Pyrosequencing Bacillus anthracis.Pyrosequencing technology is a sequencing method that screens DNA DNA: see nucleic acid.DNA or deoxyribonucleic acid One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes. nucleotide incorporation in real time. A set of coupled enzymatic reactions, together with bioluminescence bioluminescence (bī'ōl 'mĭnĕs`əns), production of light by living organisms. , detects incorporated
nucleotides in the form of light pulses, which produces a profile of
characteristic peaks in a pyrogram. We used this technology to identify
the warfare agent Bacillus anthracis Bacillus anthracis Infectious disease A gram-positive organism which causes often fatal infections when its endospores–resistant to heat, drying, UV light, gamma radiation, and many disinfectants–enter the body and cause septicemia Military medicine by sequencing 4 single nucleotide
polymorphisms (SNPs) in the rpoB gene as chromosomal markers for B.
anthracis. In addition, 1 segment in each of the B. anthracis plasmids
pXO1 and pXO2 was analyzed to determine the virulence status of the
bacterial strains. Pyrosequencing technology is a powerful method to
identify B. anthracis.********** Bacillus anthracis is a gram-positive, rod-shaped, spore-forming bacterium that causes the acute mammalian disease anthrax when endospores enter the body. The infection is often fatal if not treated with antimicrobial drugs before or when the first symptoms appear. The bacterium can infect livestock and humans by gastrointestinal, cutaneous cutaneous /cu·ta·ne·ous/ (ku-ta´ne-us) pertaining to the skin. cu·ta·ne·ous adj. Of, relating to, or affecting the skin. Cutaneous Pertaining to the skin. , or respiratory routes. Potentially, B. anthracis spores can be an effective biological weapon because of their high stability. They do not divide, have no metabolism, and are resistant to drying, heat, UV light, and many disinfectants. In 2001, letters containing anthrax spores caused illness in 22 persons, leading to 5 deaths in the United States. B. anthracis has 2 plasmids: the toxin-encoding pXO1 (182 kb) and capsule-encoding pXO2 (95 kb) (1,2). Both plasmids are required for virulence; lacking 1 of the plasmids attenuates the microorganism microorganism /mi·cro·or·gan·ism/ (-or´gah-nizm) a microscopic organism; those of medical interest include bacteria, fungi, and protozoa. . The pXO1 plasmid contains genes lef cya, and pag, which encode the toxin's lethal factor lethal factor n. A gene mutation or chromosomal structural change that when expressed causes death before sexual maturity. , edema edema (ĭdē`mə), abnormal accumulation of fluid in the body tissues or in the body cavities causing swelling or distention of the affected parts. factor, and protective antigen, respectively (3-5). The pXO2 plasmid contains the genes capA, capB, and capC, necessary for capsule formation (6). These genes have been used as markers to identify B. anthracis with polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is (PCR PCR polymerase chain reaction. PCR abbr. polymerase chain reaction Polymerase chain reaction (PCR) ) in both environmental and clinical samples (7-9). Differentiating between B. anthracis and closely related B. cereus cereus: see cactus. cereus Any of various large cacti (genus Cereus and related genera) of the western U.S. and tropical New World, including the saguaro and the organ-pipe cactus (Lemairocereus thurberi, also L. marginatus or C. thurberi). and B. thuringiensis is difficult (10). Usually, phenotypic characteristics, such as susceptibility to [beta]-lactam antimicrobial drugs, lack of hemolysis hemolysis (hĭmŏl`ĭsĭs), destruction of red blood cells in the bloodstream. Although new red blood cells, or erythrocytes, are continuously created and old ones destroyed, an excessive rate of destruction sometimes occurs. , lack of motility motility /mo·til·i·ty/ (mo-til´ite) the ability to move spontaneously.mo´tile Motility Motility is spontaneous movement. on sheep blood agar blood agar n. A nutrient culture medium that is enriched with whole blood and used for the growth of certain strains of bacteria. plate, and inability to ferment salicin salicin /sal·i·cin/ (sal´i-sin) a precursor of salicylic acid, contained in the bark of the willow and poplar, that is responsible for the antiinflammatory and antipyretic effects of willow bark. , are used to differentiate (11,12). A variety of chromosomal markers that appear to be specific have been suggested for genotypic species determination of B. anthracis (13-18). We studied single nucleotide polymorphisms (SNPs) in the rpoB gene, described by Qi et al. (13) by using pyrosequencing technology (19). This technology can determine SNPs and short DNA stretches in real time, starting from PCR products. Biotinylated PCR amplicons that cover the region of interest are immobilized onto solid streptavidin coated beads and converted to single-stranded form. A sequencing primer is hybridized to the single-stranded DNA, and incorporation of added nucleotides is detected as light peaks by an enzymatic cascade. Enzymatic degradation of excess nucleotides allows the reaction to be performed in a single tube. When one starts from PCR products, [less than or equal to] 96 genetic targets can be sequenced within 1 hour. In this study, we used the rpoB gene as a chromosomal marker to discriminate between B. anthracis and closely related bacillus bacillus (bəsĭl`əs), any rod-shaped bacterium or, more particularly, a rod-shaped bacterium of the genus Bacillus. Some bacterium in the genus cause disease, for example B. species. We studied 4 B. anthracis specific rpoB SNPs located at positions 911,912, 913, and 914 in duplex sequencing reactions by using a unique sequencing primer for each desired SNP SNP Scottish National Party Noun 1. SNP - (genetics) genetic variation in a DNA sequence that occurs when a single nucleotide in a genome is altered; SNPs are usually considered to be point mutations that have been evolutionarily in a collection of 17 anthracis and 10 non-anthracis Bacillus strains. Simultaneously, we investigated the distribution of virulence plasmids pXO1 and pXO2 among these strains by using PCR and pyrosequencing technology to rapidly verify the amplicons. Materials and Methods Bacterial Strains and DNA Extraction The B. anthracis reference strains used in this study were obtained from the National Collection of Type Cultures, London, England, and the Swedish Defense Research Agency. Reference strains of B. cereus, B. mycoides, and B. thuringiensis were obtained from the Culture Collection University of Gothenburg of Sweden. All bacterial strains are listed in Table 1. Bacteria were cultured on blood sheep agar at 37[degrees]C for 16 h, and genomic DNA was prepared by using a commercially available DNA extraction kit, QIAamp tissue protocol (Qiagen, Hilden, Sweden). The DNA was boiled at 99[degrees]C for 15 min, plated on blood agar, and incubated for 3 days. No growth was observed, and the DNA was removed from the biosafety level biosafety level Epidemiology A classification for the degree of caution required when working with specific groups of pathogens. See Maximum containment facility. 3 laboratory. All material, including the DNA, is under the protection of our institute. PCR All reagents used for amplification of bacterial DNA were from Amersham Biosciences (Uppsala, Sweden) except for primers, which were from Invitrogen Life Technologies (Paisley, United Kingdom). Table 2 shows the primer sequences. The reverse primer for each PCR fragment was biotinylated. PCR primers were designed to amplify a 176-bp fragment of rpoB, 179 bp of the pXO1 plasmid, and 127 bp of the pXO2 plasmid. PCR was performed in 50-[micro]L reaction mixtures containing 1x PCR buffer (10 mmol/L Tris-HCl, pH 8.3, 50 mmol/L KCl, 2.5 mmol/L Mg[Cl.sub.2]), 0.8 U Taq DNA polymerase DNA polymerase /DNA po·lym·er·ase/ (pah-lim´er-as) any of various enzymes catalyzing the template-directed incorporation of deoxyribonucleotides into a DNA chain, particularly one using a DNA template. , 0.2 mmol/L each nucleotide, 0.1 [micro]mol/L each primer and 5 [micro]L eluate eluate /el·u·ate/ (el´u-at) the substance separated out by, or the product of, elution or elutriation. el·u·ate n. The solution of solvent and dissolved matter resulting from elution. containing DNA. The reaction mixture was subjected to 95[degrees]C for 5 min and 45 cycles of 95[degrees]C for 30 s, annealing annealing (ənēl`ĭng), process in which glass, metals, and other materials are treated to render them less brittle and more workable. at 60[degrees]C for 30 s, and elongation at 72[degrees]C for 30 s, followed by terminal extension at 72[degrees]C for 7 min. Pyrosequencing Analysis Two primers were designed to sequence of 30 nucleotides within the PCR amplicons generated from plasmids pXO1 and pXO2, respectively. In addition, 1 sequencing primer was designed for each of the 4 rpoB SNPs to be determined (Table 2). The rpoB primers were used in duplex sequencing reactions so that primers 911 and 912 were combined in a single reaction for sequencing of SNPs at positions 911 and 912, while primers 913 and 914 were used for combined sequencing of SNPs at positions 913 and 914. For sequencing according to the pyrosequencing technology, biotinylated PCR amplicons were immobilized onto streptavidin-coated magnetic beads and denatured de·na·ture tr.v. de·na·tured, de·na·tur·ing, de·na·tures 1. To change the nature or natural qualities of. 2. to produce single-stranded DNA by using a PSQ PSQ Political Science Quarterly (journal) PSQ Pyrosequencing PSQ Pipsqueak (gene) PSQ Patient Satisfaction Questionnaire PSQ Presidential Studies Quarterly 96 Sample Prep Tool (Biotage AB, Uppsala, Sweden). Sequencing primers were added and allowed to hybridize hy·brid·ize intr. & tr.v. hy·brid·ized, hy·brid·iz·ing, hy·brid·iz·es 1. To produce or cause to produce hybrids; crossbreed. 2. to the strands, after which sequencing was performed according to the manufacturer's instructions. All steps were performed at room temperature. Results B. anthracis was unambiguously identified by determining 4 SNPs in the rpoB gene by using pyrosequencing technology; thus, we were able to distinguish B. anthracis from the other tested bacillus species. The Figure shows representative output diagrams, or pyrograms, from duplex sequencing reactions of the SNPs in B. anthracis National Collection of Type Cultures 2026 and B. cereus Culture Collection University of Gothenburg 7414. The specific nucleotides 911C, 912T, 913C, and 914A were found in all B. anthracis strains tested and appear to be unique to B. anthracis. The corresponding nucleotides in all tested non-anthracis strains (B. cereus, B. thuringiensis, and B. mycoides) were 911T, 912C, 913T, and 914G. In duplex sequencing reactions, we could easily determine 2 SNPs in each pyrogram (Figure). [FIGURE OMITTED] Presence of the virulence plasmids was determined by PCR and sequence verification of regions on plasmids pXO1 and pXO2 (Table 1). The assay was applied on 17 B. anthracis strains, 7 B. cereus strains, 2 B. thuringiensis strains, and 1 B. mycoides strain. Of the 17 B. anthracis isolates investigated, 9 isolates were positive for both pXO1 and pXO2, while the remaining 8 lacked either 1 or both of the virulence plasmids. All non-anthracis strains were negative for both plasmids, pXO1 and pXO2 PCR amplicons originating from the B. anthracis strains were verified by sequencing 30 nucleotides with the pyrosequencing technology. The nucleotide sequence following the sequencing primers located within the amplified flagments was AAGATATTATCAAGGGATATTTTAAGTAAA for all pXO1 amplicons and ACCACTCATTAAGTTCTTCGCACCGCTAAA for all pXO2 amplicons, which agreed with all nucleotide sequences of these regions submitted to the GenBank nucleotide database (http://www.ncbi.nhn.nih.gov), accession numbers AF065404, AE011190, AJ413934, AE017336, AJ413935, M29081, M30210, AF188935, AE011191, and AE017335. B. anthracis was successfully identified by using pyrosequencing technology for genotyping 4 SNP positions of the rpoB gene, which appear to be specific for B. anthracis, and 2 fragments of virulence plasmids pXO1 and pXO2. Discussion In biologic warfare, speed and accuracy are in high demand for identifying and characterizing microbial microbial pertaining to or emanating from a microbe. microbial digestion the breakdown of organic material, especially feedstuffs, by microbial organisms. species. In this study, we investigated the possibility of using pyrosequencing technology to rapidly identity and characterize strains of B. anthracis and distinguish them from related non-anthracis Bacillus strains. This method has been used to analyze multiple targets that are important in microbial infections (20,21). By determining 4 SNPs in the rpoB gene, B. anthracis strains were successfully identified. This chromosomal marker can discriminate between B. anthracis and other closely related species from the Bacillus genus. The 16S rRNA gene cannot be relied upon to differentiate B. anthracis from its close relatives; therefore, we did not include this target in the assay (22). By careful design of nucleotide dispensation order, multiple SNPs may be analyzed in 1 single sequencing reaction by using a unique primer for each desired SNP. To save time and reduce reagent cost, we analyzed the rpoB SNPs in duplex pyrosequencing reactions. The resulting pyrograms of overlapping sequences were easily resolved by the accompanying software (Figure). Using 1 well for all 4 SNP positions may further optimize the method. This technology validates PCR-based assays by qualitatively verifying that a positive PCR result is not the effect of nonspecific nonspecific /non·spe·cif·ic/ (non?spi-sif´ik) 1. not due to any single known cause. 2. not directed against a particular agent, but rather having a general effect. nonspecific 1. amplification, as shown here by sequence verification of PCR amplicon generated from virulence plasmids pXO1 and pXO2. The risk of false-positive results is thereby minimized. We illustrate for the first time how pyrosequencing technology can identify B. anthracis. Using this technology in diagnostic laboratories is advantageous because it is rapid, simple, nonradioactive, inexpensive, and automated. It is a powerful method to rapidly determine genetic targets; as many as 96 samples can be analyzed in 40 minutes. Genetic analysis with pyrosequencing technology could make selecting antimicrobial drug treatment easier and potentially complement typing methods and time-consuming, traditional microbial identification, such as biochemical testing Biochemical testing Measuring the amount or activity of a particular enzyme or protein in a sample of blood or urine or other tissue from the body. Mentioned in: Von Willebrand Disease , phage phage: see bacteriophage. phage - A program that modifies other programs or databases in unauthorised ways; especially one that propagates a virus or Trojan horse. See also worm, mockingbird. The analogy, of course, is with phage viruses in biology. lysing assays, and immunologic assays. [FIGURE OMITTED] Acknowledgments We thank Hong-Yan Zhang for providing the resources to perform this study and the Swedish Defense Research Agency for providing Bacillus strains. This work was supported by grants from the Swedish Emergency Management Agency. References (1.) Mikesell P, lvins BE, Ristroph JD, Dreier TM. Evidence for plasmid-mediated toxin production in Bacillus anthracis. Infect Immun. 1983;39:371-6. (2.) Uchida I, Sekizaki T, Hashimoto K, Terakado N. Association of the encapsulation of Bacillus anthracis with a 60 megadalton plasmid. J Gen Microbiol. 1985;131:363-7. (3.) Bragg TS, Robertson DL. Nucleotide sequence and analysis of the lethal factor gene (lef) from Bacillus anthracis. Gene. 1989;81:45-54. (4.) Robertson DL, Tippetts MT, Leppla SH. Nucleotide sequence of the Bacillus anthracis edema factor gene (cya): a calmodulin-dependent adenylate cyclase adenylate cyclase n. An enzyme that catalyzes the formation of cyclic AMP from ATP. Also called 3 ,5 . Gene. 1988;73:363-71.(5.) Welkos SL, Lowe JR, Eden-McCutchan F, Vodkin M, Leppla SH, Schmidt JJ. Sequence and analysis of the DNA encoding protective antigen of Bacillus anthracis. Gene. 1988;69:287-300. (6.) Makino SI, Uchida 1, Terakado N, Sasakawa C, Yoshikakawa M. Molecular characterization and protein analysis of the cap region, which is essential for encapsulation in Bacillus anthracis. J Bacteriol. 1989;171:722-30. (7.) Makino SI, Iinuma-Okada Y, Maruyama T, Ezaki T, Sasakawa C, Yoshikawa M. Direct detection of Bacillus anthracis DNA in animals by polymerase chain reaction. J Clin Microbiol. 1993;31:547-51. (8.) Ramisse V, Patra G, Garrigue H, Guesdon JL, Mock M. Identification and characterization of Bacillus anthracis by multiplex PCR analysis of sequences on plasmids pXO1 and pXO2 and chromosomal DNA. FEMS Microbiol Lett. 1996;145:9-16. (9.) Sjostedt A, Eriksson U, Ramisse V, Garrigue H. Detection of Bacillus anthracis spores in soil by PCR. FEMS Microbiol Ecol. 1997;23:159-68. (10.) Ash C, Farrow JAE JAE Journal of Applied Econometrics JAE Journal of Architectural Education JAE Journal of Aesthetic Education JAE Jump If Above or Equal JAE Journal of Architectural Engineering JAE Java Application Environment JAE Junta Autónoma de Estradas , Dorsch M, Stackebrandt E, Collins MD. Comparative analysis of Bacillus anthracis, Bacillus cereus Bacillus ce·re·us n. A species of Bacillus that causes an emetic type and a diarrheal type of food poisoning in humans. , and related species on the basis of reverse transcriptase Reverse transcriptase Any of the deoxyribonucleic acid (DNA) polymerases present in particles of retroviruses which are able to carry out DNA synthesis using an RNA template. sequencing of 16S rRNA. Int J Syst Bacteriol. 1991;41:343-6. (11.) Logan NA, Carman Car´man n. 1. A man whose employment is to drive, or to convey goods in, a car or car. J, Melling J, Berkeley R. Identification of Bacillus anthracis by API tests. J Med Microbiol. 1985;20:75-85. (12.) Dixon TC, Meselson M, Guilleman J, Hanna R Anthrax. N Engl J Med. 1999;341:815-26. (13.) Qi Y, Patra G, Liang X, Williams LE, Rose S, Redkar RJ, et aL. Utilization of the rpoB gene as a specific chromosomal marker for real-time PCR detection of Bacillus anthracis. Appl Environ Microbiol. 2001;67:3720-7. (14.) Ellerbrock H, Nattermann H, Ozel M, Beutin L, Appel B, Pauli G. Rapid and sensitive identification of pathogenic and apathogenic Bacillus anthracis by real-time PCR. FEMS Microbiol Lett. 2002;214:51-9. (15.) Van Ert MN, Hofstadler SA, Jiang Y, Busch JD, Wagner DM, Drader JJ, et al. Mass spectrometry mass spectrometry or mass spectroscopy Analytic technique by which chemical substances are identified by sorting gaseous ions by mass using electric and magnetic fields. provides accurate characterization of two genetic marker types in Bacillus anthracis. Biotechniques. 2004;37:642-4. (16.) Hurtle hur·tle v. hur·tled, hur·tling, hur·tles v.intr. To move with or as if with great speed and a rushing noise: an express train that hurtled past. v.tr. W, Bode E, Kulesh DA, Kaplan RS, Garrison J, Bridge D, et al. Detection of the Bacillus anthracis gyrA gene by using a minor groove binder probe. J Clin Microbiol. 2004;42:179-85. (17.) Pearson T, Busch JD, Ravel J, Read TD, Rhoton SD, U'Ren JM, et al. Phylogenetic phy·lo·ge·net·ic adj. 1. Of or relating to phylogeny or phylogenetics. 2. Relating to or based on evolutionary development or history. discovery bias in Bacillus anthracis using single-nucleotide polymorphisms from whole-genome sequencing. Proc Natl Acad Sci U S A. 2004;101:13536-41. (18.) Hill KK, Ticknor LO, Okinaka RT, Asay M, Blair H, Bliss KA, et al. Fluorescent amplified fragment length polymorphism Amplified fragment length polymorphism PCR, or "AFLP-PCR" (often AFLP), is a tool used in the study of genetics and in the practice of genetic engineering. Amplified Fragment Length Polymorphism (AFLP analysis of Bacillus anthracis, B. cereus, and B. thuringiensis isolates. Appl Environ Microbiol. 2004;70:1068-80. (19.) Ronaghi M, Uhlen M, Nyren R A sequencing method based on real time pyrophosphate pyrophosphate /py·ro·phos·phate/ (-fos´fat) a salt of pyrophosphoric acid. py·ro·phos·phate n. Abbr. PP A salt or ester of pyrophosphoric acid. . Science. 1998;281:363, 365. (20.) Hjalmarsson S, Alderborn A, Fock C, Muldin I, Kling H, Uhlen M, et al. Rapid combined characterization of microorganism and host genotypes using a single technology. Helicobacter. 2004;9:138-45. (21.) Sinclair A, Arnold C, Woodford N. Rapid detection and estimation by pyrosequencing of 23S rRNA genes with a single nucleotide polymorphism conferring linezolid resistance in enterococci enterococci bacteria in the genus Enterococcus. . Antimicrob Agents Chemother. 2003;47:3620-2. (22.) Blackwood KS, Turenne CY, Harmsen D, Kabani AM. Reassessment of sequence-based targets for identification of Bacillus species. J Clin Microbiol. 2004;42:1626-30. Tara Wahab, * Sandra Hjalmarsson, * Ralfh Wollin, * and Lars Engstrand * * Swedish Institute for Infectious Disease Control, Solna, Sweden Ms Wahab is a microbiologist at the Centre for Microbiological Preparedness at the Swedish Institute for Infectious Disease Control. She works mainly with diagnostics and developing new techniques to identify bacterial biosafety level 3 organisms. Address for correspondence: Ears Engstrand, Section of Bacteriology bacteriology Study of bacteria. Modern understanding of bacterial forms dates from Ferdinand Cohn's classifications. Other researchers, such as Louis Pasteur, established the connection between bacteria and fermentation and disease. , Swedish Institute for Infectious Disease Control, SE 171 82, Solna, Sweden; fax: 46-8-30-17-97; email: Lars.Engstrand@smi.ki.se Table 1. Bacterial strains and their plasmid content * Strain Origin PXO1 pXO2 Bacillus anthracis 30 UK + + 57-77 UK + + 73-77 UK + + 183-78 UK + + 187-78 UK + + 188-78 UK + + R81/04 Iceland + + NCTC 10340 Unk. + + NCTC 2620 UK + + NCTC 109 UK + - NCTC 1328 UK + - NCTC 5444 UK - + NCTC 7752 UK - + NCTC 7753 UK - + NCTC 08234 UK (Sterne) + - ATCC 4229 Unk. - + Sterne 7702 UK + - B. cereus CCUG 7414 USA - - CCUG 10781 USA - - CCUG 36925 USA - - CCUG 41923 Sweden - - CCUG 43518A Sweden - - CCUG 46981 Sweden - - CCUG 47340 UK - - B. mycoides CCUG 26678 USA - - B. thuringiensis CCUG 7429 Germany - - CCUG 22499 UK - - * Unk., unknown; NCTC, National Collection of Type Cultures; CCUG, Culture Collection University of Gothenburg. |
|
||||||||||||||||||

'mĭnĕs`əns)
,5
Printer friendly
Cite/link
Email
Feedback
Reader Opinion