for a particular application. We considered 2 specific applications. The first was to distinguish SARS-CoV from other species of CoV that infect humans, namely HCoV-OC43 and HcoV-229E. The second application was the utility of the technique for exploration of animal reservoirs for the discovery of SARS-related CoV species.

To quantitatively analyze the resolving power resolving power: see telescope.
Resolving power (optics)

A quantitative measure of the ability of an optical instrument to produce separable images.
 of base compositions, we mathematically modeled base composition variations using known sequences of multiple isolates of hepatitis C virus
This page is for the virus. For the disease, see Hepatitis C.
The Hepatitis C virus (HCV) is a small (50 nm in size), enveloped, single-stranded, positive sense RNA virus in the family Flaviviridae.
 (HCV HCV
abbr.
hepatitis C virus


HCV 1 Hepatitis C virus, see there 2. Human coronavirus. See Coronavirus.
) in GenBank (H. Levene et al., unpub, data). HCV sequence-derived mutation probabilities were used to estimate the extent of base composition variations for CoV species. Figure 3 shows a plot of the base compositions for the RdRp target region for the 3 CoV known to infect humans. [[DELTA].sub.bc] represents the net changes in composition required for strain variants of 229E or OC43 to be misidentified as SARS, and Am the probability of occurrence of these changes. The cumulative probability of misclassifying either 229E or OC43 as SARS by using base composition measurements from both target regions was low ([[DELTA].sub.m] >10), even allowing for unseen variations in those 2 viruses. Thus, for use in human clinical diagnostics, base composition analysis of the 2 target regions described here would provide corroborative cor·rob·o·rate  
tr.v. cor·rob·o·rat·ed, cor·rob·o·rat·ing, cor·rob·o·rates
To strengthen or support with other evidence; make more certain. See Synonyms at confirm.
 information and accurate species identification of CoV infections.

[FIGURE 3 OMITTED]

To determine the utility of base composition analysis in the search for animal CoV species, we calculated the cumulative mutation distances for both target regions for all known CoV and plotted groups where all members fall within certain probability thresholds, as shown in Figure 4. A series of nested ovals represents subgroupings of species, where the maximal distance between known members of a subgroup is represented by the [[DELTA].sub.m] next to the oval. By using the above classification metric, SARS-CoV would be considered the first member of a new group of CoV, not a member of the core group 2 cluster, although it would be placed closest to group 2 ([[DELTA].sub.m] < 10.2). These findings are similar to those recently described by Snijder et al., who used sequence data from the replicase replicase /rep·li·case/ (rep´li-kas)
1. a polymerase synthesizing RNA from an RNA template.

2. more generically, any enzyme that replicates nucleic acids, i.e., a DNA or RNA polymerase.
 genes (5,487 bp) in ORF1b and suggested that the SARS-CoV was most closely related to and possibly an early split-off from group 2 CoV (20). However, substantial space exists around SARS-CoV where as yet undiscovered SARS-CoV could populate a subgroup without being confused with the group 2 or other CoV.

[FIGURE 4 OMITTED]

Conclusion

The strategy we describe allows rapid identification of new viral species members of previously characterized viral families, without the need for prior knowledge of their sequence, through use of integrated electrospray ionization mass spectrometry and base composition analysis of broad-range PCR products. Broad-range PCR reactions are capable of producing products from groups of organisms, rather than single species, and the information content of each PCR reaction is potentially very high. Further, in many cases, including the SARS-CoV detection described in this article, priming across broadly conserved regions provides adequate species detection and taxonomic resolution. In cases where additional subspecies subspecies, also called race, a genetically distinct geographical subunit of a species. See also classification.  level classification becomes important, broad primers can be followed up with more species-specific primers that can detect even single nucleotide changes (SNPs) or alternatively, larger regions of the identified species can be analyzed by sequencing. Despite the advances in high throughput sequencing, however, it is impractical as a front-end detector in a routine survey and detection setting. The mass spectrometer is capable of analyzing complex PCR products at a rate of [approximately equal to]1 minute per sample. Because the process is performed in an automated, microtiter plate format, large numbers of samples can be examined (>900 PCR reactions/day/instrument), which makes this process practical for large-scale analysis of clinical or environmental surveillance samples in public health laboratory settings. The current generations of ESI (Edge Side Includes) A markup language for Web pages that enables elements of a Web page to be dynamically assembled in servers distributed throughout the Internet.  mass spectrometers used in the detector cost approximately U.S.$150,000 and can be operated 24 hours per day by trained technicians. Tools for analyzing mass spectrometry data are widely available and are described in detail elsewhere (23-25). A comparable alternative to the methods described here are microarrays, which can also provide broad range detection.

This approach can be extended to other viral, bacterial, fungal, or protozoal pathogen groups and is a powerful new paradigm New Paradigm

In the investing world, a totally new way of doing things that has a huge effect on business.

Notes:
The word "paradigm" is defined as a pattern or model, and it has been used in science to refer to a theoretical framework.
 for timely identification of previously unknown organisms that cause disease in humans or animals and for monitoring the progress of epidemics.

This study used platform technology that was funded in part by the Department of Defense through its DARPA DARPA: see Defense Advanced Research Projects Agency.


(Defense Advanced Research Projects Agency) The name given to the U.S. Advanced Research Projects Agency during the 1980s. It was later renamed back to ARPA.
 Special Projects Office for the development of TIGER Technology, under contract MDA (1) (Monochrome Display Adapter) The first IBM PC monochrome video display standard for text. Due to its lack of graphics, MDA cards were often replaced with Hercules cards, which provided both text and graphics. See PC display modes and Hercules Graphics. 972-00-C-0053; patents are currently pending in the United States United States, officially United States of America, republic (2005 est. pop. 295,734,000), 3,539,227 sq mi (9,166,598 sq km), North America. The United States is the world's third largest country in population and the fourth largest country in area.  and internationally. Additional funding and support was provided by grants from the National Institutes of Health, AI 25913 to M.B., and T32 NS 41219 to B.N. All authors, with the exception of M.B. and B.N., are employees and stockholders of Isis Pharmaceuticals, Inc.
Table 1. Coronaviruses used in the study and mass spectrometry
results *

                                                         RdRp

                                                      Experiment
          CoV                                         determined
Group   species    Strain       Source     Strand     masses (Da)

1       Canine      1-71        VR809        S         27486.514
                                             AS        26936.574
                  CCV-TN449     VR2068       S         27471.510
                                             AS        26952.548
        Feline     WSU 79-      VR-989       S         27471.517
                    1683                     AS        26952.556
                     DF2        VR2004       S         27472.497
                                             AS        26953.536
         Human      229E        VR740        S         27450.532
         229E                                AS        26975.545
                    229E         NHRC        S         27450.506
                               ([double      AS        26975.512
                               dagger])
2       Bovine      Calf        VR874        S         27358.452
                  diarrheal                  AS        27066.586
                    virus
         Human      OC43         NHRC        S         27328.473
         OC43                  ([double      AS        27098.562
                               dagger])
        Murine      MHV1        VR261        S         27344.491
         hepa-                               AS        27083.564
         titis      JHM-        VR1426       S         27344.497
         virus     thermo-                   AS        27083.571
                   stable
                   MHV-A59      VR764        S         27344.503
                                             AS        27083.572
          Rat       8190        VR1410       S         27344.491
                                             AS        27083.567
3       Infec-      Egg-         VR22        S         27396.544
         tious     adapted                   AS        27032.524
         bron-
        chitis
         virus
4        SARS       TOR2      University     S         27298.518
                                  of         AS        27125.542
                               Manitoba
                                ([sub-
                              section])
                   Urbani        CDC         S         27298.518
                               ([para-       AS        27125.542
                               graph])

                                                         RdRp

          CoV                                       Calculated base
Group   species    Strain       Source     Strand    compositions

1       Canine      1-71        VR809        S      A24 G24 C8 T32
                                             AS     A32 G8 C24 T24
                  CCV-TN449     VR2068       S      A24 G24 C9 T31
                                             AS     A31 G9 C24 T24
        Feline     WSU 79-      VR-989       S      A24 G24 C9 T31
                    1683                     AS     A31 G9 C24 T24
                     DF2        VR2004       S      A23 G25 C10 T30
                                             AS     A30 G10 C25 T23
         Human      229E        VR740        S      A25 G24 C11 T28
         229E                                AS     A28 G11 C24 T25
                    229E         NHRC        S      A25 G24 C11 T28
                               ([double      AS     A28 G11 C24 T25
                               dagger])
2       Bovine      Calf        VR874        S      A22 G22 C12 T32
                  diarrheal                  AS     A32 G12 C22 T22
                    virus
         Human      OC43         NHRC        S      A22 G22 C14 T30
         OC43                  ([double      AS     A30 G14 C22 T22
                               dagger])
        Murine      MHV1        VR261        S      A21 G23 C14 T30
         hepa-                               AS     A30 G14 C23 T21
         titis      JHM-        VR1426       S      A21 G23 C14 T30
         virus     thermo-                   AS     A30 G14 C23 T21
                   stable
                   MHV-A59      VR764        S      A21 G23 C14 T30
                                             AS     A30 G14 C23 T21
          Rat       8190        VR1410       S      A21 G23 C14 T30
                                             AS     A30 G14 C23 T21
3       Infec-      Egg-         VR22        S      A24 G24 C14 T26
         tious     adapted                   AS     A26 G14 C24 T24
         bron-
        chitis
         virus
4        SARS       TOR2      University     S      A27 G19 C14 T28
                                  of         AS     A28 G14 C19 T27
                               Manitoba
                                ([sub-
                              section])
                   Urbani        CDC         S      A27 G19 C14 T28
                               ([para-       AS     A28 G14 C19 T27
                               graph])

                                                         Nsp14

                                                      Experiment
                                                      determined
          CoV                                         masses (Da)
Group   species    Strain       Source     Strand     ([dagger])

1       Canine      1-71        VR809        S         42475.955
                                             AS        42185.117
                  CCV-TN449     VR2068       S         42474.899
                                             AS        42184.072
        Feline     WSU 79-      VR-989       S         42490.945
                    1683                     AS        42169.118
                     DF2        VR2004       S         42450.904
                                             AS        42209.081
         Human      229E        VR740        S         42462.994
         229E                                AS        42198.061
                    229E         NHRC        S         42462.930
                               ([double      AS        42198.040
                               dagger])
2       Bovine      Calf        VR874        S         42606.039
                  diarrheal                  AS        42052.897
                    virus
         Human      OC43         NHRC        S         42580.959
         OC43                  ([double      AS        42076.028
                               dagger])
        Murine      MHV1        VR261        S         42602.022
         hepa-                               AS        42061.016
         titis      JHM-        VR1426       S         42529.960
         virus     thermo-                   AS        42136.047
                   stable
                   MHV-A59      VR764        S         42599.989
                                             AS        42064.089
          Rat       8190        VR1410       S         42544.967
                                             AS        42120.041
3       Infec-      Egg-         VR22        S         42530.984
         tious     adapted                   AS        42129.100
         bron-
        chitis
         virus
4        SARS       TOR2      University     S         42519.906
                                  of         AS        42144.026
                               Manitoba
                                ([sub-
                              section])
                   Urbani        CDC         S         42519.906
                               ([para-       AS        42144.026
                               graph])

                                                         Nsp14

          CoV                                       Calculated base
Group   species    Strain       Source     Strand    compositions

1       Canine      1-71        VR809        S      A33 G31 C19 T54
                                             AS     A54 G19 C31 T33
                  CCV-TN449     VR2068       S      A34 G30 C18 T55
                                             AS     A55 G18 C30 T34
        Feline     WSU 79-      VR-989       S      A33 G31 C18 T55
                    1683                     AS     A55 G18 C31 T33
                     DF2        VR2004       S      A33 G30 C19 T55
                                             AS     A55 G19 C30 T33
         Human      229E        VR740        S      A36 G30 C20 T51
         229E                                AS     A51 G20 C30 T36
                    229E         NHRC        S      A36 G30 C20 T51
                               ([double      AS     A51 G20 C30 T36
                               dagger])
2       Bovine      Calf        VR874        S      A38 G32 C15 T52
                  diarrheal                  AS     A52 G15 C32 T38
                    virus
         Human      OC43         NHRC        S      A38 G31 C15 T53
         OC43                  ([double      AS     A53 G15 C31 T38
                               dagger])
        Murine      MHV1        VR261        S      A37 G34 C18 T48
         hepa-                               AS     A48 G18 C34 T37
         titis      JHM-        VR1426       S      A34 G34 C21 T48
         virus     thermo-                   AS     A48 G21 C34 T34
                   stable
                   MHV-A59      VR764        S      A34 G35 C18 T50
                                             AS     A50 G18 C35 T34
          Rat       8190        VR1410       S      A34 G34 C20 T49
                                             AS     A49 G20 C34 T34
3       Infec-      Egg-         VR22        S      A33 G32 C17 T55
         tious     adapted                   AS     A55 G17 C32 T33
         bron-
        chitis
         virus
4        SARS       TOR2      University     S      A34 G33 C20 T50
                                  of         AS     A50 G20 C33 T34
                               Manitoba
                                ([sub-
                              section])
                   Urbani        CDC         S      A34 G33 C20 T50
                               ([para-       AS     A50 G20 C33 T34
                               graph])

* CoV, coronavirus; SARS, severe acute respiratory syndrome.

([dagger]) Exact mass measurements for the sense and antisense strands
of the dsDNA amplicon reported. Experimentally observed masses were
within [+ or -] 1 ppm of expected masses, based on sequence data for
each of the amplified DNA. Sense and antisense strand base compositions
reported.

([double dagger]) Clinical isolate obtained from Kathryn Holmes,
University of Colorado, via Kevin Russell, Naval Health Research
Center, San Diego.

([section]) Obtained from Heinz Feldmann, University of Manitoba.

([paragraph]) Obtained from Dean Erdman, Centers for Disease Control
and Prevention.

Table 2. PCR primer pairs used in this study *

Primer     Gene                         Genome
name       name      Product name     coordinates    Orientation

RdRp      ORF 1b     Nsp12-pp1ab      15146-15164       Sense
primer                  (RdRp)        15213-15233     Antisense
Nsp14     ORF 1b     Nsp14-pp1ab      19113-19138       Sense
primer              (nuclease ExoN    19225-19249     Antisense
                       homolog)

Primer    Product
name      length       (bpSequence (5' to >3')

RdRp         88         TAAGTTTTATGGCGGCTGG#
primer                 TTTAGGATAGTCCCAACCCAT#
Nsp14       137      TGTTTGTTTTGGAATTGTAATGTTGA#
primer               TGGAATGCATGCTTATTAACATACA#

Note: 5' propynyl-modified pyrimidine nucleotides are shown in #.

* All coordinates are based on SARS TOR2 genome (GenBank accession no.
NC_004718.3). 5' propynyl-modified pyrimidine nucleotides are shown in
bold. Each primer was designed to include a thymidine (T) nucleotide on
the 5' end to minimize addition of nontemplated adenosine (A) during
polymerase chain reaction (PCR) (data not shown). RdRp, RNA-dependent
RNA polymerase.


References

(1.) Poutanen, SM, Low DE, Henry B, Finkelstein S, Rose D, Green K, et al. Identification of severe acute respiratory syndrome Severe Acute Respiratory Syndrome (SARS) Definition

Severe acute respiratory syndrome (SARS) is the first emergent and highly transmissible viral disease to appear during the twenty-first century.
 in Canada. N Engl J Med. 2003;348:1995-2005.

(2.) Peiris JS, Lai S, Poon poon  
n.
Any of several trees of the genus Calophyllum, of southern Asia, having light hard wood used for masts and spars.



[Sinhalese p
 L, Guan guan: see curassow.  Y, Yam L, Lim W, et al. Coronavirus as a possible cause of severe acute respiratory syndrome. Lancet. 2003;361:1319-25.

(3.) Falsey AR, Walsh EE. Novel coronavirus and severe acute respiratory syndrome. Lancet. 2003;361:1312-3.

(4.) Ksiazek TG, Erdman D, Goldsmith CS, Zaki SR, Peret T, Emery S, et al. A novel coronavirus associated with severe acute respiratory syndrome. N Engl J Med. 2003;348:1953-66.

(5.) Schmidt TM, DeLong EF, Pace NR. Analysis of a marine picoplankton community by 16S rRNA gene cloning and sequencing. J Bacteriol. 1991;173:4371-8.

(6.) Kroes I, Lepp PW, Relman DA. Bacterial diversity within the human subgingival crevice crevice /crev·ice/ (krev´is) fissure.

gingival crevice  the space between the cervical enamel of a tooth and the overlying unattached gingiva.


crev·ice
n.
. Proc Natl Acad Sci U S A. 1999;96:14547-52.

(7.) Stephensen CB, Casebolt DB, Gangopadhyay NN. Phylogenetic phy·lo·ge·net·ic
adj.
1. Of or relating to phylogeny or phylogenetics.

2. Relating to or based on evolutionary development or history.
 analysis of a highly conserved region of the polymerase gene from 11 coronaviruses and development of a consensus polymerase chain reaction assay. Virus Res. 1999;60:181-9.

(8.) Oberste MS, Maher K, Pallansch MA. Molecular phylogeny Molecular phylogeny is the use of the structure of molecules to gain information on an organism's evolutionary relationships. The result of a molecular phylogenetic analysis is expressed in a so-called phylogenetic tree.

Every living organism contains DNA, RNA, and proteins.
 and proposed classification of the simian picornaviruses. J Virol. 2002;76:1244-51.

(9.) Mack DH, Sninsky JJ. A sensitive method for the identification of uncharacterized viruses related to known virus groups: hepadnavirus model system. Proc Natl Acad Sci U S A. 1988;85:6977-81.

(10.) Echavarria M, Forman M, Ticehurst J, Dumler A, Charache P. PCR method for detection of adenovirus adenovirus

Any of a group of spheroidal viruses, made up of DNA wrapped in a protein coat, that cause sore throat and fever in humans, hepatitis in dogs, and several diseases in fowl, mice, cattle, pigs, and monkeys.
 in urine of healthy and human immunodeficiency virus-infected individuals. J Clin Microbiol. 1998;36:3323-6.

(11.) Fout GS, Martinson BC, Moyer MW, Dahling DR. A multiplex reverse transcription-PCR method for detection of human enteric viruses in groundwater. Appl Environ Microbiol. 2003;69:3158-64.

(12.) Brito DA, Ramirez M, de Lencastre H. Serotyping Streptococcus pneumoniae Streptococcus pneu·mo·ni·ae
n.
Pneumococcus.


Streptococcus pneumoniae Microbiology A pathogenic streptococcus with 90 serotypes associated with pneumonia, bacteremia, meningitis Transmission Person to person Incidence
 by multiplex PCR. J Clin Microbiol. 2003;41:2378-84.

(13.) Wilson KH, Wilson WJ, Radosevich JL, DeSantis TZ, Viswanathan VS, Kuczmarski TA, et al. High-density microarray of small-subunit ribosomal DNA Not to be confused with Reformed Druids of North America.
Ribosomal DNA (rDNA) are sequences encoding ribosomal RNA. These sequences regulate amplification and transcription initiation and contain transcribed and nontranscribed spacer segments.
 probes. Appl Environ Microbiol. 2002;68:2535-41.

(14.) Wang D, Coscoy L, Zylberberg M, Avila PC, Boushey HA, Ganem D, et al. Microarray-based detection and genotyping of viral pathogens. Proc Natl Acad Sci U S A. 2002;99:15687-92.

(15.) Wang D, Urisman A, Liu YT, Springer M, Ksiazek TG, Erdman D, et al. Viral discovery and sequence recovery using DNA microarrays. PLoS Biology PLoS Biology is a scientific journal covering the full spectrum of the biological sciences that began operation on October 13, 2003. It was the first journal of the Public Library of Science (PLoS) a non-profit organization which releases scientific content under open . 2003; 1:257-60.

(16.) Sampath R, Ecker DJ. Novel biosensor A device that detects and analyzes body movement, temperature or fluids and turns it into an electronic signal. See lab on a chip and data glove.
Biosensor 
 for infectious disease diagnostics. In: Knobler SE, Mahmoud A, Lemon S, Mack A, Sivitz L, Oberholtzer K, editors. Learning from SARS: preparing for the next disease outbreak. Washington: The National Academies Press; 2004. p. 181-5.

(17.) Hofstadler SA, Sampath R, Blyn LB, Eshoo MW, Hall TA, Jiang Y, et al. TIGER: the universal biosensor. Int J Mass Spectrom. 2004. [cited 22 Dec 2004]. Available from http://www.sciencedirect.com/ science/article/B6VND-4F31R2G-1/2/96bc83d6dec9dfdd8429 ca692be52a08

(18.) Wagner RW, Matteucci MD, Lewis JG, Gutierrez AJ, Moulds C, Froehler BC. Antisense antisense, DNA or RNA manipulated in a laboratory so that its components (nucleotides) form a complementary copy of normal, or "sense," messenger RNA (mRNA; see nucleic acid).  gene inhibition by oligonucleotides containing C-5 propyne pyrimidines. Science. 1993;260:1510-3.

(19.) Barnes TW, Turner DH. Long-range cooperativity due to C5-propynylation of oligopyrimidines enhances specific recognition by uridine uridine /uri·dine/ (ur´i-den) a pyrimidine nucleoside containing uracil and ribose; it is a component of nucleic acid and its nucleosides are involved in the biosynthesis of polysaccharides. Symbol U.  of ribo-adenosine over ribo-guanosine. J Am Chem Soc. 2001;123:9186-7.

(20.) Snijder EJ, Bredenbeek PJ, Dobbe JC, Thiel V, Ziebuhr J, Poon LLM LLM
abbr.
Latin Legum Magister (Master of Laws)


LLM Master of Laws [Latin Legum Magister]

Noun 1.
, et al. Unique and conserved features of genome and proteome pro·te·ome
n.
The complete set of proteins that are produced by the genes of an organism.



proteome

the entire complement of proteins produced by a cell.
 of SARS-coronavirus, an early split-off from the coronavirus group 2 lineage. J Mol Biol. 2003;331:991-1004.

(21.) Jiang Y, Hofstadler SA. A highly efficient and automated method of purifying and desalting PCR products for analysis by electrospray ionization mass spectrometry. Anal Biochem. 2003;316:50-7.

(22.) Greig M, Griffey RH. Utility of organic bases for improved electrospray mass spectrometry of oligonucleotides. Rapid Commun Mass Spectrom. 1995;9:97-102.

(23.) Anderson GA, Bruce JE. ICR (Intelligent Character Recognition or Image Character Recognition) The machine recognition of hand-printed characters as well as machine printing that is difficult to recognize. 2LS. Richland (WA): Pacific Northwest National Laboratory The Pacific Northwest National Laboratory (PNNL) is one of nine United States Department of Energy (DOE) multiprogram national laboratories. The laboratory
PNNL is located in Richland, Washington, and operates a marine research facility in Sequim, Washington.
; 1995.

(24.) Senko MW, Beu SC, McLafferty FW. Determination of monoisotopic masses and ion populations for large biomolecules This page aims to list articles on Wikipedia that describe particular biomolecules or types of biomolecules.

This list is not necessarily complete or up to date - if you see an article that should be here but isn't (or one that shouldn't be here but is), please update the page
 from resolved isotopic distributions. J Am Soc Mass Spectrom. 1995;6:229-33.

(25.) Muddiman DC, Anderson GA, Hofstadler SA, Smith RD. Length and base composition of PCR-amplified nucleic acids Nucleic acids
The cellular molecules DNA and RNA that act as coded instructions for the production of proteins and are copied for transmission of inherited traits.
 using mass measurements from electrospray ionization mass spectrometry. Anal Chem. 1997;69:1543-9.

(26.) Towner JS, Rollin PE, Bausch DG, Sanchez A, Crary SM, Vincent M, et al. Rapid diagnosis of Ebola hemorrhagic fever Noun 1. Ebola hemorrhagic fever - a severe and often fatal disease in humans and nonhuman primates (monkeys and chimpanzees) caused by the Ebola virus; characterized by high fever and severe internal bleeding; can be spread from person to person; is largely limited to  by reverse transcription-PCR in an outbreak setting and assessment of patient viral load viral load
n.
The concentration of a virus, such as HIV, in the blood.


viral load,
n a measure of the number of virus particles present in the bloodstream, expressed as copies per milliliter.
 as a predictor of outcome. J Virol. 2004;78:4330-41.

(27.) Drosten C, Gunther S, Preiser W, Van Der Werf S, Brodt HR, Becker S, et al Identification of a novel coronavirus in patients with severe acute respiratory syndrome. N Engl J Med. 2003;348:1967-76.

(28.) Nitsche A, Schweiger B, Ellerbrok H, Niedrig M, Pauli G. SARS coronavirus The SARS coronavirus is the virus that causes severe acute respiratory syndrome (SARS).[1] On April 16 2003, following the outbreak of SARS in Asia and secondary cases elsewhere in the world, the World Health Organization (WHO) issued a press release stating that the  detection. Emerg Infect Dis. 2004; 10:1300-4.

(29.) Jenkins GM, Rambaut A, Pybus OG, Holmes EC. Rates of molecular evolution in RNA viruses: a quantitative phylogenetic analysis. J Mol Evol. 2002;54:156-65.

Dr. Sampath is the director of Genomics and Computational Biology Not to be confused with Biologically-inspired computing.
Computational biology is an interdisciplinary field that applies the techniques of computer science, applied mathematics, and statistics to address problems inspired by biology.
 at Ibis ibis (ī`bĭs), common name for wading birds with long, slender, decurved bills, found in the warmer regions of both hemispheres. The body is usually about 2 ft (61 cm) long. Most ibises nest in colonies.  Therapeutics, a division of Isis Pharmaceuticals, Inc. He leads Ibis' genomics efforts in microbial microbial

pertaining to or emanating from a microbe.


microbial digestion
the breakdown of organic material, especially feedstuffs, by microbial organisms.
 detection and diagnosis. His research interests include pathogen discovery, epidemiologic surveillance epidemiologic surveillance The ongoing, systematic collection, analysis, and interpretation of health data essential to planning, implementing, and evaluating public health practice, closely integrated with the timely dissemination of these data to those who need to know , and clinical infectious diagnostics.

Address for correspondence: Rangarajan Sampath, Ibis Therapeutics, 1891 Rutherford Ct, Carlsbad, CA 92008, USA; fax: 760-603-4653; email: rsampath@isisph.com

Rangarajan Sampath, * Steven A. Hofstadler, * Lawrence B. Blyn, * Mark W. Eshoo, * Thomas A. Hall, * Christian Massire, * Harold M. Levene, * James C. Hannis, * Patina M. Harrell, * Benjamin Neuman, ([dagger]) Michael J. Buchmeier, ([dagger]) Yun Jiang, * Raymond Ranken, * Jared J. Drader, * Vivek Samant, * Richard H. Griffey, * John A. McNeil, * Stanley T. Crooke, * and David J David J. Haskins (b. April 24, 1957, in Northampton, England) is a British alternative rock musician. He was the bassist for the seminal gothic rock band Bauhaus. Life and work . Ecker, *

* Ibis Therapeutics, Carlsbad, California Carlsbad is a coastal resort-town in northern San Diego County, California. According to the state Department of Finance, the city had a total population of 90,271 in 2003. , USA; and ([dagger]) The Scripps Research Institute, La Jolla La Jolla (lə hoi`yə), on the Pacific Ocean, S Calif., an uninc. district within the confines of San Diego; founded 1869. The beautiful ocean beaches, in particular La Jolla shores and Black's Beach, and sea-washed caves attract visitors and , California, USA
COPYRIGHT 2005 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2005, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Research
Author:Ecker, David J.
Publication:Emerging Infectious Diseases
Geographic Code:1USA
Date:Mar 1, 2005
Words:4896
Previous Article:Disease risks from foods, England and Wales, 1996-2000.(Research)
Next Article:Antimicrobial drug prescribing for pneumonia in ambulatory care.(Research)
Topics:



Related Articles
Role of China in the quest to define and control severe acute respiratory syndrome.(Perspectives)
Microbiologic characteristics, serologic responses, and clinical manifestations in severe acute respiratory syndrome, Taiwan (1).(Dispatches)
Longitudinally profiling neutralizing antibody response to SARS coronavirus with pseudotypes.(Research)
SARS-associated coronavirus transmitted from human to pig.(Dispatches)
SARS vaccine development.(SYNOPSIS)(severe acute respiratory syndrome)
SARs coronavirus detection methods.(DISPATCHES)(Severe acute respiratory syndrome)
Community epidemiology framework for classifying disease threats.(PERSPECTIVE)
Host range and emerging and reemerging pathogens.(RESEARCH)
Canine coronavirus highly pathogenic for dogs.(DISPATCHES)
Coronavirus HKU1 infection in the United States.

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles