Printer Friendly
The Free Library
5,676,108 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Rapid Molecular Genetic Subtyping of Serotype M1 Group A Streptococcus Strains.


Serotype serotype /se·ro·type/ (ser´o-tip) the type of a microorganism determined by its constituent antigens; a taxonomic subdivision based thereon.

se·ro·type
n.
See serovar.

v.
 M1 group A Streptococcus group A streptococcus
n.
A common but virulent streptococcus that kills the tissue it infects and produces toxins that trigger a form of shock that affects the vital organs.
, the most common cause of invasive disease in many case series, generally have resisted extensive molecular subtyping by standard techniques (e.g., multilocus enzyme electrophoresis, pulsed-field gel electrophoresis). We used automated sequencing of the sic gene encoding streptococcal streptococcal /strep·to·coc·cal/ (-kok´al) pertaining to or caused by a streptococcus.
Streptococcal (Streptococcus)
Pertaining to any of the Streptococcus bacteria.
 inhibitor of complement and of a region of the chromosome with direct repeat sequences to unambiguously differentiate 30 M1 isolates recovered from 28 patients in Texas with invasive disease episodes temporally clustered and thought to represent an outbreak. Sequencing of the emm gene was less useful for M1 strain differentiation, and restriction fragment length polymorphism restriction fragment length polymorphism
n. Abbr. RFLP
Intraspecies variations in the length of DNA fragments generated by the action of restriction enzymes and caused by mutations that alter the sites at which these enzymes act, changing
 analysis with IS 1548 or IS 1562 as Southern hybridization probes did not provide epidemiologically useful subtyping information. Sequence polymorphism polymorphism, of minerals, property of crystallizing in two or more distinct forms. Calcium carbonate is dimorphous (two forms), crystallizing as calcite or aragonite. Titanium dioxide is trimorphous; its three forms are brookite, anatase (or octahedrite), and rutile.  in the direct repeat region of the chromosome and IS 1548 profiling data support the hypothesis that M1 organisms have two main evolutionary lineages marked by the presence or absence of the spcA2 allele allele (əlēl`): see genetics.
allele

Any one of two or more alternative forms of a gene that may occur alternatively at a given site on a chromosome.
 encoding streptococcal pyrogenic pyrogenic /py·ro·gen·ic/ (pi?ro-jen´ik) febrifacient; causing fever.

py·ro·gen·ic or py·rog·e·nous
adj.
1. Producing or produced by fever.

2.
 exotoxin exotoxin /exo·tox·in/ (ek´so-tok?sin) a potent toxin formed and excreted by the bacterial cell, and free in the surrounding medium.  A2.

Molecular genetic approaches that differentiate isolates of a pathogenic microbial microbial

pertaining to or emanating from a microbe.


microbial digestion
the breakdown of organic material, especially feedstuffs, by microbial organisms.
 species have revolutionized contemporary epidemiologic investigations of putative disease outbreaks. The human gram-positive bacterium group A Streptococcus (GAS) has more than 80 M-protein serotypes, but isolates expressing the M1 serotype are disproportionately represented among invasive disease episodes in most case series (1). M1 organisms also commonly cause pharyngitis pharyngitis

Inflammation and infection (usually bacterial or viral) of the pharynx. Symptoms include pain (sore throat, worse on swallowing), redness, swollen lymph nodes, and fever.
. For reasons that are unknown, M1 isolates and organisms expressing other M serologic se·rol·o·gy  
n. pl. se·rol·o·gies
1. The science that deals with the properties and reactions of serums, especially blood serum.

2.
 types can undergo rapid temporal variation in disease frequency and severity (1). Serotype M1 isolates have been studied by several molecular typing approaches, including multilocus enzyme electrophoresis; pulsed-field gel electrophoresis; rRNA gene polymorphism typing (ribotyping); random amplified polymorphic polymorphic - polymorphism  DNA analysis DNA analysis Any technique used to analyze genes and DNA. See Chromosome walking, DNA fingerprinting, Footprinting, In situ hybridization, Jeffries' probe, Jumping libraries, PCR, RFLP analysis, Southern blot hybridization. ; and sequencing of the genes encoding streptokinase streptokinase /strep·to·ki·nase/ (-ki´nas) a protein produced by ß, which produces fibrinolysis by binding to plasminogen and causing its conversion to plasmin; used as a thrombolytic agent. , C5a peptidase peptidase /pep·ti·dase/ (pep´ti-das) any of a subclass of proteolytic enzymes that catalyze the hydrolysis of peptide linkages; it comprises the exopeptidases and endopeptidases.

pep·ti·dase
n.
, M protein, hyaluronidase Hyaluronidase

Any one of a family of enzymes, also known as hyaluronate lyases or spreading factors, produced by mammals, reptiles, insects, and bacteria, which catalyze the breakdown of hyaluronic acid.
, and pyrogenic exotoxin A, B, and C (1-5). The common theme of these analyses is that most M1 isolates cultured from patients with invasive disease episodes are closely allied in overall chromosomal relationship as a consequence of sharing a :recent common ancestor (1.3.5). Lack of readily detectable chromosomal variation has limited insights on the molecular origin of new virulent strains, velocity of strain spread in human populations, and association of genetic subtypes with certain clinical syndromes, including necrotizing fasciitis necrotizing fasciitis
n.
Tissue death such as that associated with group A streptococcus infection.


Necrotizing fasciitis 
 and acute rheumatic fever rheumatic fever (rmăt`ĭk), systemic inflammatory disease, extremely variable in its manifestation, severity, duration, and aftereffects. .

Recently, Akesson et al. (6) identified a GAS extracellular protein made by M1 strains that inhibits human complement. This streptococcal inhibitor of complement (Sic) protein is incorporated into the membrane-attack complex (C5b-C9) and inhibits target cell lysis lysis /ly·sis/ (li´sis)
1. destruction or decomposition, as of a cell or other substance, under influence of a specific agent.

2. mobilization of an organ by division of restraining adhesions.

3.
 by an undetermined mechanism. Analysis of molecular diversity among 16 M1 GAS isolates from patients with pharyngitis identified seven alleles of the sic gene (7). The high level of sic polymorphism was unanticipated, given that other methods of molecular analysis had failed to identify substantial variation among M1 isolates (1-5). Subsequently, Stoekbauer et al. (8) analyzed 165 M1 isolates from diverse localities, identified 62 alleles, and documented a uniquely high level of allelic al·lele  
n.
One member of a pair or series of genes that occupy a specific position on a specific chromosome.



[German Allel, short for Allelomorph, allelomorph, from English
 variation in this gene. The molecular features of sic variation indicated that structural change in Sic is mediated by natural selection (8). Moreover, study of 70 M1 isolates from two temporally distinct epidemics of streptococcal infections Streptococcal Infections Definition

Streptococcal (strep) infections are communicable diseases that develop when bacteria normally found on the skin or in the intestines, mouth, nose, reproductive tract, or urinary tract invade other parts of the body
 in the former East Germany suggested that variation in sic contributed to fluctuations in GAS disease frequency and severity (8).

The observation that the polymorphism in the sic gene greatly exceeded that for all other genes examined in serotype M1 isolates suggested that sic sequencing could be used as a rapid strategy to differentiate organisms thought to be epidemiologically linked. A recent statistically significant increase in cases of invasive GAS in Texas presented an opportunity to test this hypothesis. We also tested whether molecular variation in a region of the chromosome with multiple direct repeat (DR) nucleotide sequences and restriction fragment length polymorphism (RFLP RFLP
abbr.
restriction fragment length polymorphism



RFLP

restriction fragment length polymorphism.

RFLP 
) analysis with insertion elements IS1548 (9) and IS1562 (10) would differentiate M1 isolates.

Brief Overview of the GAS Epidemiology

Statistics gathered by the Texas Department of Health indicated that from December 1, 1997, through March 5, 1998, 117 invasive episodes of GAS (and 26 deaths) had occurred statewide. Sixty of these cases and 14 deaths were in central Texas (population 1.4 million). Concern was raised by community physicians, lay individuals, and the media that an unusually virulent strain was causing a disease outbreak. (A complete description of the epidemiology of this outbreak will be presented elsewhere.) For molecular analysis of the GAS causing recent cases, 100 isolates were sent to the laboratory of J.M.M. at Baylor College of Medicine Baylor College of Medicine is a private medical school located in Houston, Texas, USA on the grounds of the Texas Medical Center. It has been consistently rated the top medical school in Texas and among the best in the United States. , Houston, TX. On receipt, the bacteria were checked for purity by visual inspection and were confirmed to contain beta-hemolytic organisms with a colony morphology consistent with GAS. Chromosomal DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 was isolated as described (5).

Sequence Analysis of emm

To determine whether one or a few unusually virulent strains might account for most of the invasive episodes, we sequenced the hypervariable part of the emm gene encoding M-type specificity (5,11). After the sequence data were edited electronically, they were used to search an emm database maintained in the laboratory that contains at least one sequence of all known M-protein serotypes and provisional serotypes (11). The database also contains 33 emm1 allelic variants identified among serotype M1 organisms from global sources (1,5,12) (Figure 1).

[Figure 1 ILLUSTRATION OMITTED]

The most common M type identified was M1 (n = 30 isolates) (Table). Five emm1 alleles were identified in the 30 M1 isolates, including four (emm1.13, emm1.18, emm1.19, and emm1.24) not previously described (Figure 1). Twenty-three Texas isolates had allele emm 1.0, the most common emm1 allele in M1 isolates globally (5). Three isolates had allele emm1.19, two organisms had allele emm1.24, and one isolate each had allele emm1.13 and emm1.18 (Table). Compared with the emm1.0 allele encoding variant M1.0, each of these alleles is characterized by single nucleotide changes resulting characterized by single nucleotide changes resulting in single amino acid amino acid (əmē`nō), any one of a class of simple organic compounds containing carbon, hydrogen, oxygen, nitrogen, and in certain cases sulfur. These compounds are the building blocks of proteins.  substitutions in the resulting M1 protein (Figure 1). The additional 70 isolates were a heterogeneous array of M types, including M3, M4, M5, M6, M12, M18, and many others. A more detailed description of the bacteriologic bac·te·ri·ol·o·gy  
n.
The study of bacteria, especially in relation to medicine and agriculture.



bac·te
 features will be presented elsewhere.

Table. Characteristics of serotype M1 Group A Streptococcus isolates analyzed
                                         DR(c)
MGAS                    sic      emml    PCR(d)
no.(a)    TDH no.(b)   allele   allele    (bp)

6151      BE8-776      1.01     1.0       372
6168      BE-98-743    1.01     1.0       306
6184      BE8-873      1.01     1.0       306
6199      BE8-917      1.01     1.19      306
6262      BE8-1085     1.01     1.19      306
6264      BE8-1087     1.01     1.19      306
6181      BE-98-764    1.02     1.0       240
6293      BE8-1339     1.02     1.0       306
6294      BE8-1340     1.02     1.0       306
6140      BE8-629      1.13     1.0       240
6200      BE8-918      1.13     1.0       240
6201      BE8-919      1.13     1.0       240
6281      BE8-1149     1.13     1.24      306
6137      BE8-563      1.32     1.0       306
6148      BE8-773      1.32     1.0       306
6249      BE8-929      1.32     1.0       306
6172      BE-98-751    1.34     1.0       306
5997      BE8-191      1.36     1.0       240
6135      BE8-548      1.36     1.0       240
6254      BE8-1021     1.36     1.24      306
6189      BE8-88       1.66     1.13      306
5999      BE8-208      1.99     1.0       306
6003      BE8-322      1.100    1.0       240
6251      BE8-1000     1.100    1.0       240
6006      BE8-369      1.101    1.0       306
6138      BE8-566      1.118    1.0       240
6150      BE8-775      1.119    1.0       306
6154      BE8-792      1.120    1.18      240
6272      BE8-1111     1.179    1.0       306
6299      BE8-1380     1.180    1.0       240
2221      NA           1.01     1.0       306
5305      NA           1.01     1.0       306
5809      NA           1.01     1.0       305
2139      NA           1.02     1.0       306
2350      NA           1.09     1.0       306
1272      NA           1.35     1.0       306
5297      NA           1.121    1.0       240
279       NA           1.08     1.3       570
1632      NA           1.08     1.3       570
1653      NA           1.19     1.3       570
326       NA           1.20     1.3       570
570       NA           1.21     1.3       570
1642      NA           1.24     1.3       504
6708(g)   NA           1.225    1.6       504

           DR se-
MGAS       quence    speA    IS1548
no.(a)      type    PCR(e)    type

6151        4.0      pos      1.0
6168        3.0      pos      1.0
6184       NS(f)     pos      1.0
6199         NS      pos      1.0
6262         NS      pos      1.0
6264        3.0      pos      1.0
6181         NS      pos      1.0
6293         NS      pos      1.0
6294         NS      pos      1.4
6140         NS      pos      1.0
6200         NS      pos      1.0
6201         NS      pos      1.0
6281         NS      pos      1.3
6137        3.0      pos      1.0
6148         NS      pos      1.0
6249         NS      pos      1.0
6172         NS      pos      1.0
5997         NS      pos      1.0
6135        2.2      pos      1.0
6254         NS      pos      1.0
6189         NS      pos      1.0
5999        3.0      pos      1.0
6003         NS      pos      1.0
6251        2.1      pos      1.0
6006        3.0      pos      1.0
6138        2.2      pos      1.0
6150        3.0      pos      1.0
6154        2.1      pos      1.0
6272         NS      pos      1.0
6299        2.0      pos      1.0
2221         NS      pos      1.0
5305        3.0      pos      1.0
5809        3.0      pos      1.0
2139        3.0      pos      1.0
2350        3.0      pos      1.0
1272         NS      pos      1.5
5297        2.0      pos      1.0
279         7.0      neg      1.6
1632        7.0      neg      1.6
1653        7.0      neg      1.6
326         7.0      neg      1.6
570         7.0      neg      1.8
1642        6.1      neg      1.6
6708(g)     6.0      neg      1.7


(a) MGAS, Musser group A Streptococcus strain number. All isolates had no known direct epidemiologic connection except MGAS 6199, 6264, and 6272 (associated household cases); MGAS 6140, 6200, and 6201 (blood and cerebrospinal fluid cerebrospinal fluid (CSF)

Clear, colourless liquid that surrounds the brain and spinal cord and fills the spaces in them. It helps support the brain, acts as a lubricant, maintains pressure in the skull, and cushions shocks.
 cultures of same patient); and MGAS 6293 and 6294 (mother-neonate paired isolates).

(b) TDH TDH Texas Department of Health
TDH Total Dynamic Head
TDH Tennessee Department of Health
TDH Table D’ Hote (French: hosts table; menu )
TDH Tall Dark and Handsome
TDH Total Discharge Head
TDH Total Developed Head
, Texas Department of Health strain number; NA, not applicable (control isolate).

(c) DR, direct repeat.

(d) PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
, polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is .

(e) pos, PCR-positive for speA; neg, PCR-negative for speA. The speA gene in MGAS 1272, 6135, 6137, 6138, 6150, 6151, 6154, 6168, 6251, 6264, 6272, and 6299 was sequenced and identified as allele speA2.

(f) NS, not sequenced.

(g) MGAS 6708 is also known as SF370. The genome of this organism is being sequenced at the University of Oklahoma University of Oklahoma, abbreviated OU, is a coeducational public research university located in the U.S. state of Oklahoma. Founded in 1890, it existed in Oklahoma Territory near Indian Territory 17 years before the two became the state of Oklahoma. .

Analysis of speA Encoding Pyrogenic Exotoxin A

Because M1 isolates were a prominent cause of the invasive disease episodes, we sought to determine the extent of genotypic heterogeneity among the 30 M1 GAS isolates. First, polymerase chain reaction (PCR) was used to test whether the organisms possessed the speA gene encoding pyrogenic exotoxin A (scarlet fever scarlet fever or scarlatina, an acute, communicable infection, caused by group A hemolytic streptococcal bacteria (see streptococcus) that produce an erythrogenic toxin.  toxin) (3,13). Most contemporary M1 isolates cultured from patients with invasive disease have this gene (1,3-5), but some lack it because speA is bacteriophage encoded (13). Possession of speA is therefore a variable trait among M1 organisms. All 30 M1 isolates had the speA gene, and sequence analysis of 11 random isolates found that all had allele speA2 (14). Previous study of the speA gene in several hundred contemporary M1 strains showed that all organisms had the speA2 allele (1,14).

Sequence Analysis of sic

Recent molecular genetic studies have documented that sic is a uniquely hypervariable gene among M1 GAS strains (7,8). Our sic database consists of 252 distinct alleles identified by sequence analysis of ~1,200 M1 isolates from worldwide sources and cultured from patients with a large array of GAS diseases, including pharyngitis and invasive episodes (7;8; unpub. data), sic allelic variation has not been identified during in vitro in vitro /in vi·tro/ (in ve´tro) [L.] within a glass; observable in a test tube; in an artificial environment.

in vi·tro
adj.
In an artificial environment outside a living organism.
 laboratory passage, nor has variation been detected among strains that are epidemiologically associated (8). These molecular features suggest that automated sequencing of sic may be a convenient method for identifying M1 genetic subtypes and inferring epidemiologic relationships in potential outbreaks. To test this idea, we sequenced the sic gene in the 30 M1 isolates and identified 15 sic alleles that differed from one another by at least one nucleotide (Figure 2). Seven of the 15 alleles were not found among the ~1,200 M1 isolates previously characterized for sic variation. Eight new nucleotide substitutions were identified in eight codons, and one codon codon: see nucleic acid.  had a new dinucleotide dinucleotide /di·nu·cleo·tide/ (di-nldbomack´le-o-tid?) one of the cleavage products into which a polynucleotide may be split, itself composed of two mononucleotides.

di·nu·cle·o·tide
n.
 change; these changes would result in nine amino acid substitutions in the expressed Sic proteins. As observed in earlier analyses (7,8), the amino-terminal half of the Sic protein had many insertions and deletions, all in frame (Figure 2).

[Figure 2 ILLUSTRATION OMITTED]

RFLP Analysis with Insertion Sequences IS1548 and IS1562

I81548, a recently described insertion sequence, has been reported to be polymorphic in copy number and location in the chromosome of group A and group B streptococci Streptococcus (plural, streptococci)
A genus of spherical-shaped anaerobic bacteria occurring in pairs or chains. Sydenham's chorea is considered a complication of a streptococcal throat infection.
 (9). IS1562 is an insertion sequence located in the Mga regulon between the sic gene and scpA gene encoding C5a peptidase in some GAS (10). Relatively few GAS strains have been analyzed by RFLP profiling with these elements, and their ability to differentiate among isolates expressing the same M type has not been assessed. Since insertion sequence profiling has helped elucidate transmission dynamics and evolutionary relationships of Mycobacterium tuberculosis Mycobacterium tuberculosis
n.
Tubercic bacillus.


Mycobacterium tuberculosis
 (15), Bordetella pertussis Bordetella pertussis Microbiology A small, aerobic, gram-negative bacillus, causative organism of whooping cough; B pertussis produces various toxins including a dermonecrotizing toxin, an adenyl cyclase, an endotoxin and pertussis toxin, as well as surface  (16), Streptococcus pneumoniae Streptococcus pneu·mo·ni·ae
n.
Pneumococcus.


Streptococcus pneumoniae Microbiology A pathogenic streptococcus with 90 serotypes associated with pneumonia, bacteremia, meningitis Transmission Person to person Incidence
 (17), Escherichia coli Escherichia coli (ĕsh'ərĭk`ēə kō`lī), common bacterium that normally inhabits the intestinal tracts of humans and animals, but can cause infection in other parts of the body, especially the urinary tract.  (18), and Salmonella Enteritidis Salmonella en·ter·it·i·dis
n.
Gärtner's bacillus.
 (19), we tested the hypothesis that IS1548 or IS1562 subtyping would provide additional epidemiologically informative data regarding genetic diversity among M1 isolates.

To determine whether the IS1548 element was present in M1 organisms in our sample, PCR was performed on genomic DNA from 10 random isolates by using the oligonucleotides (forward) 5'TGCCGTTCATCAACTGATTTCAGTGG-3' and (reverse 5'-CGACGATAACTGAGGTCTTTTTT AGGAAAT-3'(9). A PCR product of the anticipated size of ~1 kb was obtained from all organisms, a result indicating that the isolates had this element or a close relative. The PCR-amplified fragment was subsequently used as a probe for RFLP analysis by Southern blotting after EcoNI digestion and electrophoretic separation of chromosomal DNA fragments. The data were analyzed with a Bioimage Analyzer system interfaced with a Sun Sparcstation. Four M1 isolates had the same 6-band IS1548 RFLP pattern, which was distinct from the 3-band pattern obtained from three random serotype M3 isolates (Figure 3A). Twenty-eight of the 30 M1 isolates studied had the same IS1548 pattern (Figure 3B and data not shown). The IS1548 RFLP patterns of the two other isolates were single-band variants of the common M1 pattern, both characterized by the addition of one hybridizing band (Figure 3B). One of the isolates (MGAS 6294) with a variant IS1548 pattern was recovered from the blood of a neonate neonate /neo·nate/ (ne´o-nat) newborn infant.

ne·o·nate
n.
A neonatal infant.



neonate

a newborn animal.
 born to a woman with GAS sepsis. The isolate (MGAS 6293) from the blood of the infected mother had the common IS1548 pattern.

[Figure 3 ILLUSTRATION OMITTED]

To identify other IS1548 RFLP patterns in M1 GAS organisms, we analyzed 14 non-Texas control organisms, we analyzed 14 non-Texas control isolates. These 14 M1 isolates were selected for analysis because they have been well characterized by several molecular techniques (5). The isolates also have many different sic alleles and include representatives of two major genetic subclones of M1 organisms (5). IS1548 profiling of this group identified the common six-band pattern and also found five organisms with a distinct subtype (programming) subtype - If S is a subtype of T then an expression of type S may be used anywhere that one of type T can and an implicit type conversion will be applied to convert it to type T.  with four bands (Figure 3C). All organisms with this profile were speA-negative. Interestingly, MGAS6708 (SF370), the M1 strain whose genome is being sequenced (20), had a unique five-band IS1548 fingerprint (Figure 3C). The IS1548 profile for this strain was very, similar to the four-copy pattern characteristic of most of the speA negative organisms.

next used PCR to determine whether IS1562 was present in the 30 M1 organisms from Texas and in 11 of the 14 non-Texas isolates by using oligonucleotide primers 3244 and 3267, as described by Berge et al. (10). A PCR product of the expected size of ~1 kb was obtained from all isolates. The ~1-kb fragment was used to reprobe the nylon membranes used for IS1548 RFLP analysis. The results showed that all M1 isolates tested had the identical or closely similar RFLP characterized by one copy of IS1562 (data not shown).

PCR and Sequence Analysis of a Polymorphic Direct Repeat (DR) Chromosomal Region chromosomal region
n.
The part of a chromosome defined either by anatomical details, especially by banding, or by its linkage groups.


Several years ago Groenen et al. (21) characterized an unusual region of the M. tuberculosis M. tuberculosis,
n the bacterium responsible for tuberculosis, generally a respiratory infection in man; nonrespiratory tuberculosis is considered an indicator disease for AIDS. See also tuberculosis.
 chromosome that contains up to approximately 40 copies of a 36-bp DR sequence interspersed with unique-sequence spacer regions 35 bp to 41 bp in length. Subsequent analysis of this DR region in hundreds of M. tuberculosis isolates by a method referred to as spacer oligotyping (spoligotyping) has identified large numbers of distinct subtypes of this pathogen (22), indicating that the DR region is highly polymorphic, even among isolates closely related in overall chromosomal character (23). We examined the M1 OAS OAS

See: Option adjusted spread
 genome database maintained by the University of Oklahoma Advanced Center for Genome Technology and identified a region of the GAS chromosome located on contig 208 (database as of February 22, 1999) that consists of seven DR elements separated by six unique 30-bp spacer regions. This area of the M1 chromosome is referred to as a DR region on the basis of its shared structural features with the M. tuberculosis DR region.

To test the hypothesis that the DR region is polymorphic among M1 GAS isolates, we analyzed the 14 control isolates by PCR with primers that flank this region (DR003, 5'GGGCTTTTCAAGACTGAAGTCTAGCTG-3' and DR004, 5'TCCGACTGCTGGTATTAACCCTC TT-3'). Four sizes of PCR products were identified (data not shown). Six of seven isolates previously identified as RFLP type 1a (speA-positive, containing allele emm1.0) had an apparently identical size PCR product of ~300 bp. A PCR product of ~240 bp was identified in the remaining isolate. Two sizes of PCR products (~500 bp and ~570 bp) were also identified in the six organisms with RFLP type 1k (speA-negative, allele emm1.3). Hence, the PCR results indicated that size variation was present in the GAS DR region in M1 organisms and showed that isolates of the RFLP types la and 1k categories did not share PCR fragment sizes.

To examine nucleotide variation in this chromosomal region, we sequenced the PCR products obtained from 12 of these control M1 isolates, including 5 with the ~240-bp or-300-bp PCR product and 7 organisms with either the ~500-bp or ~570-bp PCR product. The one organism with the ~240bp PCR product, characterized by two identical DR elements and two nonidentical non·i·den·ti·cal
adj.
1. Not being the same; different.

2. Fraternal, as of twins.
 spacer sequences, is arbitrarily designated DR type 2.0 (Figure 4). Three of the four organisms with the ~300-bp PCR product had identical DR-region sequences defined by the presence of three identical DR elements and three nonidentical spacer sequences (Figure 4B). This molecular arrangement was designated DR type 3.0 (Figure 4C). The DR element of the fourth isolate differed from the other three by the absence of 1 base in the second spacer region and is designated DR type 3.01 (Figure 4C). Consistent with the difference in PCR fragment size, the sequences of the DR region in the seven other organisms were distinct from the DR type 3.0 sequence. Five of these seven isolates had an identical DR-region sequence that was characterized by seven spacer regions (designated DR type 7.0). Two organisms lacked one of the spacer regions present in the DR type 7.0 strains; these molecular variants were designated DR types 6.0 and 6.1 (Figure 4C).

[Figure 4 ILLUSTRATION OMITTED]

We next analyzed the 30 M1 Texas isolates by PCR of the DR region and obtained three PCR fragment sizes: products of ~240 bp (n = 11 isolates), ~300 bp n = 18 isolates), and ~370 bp (n = 1 isolate). We sequenced the PCR products from 12 organisms selected to represent an array of DR PCR fragment sizes and emm and sic alleles. Two additional sequences (designated DR types 2.1 and 2.2) were identified among the five isolates with the DR region PCR fragment size of ~240 bp. All six isolates with the ~300-bp PCR product had the identical sequence (DR type 3.0). The one isolate with the ~370-bp PCR product had a unique sequence (DR type 4.0) with four spacer regions (Figure 4). The results showed that the DR region had more molecular variation than emm. However, the level of allelic variation in sic exceeded that found in either emm or the DR region.

Conclusions

Our data underscore the importance of molecular typing techniques in rapidly providing information about the epidemiology of OAS infections (24). The emm sequence data indicated that a heterogeneous array of GAS M types was present in the sample of 100 GAS isolates; thus, we could rapidly rule out the notion that the invasive cases had been caused by one or a few distinct GAS strains. Moreover, molecular analysis of several other polymorphic loci loci

[L.] plural of locus.

loci Plural of locus, see there
, including automated DNA sequencing of sic and a chromosomal region with multiple DR sequences, showed that M1 organisms, the most abundant serotype in the sample, had substantial levels of genetic diversity. Of the molecular techniques used in this analysis, sequencing the sic gene was the most effective for differentiating among M1 isolates because it identified the most variants. RFLP-based typing with IS1548 and IS1562 failed to provide extensive, or even adequate, resolving power resolving power: see telescope.
Resolving power (optics)

A quantitative measure of the ability of an optical instrument to produce separable images.
 among me M1 organisms for epidemiologic purposes. Moreover, the variation in the IS1548 RFLP profile we detected in two isolates (MGAS 6293 and MGAS 6294) from a woman with puerperal puerperal /pu·er·per·al/ (-al) pertaining to a puerpera or to the puerperium.

pu·er·per·al
adj.
 sepsis and the blood of her newborn child suggests that IS 1548 can be mobile in host-pathogen interactions. Instability in insertion sequence profiles has also been reported for IS 6110, an element commonly used for molecular subtyping of M. tuberculosis (25).

Although sequence analysis of emm and the DR region provided some useful molecular subtyping data for M 1 strains, the level of polymorphism at these loci was less than in sic. A rapid PCR-based subtyping system to index polymorphism in the DR region could be formulated for M 1 GAS that would be similar to the method available for M. tuberculosis. However, this approach would be less useful for M1 GAS than M. tuberculosis because in the latter organism 43 distinct spacer regions have been described. Hence, the number of polymorphic markers is considerably greater than in M 1 GAS, in which thus far only 13 spacer regions have been found (unpub. data).

Our work, recently reported results (7,8), and unpublished data obtained from ongoing analysis of sic polymorphism in large samples obtained from population-based studies demonstrate four emerging themes in the molecular epidemiology molecular epidemiology Molecular medicine An evolving field that combines the tools of standard epidemiology–case studies, questionnaires and monitoring of exposure to external factors with the tools of molecular biology–eg, restriction endonucleases,  and evolutionary biology of M1 organisms. First, several sic variants are dispersed over broad geographic areas; some have achieved intercontinental distribution. For example, M1 strains with the sic1.01 allele have been identified in 14 countries. This allele might be widely disseminated because it is the ancestral condition in M1 organisms or otherwise has had a long-standing association with the M1 serotype. Another plausible hypothesis to explain its widespread dissemination is that expression of Sic1.01 protein bestows greater fitness than do other Sic variants. A third possibility is that the Sic1.01 variant marks an M1 subclone with an unusual propensity to survive and spread. In this regard, we note that virtually all isolates with the sic1.01 allele are speA-positive. GAS isolates with the speA gene are statistically overrepresented o·ver·rep·re·sent·ed  
adj.
Represented in excessive or disproportionately large numbers: "Some groups, and most notably some races, may be overrepresented and others may be underrepresented" 
 among organisms recovered from children with pharyngitis who have not been cured by oral antibiotic therapy (26). Bacterial survival despite appropriate antibiotic therapy would likely enhance spread of the organism to new hosts and, hence, assist widespread dispersal. We also note that speA-positive M1 isolates are internalized efficiently by human respiratory tract respiratory tract
n.
The air passages from the nose to the pulmonary alveoli, including the pharynx, larynx, trachea, and bronchi.


Respiratory tract 
 epithelial cells Epithelial cells
Cells that form a thin surface coating on the outside of a body structure.

Mentioned in: Corneal Transplantation
 grown in culture (27.28), a process that could provide access to a protective niche that enhances survival capability.

A second important theme is that many sic alleles are confined to local geographic areas (e.g., individual countries or communities). For example, seven of the sic alleles identified in this study were unique to the Texas M1 isolates. Several unique sic alleles also were found among organisms cultured from patients in Mexico (7) and the former East Germany (8). Because many sic alleles can be readily linked with one another by a single molecular event such as a nucleotide substitution or one insertion or deletion, some of the variants likely arise rapidly in local areas. Their absence in other regions is explained by lack of sufficient elapsed time required for widespread dispersal. Recent data obtained from study of M1 isolates recovered from population-based surveys in Finland (29), Ontario, Canada (30), and Atlanta, Georgia (31) strongly support this explanation (unpub. data).

The third theme is the remarkable polymorphism in the sic gene. Stockbauer et al. (8) reported that virtually all changes in the sic gene result in structural changes in the Sic protein and concluded that positive Darwinian selection is mediating Sic variation. Our study confirmed these observations. For example, all 10 new nucleotide changes identified would result in amino acid substitutions in Sic, and all insertions and deletions were in frame. Moreover, most of the amino acid changes were radical replacements, that is, those producing charge changes or polar-nonpolar substitutions. These types of amino acid replacements commonly result in functional differences in the resulting proteins and are a hallmark of positive selection (32).

Last, accumulating data suggest the existence of two genetically divergent M1 subpopulations, which can be thought of as two evolutionarily distinct lineages. Our study found that organisms with the speA gene and chromosomal PFGE PFGE Pulsed-Field Gel Electrophoresis  type la (5) have shorter DR-region sequences and an IS 1548 profile characterized by six hybridizing bands. In contrast, organisms that are speA-negative usually have PFGE type 1k (5), longer DR sequences, and an IS 1548 fingerprint with four bands. In addition, we will show elsewhere that the two M1 lineages each have distinct families of sic alleles. Together, the data indicate that sufficient time has elapsed e·lapse  
intr.v. e·lapsed, e·laps·ing, e·laps·es
To slip by; pass: Weeks elapsed before we could start renovating.

n.
 since a shared common ancestor for members of the two lineages to have diverged at many chromosomal loci. The data also indicate that transduction transduction, in genetics: see recombination.
Transduction (bacteria)

A mechanism for the transfer of genetic material between cells.
 of the speA2 allele between members of the two lineages is apparently rare in natural populations of GAS (5,14). As more comparative analyses are conducted, additional genetic differences will probably be identified between isolates of the two lineages.

In summary, automated sequence analysis of sic and a region of the chromosome with DR sequences permitted rapid and unambiguous differentiation among serotype M1 isolates during a period of a significant increase in the number of invasive disease cases. Genetic analysis of these polymorphic markers permitted us to rapidly rule out the idea that a single unusually virulent strain of M1 GAS was responsible. The subtyping methods described in this work will assist other outbreak investigations and studies designed to understand the molecular basis of temporal variation in disease frequency and severity of infections caused by M1 GAS isolates.

Acknowledgments

We thank C. Stager, S. Rossman, K. Krause, and C. Baker for generously providing strains.

This work was supported by Public Health Service Grant A1-33119 to J.M.M.

Dr. Hoe is a research associate in the Institute for the Study of Human Bacterial Pathogenesis, Baylor College of Medicine. Her main interests are in the areas of molecular epidemiology and bacterial pathogenesis.

Address for correspondence: James M. Musser, Institute for the Study of Human Bacterial Pathogenesis, Department of Pathology, Baylor College of Medicine, One Baylor Plaza, Houston, Texas 77030, USA; fax: 713-798-4595; e-mail: jmusser@bcm.tmc.edu.

References

(1.) Musser JM, Krause RM. The revival of group A streptococcal diseases, with a commentary on staphylococcal staphylococcal

pertaining to Staphylococcus spp.


staphylococcal clumping test
used as a means of measuring the quantity of fibrinogen-split products in a sample of blood.
 toxic shock syndrome toxic shock syndrome (TSS). acute, sometimes fatal, disease characterized by high fever, nausea, diarrhea, lethargy, blotchy rash, and sudden drop in blood pressure. It is caused by Staphylococcus aureus, an exotoxin-producing bacteria (see toxin). . In: Krause RM, editor. Emerging infections. San Diego: Academic Press; 1998. p. 185-218.

(2.) Martin DR, Single LA. Molecular epidemiology of group A streptococcus M type 1 infections. J Infect Dis 1993;167:1112-7.

(3.) Musser JM, Hauser JM, Kim MH, Schlievert PM, Nelson K. Selander RK. Streptococcus pyogenes Streptococcus py·og·e·nes
n.
A bacterium that causes the formation of pus or of fatal septicemias.


Streptococcus pyogenes
A common bacterium that causes strep throat and can also cause tonsillitis.
 causing toxic-shock-like syndrome and other invasive diseases: clonal diversity and pyrogenic exotoxin expression. Proc Natl Acad Sci U S A 1991;88:2668-72.

(4.) Norgren M, Norrby A, Holm SE. Genetic diversity :in T1M1 group A streptococci in relation to clinical outcome of infection. J Infect Dis 1992;166:1014-20.

(5.) Musser JM, Kapur V, Szeto J, Pan X, Swanson DS, Martin DR. Genetic diversity and relationships among Streptococcus pyogenes strains expressing serotype M1 protein: recent intercontinental spread of a subclone causing episodes of invasive disease. Infect Immun 1995 ;63:994-1003.

(6.) Akesson P, Sjoholm AG, Bjorck L. Protein SIC, a novel extracellular protein of Streptococcux pyogenes interfering with complement function. J Biol Chem 1996;271:1081-8.

(7.) Perea Mejia LM, Stockbauer KE, Pan X, Cravioto A, Musser JM. Characterization of group A Streptococcus strains recovered from Mexican children with pharyngitis by automated DNA sequencing of virulence-related genes: unexpectedly large variation in the gene (sic) encoding a complement inhibiting protein. J Clin Microbiol 1997;35:3220-4.

(8.) Stockbauer KE, Grigsby D, Pan X, Fu Y-X, Perea Mejia LM, Cravioto A, et al. Hypervariability generated by natural selection in an extracellular complement-inhibiting protein of serotype M1 strains of group A Streptococcus. Proc Natl Acad Sci U S A 1998;95:3128-33.

(9.) Granlund M, Oberg L, Sellin M, Norgren M. Identification of a novel insertion element, IS/548, in group B streptococci, predominantly in strains causing endocarditis endocarditis (ĕn'dōkärdī`tĭs), bacterial or fungal infection of the endocardium (inner lining of the heart) that can be either acute or subacute. . J Infect Dis 1998;177:967-76.

(10.) Berge A, Rasmussen M, Bjorck L. Identification of an insertion sequence located in a region encoding virulence factors of Streptococcus pyogenes. Infect Immun 1998;66:3449-53.

(11.) Whatmore AM, Kapur V, Sullivan DJ, Musser JM, Kehoe MA. Non-congruent relationships between variation in emm gene sequences and the population genetic structure of group A streptococci. Mol Microbiol 1994;14:619-31.

(12.) Harbaugh MP, Podbielski A, Hugl S, Cleary PP. Nucleotide substitutions and small-scale insertion produce size and antigenic variation in group A streptococcal M1 protein. Mol Microbiol 1993;8:981-91.

(13.) Johnson LP, Schlievert PM. Group A streptococcal phage phage: see bacteriophage.

phage - A program that modifies other programs or databases in unauthorised ways; especially one that propagates a virus or Trojan horse. See also worm, mockingbird. The analogy, of course, is with phage viruses in biology.
 T12 carries the structural gene for pyrogenic exotoxin type A. Mol Gen Genet genet: see civet.  1984;194:52-6.

(14.) Musser JM, Kapur V, Kanjilal S, Shah U, Musher mush 1  
n.
1. A thick porridge or pudding of cornmeal boiled in water or milk.

2. Something thick, soft, and pulpy.

3. Informal Mawkish sentimentality, affection, or amorousness.

tr.v.
 DM, Barg NL, et al. Geographic and temporal distribution and molecular characterization of two highly pathogenic clones of Streptococcus pyogenes expressing allelic variants of pyrogenic exotoxin A (scarlet fever toxin). J Infect Dis 1993;167:337-46.

(15.) Alland D, Kalkut GE, Moss AR, McAdam RA, Hahn JA, Bosworth W, et al. Transmission of tuberculosis in New York City New York City: see New York, city.
New York City

City (pop., 2000: 8,008,278), southeastern New York, at the mouth of the Hudson River. The largest city in the U.S.
. An analysis by DNA fingerprinting DNA fingerprinting or DNA profiling, any of several similar techniques for analyzing and comparing DNA from separate sources, used especially in law enforcement to identify suspects from hair, blood, semen, or other biological materials found at  and conventional epidemiologic methods. N Engl J Med 1994;330:1710-6.

(16.) van der Zee A, Mooi F, van Embden J, Musser J. Molecular evolution and host adaptation in Bordetella Bordetella

A genus of gram-negative bacteria which are coccobacilli and obligate aerobes, and fail to ferment carbohydrates. These bacteria are respiratory pathogens. Bordetella pertussis, B. parapertussis, and B.
 spp.: phylogenetic phy·lo·ge·net·ic
adj.
1. Of or relating to phylogeny or phylogenetics.

2. Relating to or based on evolutionary development or history.
 analysis using multilocus enzyme electrophoresis and typing with three insertion sequences. J Bacteriol 1997;179:6609-17.

(17.) Robinson DA, Hollingshead SK, Musser JM, Parkinson AJ, Briles DE, Crain MJ. The IS/1167 insertion sequence is a phylogenetically phy·lo·ge·net·ic  
adj.
1. Of or relating to phylogeny or phylogenetics.

2. Relating to or based on evolutionary development or history: a phylogenetic classification of species.
 informative marker among isolates of serotype 6B Streptococcus pneumoniae. J Mol Evol 1998;47:222-9.

(18.) Lawrence JG, Dykhuizen DE, DuBose RF, Hard DL. Phylogcnetic analysis using insertion sequence fingerprinting in Escherichia coli. Mol Biol Evol 1989;6:1-14.

(19.) Stanley J, Jones CS, Threlfall EJ. Evolutionary lines among Salmonella enteritidis phage types are identified by insertion sequence IS 200 distribution. FEMS FEMS Federation of European Microbiological Societies
FEMS Federation of European Materials Societies
FEMS Fabrication Engineering Management System
FEMS Facility Equipment Maintenance System (PMEL/TMDE) 
 Microbiol Lett 1991 ;66:83-9.

(20.) Suvorov A, Ferretti J. Physical and genetic chromosomal map chromosomal map
n.
A representation of the karyotype and of the positioning and ordering on it of those loci that have been localized by any of several mapping methods.
 of an M type 1 strain of Streptococcus pyogenes. J Bacteriol 1996;178:5546-9.

(21.) Groenen PMA PMA (papillary-marginal-attached),
n a system of epidemiologic scoring of periodontal disease devised by Schour and Massler in which the symbols denote the areas involved in gingival inflammation.

PMA Progressive muscular atrophy
, Bunschoten AE, van Soolingen D, van Embden JDA JDA Japan Defense Agency
JDA Joint Development Agreement
JDA Janne da Arc (band)
JDA Joint Duty Assignment
JDA Jerusalem Development Authority
JDA Jovian Detention Authority (gaming) 
. Nature of DNA polymorphism DNA polymorphism
n.
A condition in which one of two different but normal nucleotide sequences can exist at a particular site in a DNA molecule.
 in the direct repeat cluster of Mycobacterium tuberculosis; application for strain differentiation by a novel typing method. Mol Microbiol 1993; 10:1057-65.

(22.) Kamerbeek J, Schouls L, Kolk A, van Agterveld M, van Soolingen D, Kuijper S, et al. Simultaneous detection and strain differentiation of Mycobacterium tuberculosis for diagnosis and epidemiology. J Clin Microbiol 1997;35:907-14.

(23.) Sreevatsan S, Pan X, Stockbauer KE, Connell ND, Kreiswirth BN, Whittam TS, et al. Restricted structural gene polymorphism in the Mycobacterium tuberculosis complex indicates evolutionarily recent global dissemination. Proc Natl Acad Sci US A 1997;94:9869-74.

(24.) Musser JM, Kapur V, Peters JE, Hendrix CW, Drehner D, Gackstetter GD, et al. Real-time molecular epidemiologic analysis of an outbreak of Streptococcus pyogenes invasive disease in US Air Force trainees. Arch Pathol Lab Med 1994; 118:128-33.

(25.) Yeh RW, Ponce de Leon Ponce de Le·ón   , Juan 1460-1521.

Spanish explorer who sailed with Columbus on his second voyage (1493-1494) and discovered Florida (1513) while looking for the legendary Fountain of Youth.

Noun 1.
 A, Agasino CB, Hahn JA, Daley CL, Hopewell PC, et al. Stability of Mycobacterium tuberculosis DNA genotypes. J Infect Dis 1998; 177:1107-11.

(26.) Musser JM, Gray BM, Schlievert PM, Pichichero ME. Streptococcus pyogenes pharyngitis: characterization of strains by multilocus enzyme genotype. M and T protein serotype, and pyrogenic exotoxin gene probing. J Clin Microbiol 1992;30:600-3.

(27.) LaPenta D, Rubens C, Chi E, Cleary PP. Group A streptococci efficiently invade human respiratory epithelial cells. Proc Natl Acad Sci U S A 1994;91:12115-9.

(28.) Cleary PP, McLandsborough L, Ikeda L, Cue D, Krawczak J, Lam H. High-frequency intracellular infection and erythrogenic toxin erythrogenic toxin
n.
See streptococcus erythrogenic toxin.
 A expression undergo phase variation in MI group A streptococci. Mol Microbiol 1998;28:157-67.

(29.) Muotiala A, Seppala H, Huovinen P, Vuopio-Varkila J. Molecular comparison of group A streptococci of T1M1 serotype from invasive and noninvasive infections in Finland. J Infect Dis 1997;175:392-9.

(30.) Davies DD, McGeer A, Schwartz B, Green K, Cann D, Simor AE, et al. Invasive group A streptococcal infections in Ontario, Canada. N Engl J Med 1996;335:547-53.

(31.) Zurawski CA, Bardsley MS, Beall B, Elliott JA, Facklam R, Schwartz B, et al. Invasive group A streptococcal disease in metropolitan Atlanta: a population-based assessment. Clin Infect Dis 1998;27:150-7.

(32.) Hughes MK, Hughes AL. Natural selection on Plasmodium plasmodium, name for a stage in the life cycle of a slime mold. Also, Plasmodium is the name given to the genus of the protozoan parasite that causes malaria.  surface proteins. Mol Biochem Parasitol 1995;71:99-113.

Nancy Hoe,(*) Kazumitsu Nakashima,(*) Diana Grigsby,(*) Xi Pan,(*) Shu Jun Dou,(*) Steven Naidich,([dagger]) Marianne Garcia,([double dagger]) Emily Kahn,([double dagger]) David Bergmire-Sweat,([double dagger]) and James M. Musser(*)

(*)Baylor College of Medicine, Houston, Texas, USA; ([dagger])Naidich Space Laboratory, Inc., New York New York, state, United States
New York, Middle Atlantic state of the United States. It is bordered by Vermont, Massachusetts, Connecticut, and the Atlantic Ocean (E), New Jersey and Pennsylvania (S), Lakes Erie and Ontario and the Canadian province of
, New York, USA; ([double dagger])Texas Department of Health, Austin, Texas, USA
COPYRIGHT 1999 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 1999, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Author:Musser, James M.
Publication:Emerging Infectious Diseases
Geographic Code:1USA
Date:Mar 1, 1999
Words:5667
Previous Article:emm Typing and Validation of Provisional M Types for Group A Streptococci(1).
Next Article:Gnathostomosis, an Emerging Foodborne Zoonotic Disease in Acapulco, Mexico.
Topics:



Related Articles
Outbreak among drug users caused by a clonal strain of group A streptococcus.
New emm (M Protein Gene) Sequences of Group A Streptococci Isolated from Malaysian Patients.
Clonal Differences among Erythromycin. Resistant Streptococcus pyogenes in Spain.
emm Typing and Validation of Provisional M Types for Group A Streptococci(1).
Rapid Identification of Corynebacterium diphtheriae Clonal Group Associated with Diphtheria Epidemic, Russian Federation.(Statistical Data Included)
Invasive group A streptococcal infections, Israel. (Research).(Statistical Data Included)
Molecular Subtyping of Bacillus anthracis and the 2001 Bioterrorism-Associated Anthrax Outbreak, United States. (Bioterrorism-Related Anthrax).
Serotype III Streptococcus agalactiae from Bovine milk and human neonatal infections (1).(Research)
Macrolide- and telithromycin-resistant Streptococcus pyogenes, Belgium, 1999-2003 (1).(DISPATCHES)
Serotype competence and penicillin resistance in Streptococcus pneumoniae.(RESEARCH)

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles