Printer Friendly
The Free Library
14,457,573 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Prevalence of G2P[4] and G12P[6] rotavirus, Bangladesh.


Approximately 20,000 stool specimens from patients with diarrhea visiting 1 urban and 1 rural hospital in Bangladesh during January 2001-May 2006 were tested for group A rotavirus rotavirus /ro·ta·vi·rus/ (ro´tah-vi?rus) any member of the genus Rotavirus. ro´taviral
Rotavirus /Ro·ta·vi·rus/ (ro´tah-vi?rus 
 antigen, and 4,712 (24.0%)were positive. G and P genotyping was performed on a subset of 10% of the positive samples (n = 471). During the 2001-2005 rotavirus seasons, G1P G1P Glucose 1 Phosphate [8] (36.4%) and G9P[8] (27.7%) were the dominant strains, but G2[4] and G12P[6] were present in 15.4% and 3.1% of the rotavirus-positive patients, respectively. During the 2005-06 rotavirus season, G2P G2P Got to Pee [4] (43.2%) appeared as the most prevalent strain, and G12P[6] became a more prevalent strain (11.1%) during this season. Because recently licensed rotavirus vaccines include only the P[8] specificity, it is unknown how the vaccines will perform in settings where non-P[8] types are prevalent.

**********

Group A rotaviruses are the major etiologic agents of severe infantile infantile /in·fan·tile/ (in´fin-til) pertaining to an infant or to infancy.

in·fan·tile
adj.
1. Of or relating to infants or infancy.

2.
 diarrhea. Worldwide, >125 million infants and young children develop rotavirus-associated diarrhea each year, resulting in 440,000 infant and child deaths, mostly in developing countries (1). In Bangladesh, rotavitoses cause 6,000-14,000 deaths each year in children <5 years of age (2).

The tremendous incidence of rotavirus disease underscores the urgent need for interventions such as vaccines, particularly to prevent childhood deaths in developing nations. Fortunately, 2 rotavirus vaccines, RotaTeq (Merck and Co., Whitehouse Station, NJ, USA) and RotaRix (GlaxoSmithKline, Research Triangle Park Research Triangle Park, research, business, medical, and educational complex situated in central North Carolina. It has an area of 6,900 acres (2,795 hectares) and is 8 × 2 mi (13 × 3 km) in size. Named for the triangle formed by Duke Univ. , NC, USA) passed a large safety trial, showed high efficacy against the major rotavirus G types, and have been approved by the Food and Drug Administration (3.4). The efficacy trials of these vaccines have been conducted in the United States United States, officially United States of America, republic (2005 est. pop. 295,734,000), 3,539,227 sq mi (9,166,598 sq km), North America. The United States is the world's third largest country in population and the fourth largest country in area. , Latin America Latin America, the Spanish-speaking, Portuguese-speaking, and French-speaking countries (except Canada) of North America, South America, Central America, and the West Indies. , and Europe but not in developing countries in Africa and Asia.

Rotavirus infection rotavirus infection Virology RI is usually mild, but may be severe in children ≤ 2 yrs due to intense vomiting Morbidity > 870,000 children < age 5 die of rotavirus infection in developing countries, in contrast to 75 to 150 in the US Epidemiology  shows a characteristic seasonal pattern that is not clearly understood. In developed countries with temperate climates, peak incidence is in winter; however, in developing countries with tropical or subtropical sub·trop·i·cal  
adj.
Of, relating to, or being the geographic areas adjacent to the Tropics.


subtropical
Adjective

of the region lying between the tropics and temperate lands

 climates, the virus circulates year-round (5-8). The temperature in Bangladesh is usually high from April through October and relatively low from December through February. In addition, previous studies have indicated that rotavirus in Bangladesh is affected by floods, which increase opportunities for transmission of the virus (8,9). Bangladesh lies on the confluence of hundreds of rivers and is inundated in·un·date  
tr.v. in·un·dat·ed, in·un·dat·ing, in·un·dates
1. To cover with water, especially floodwaters.

2.
 with water every year due to enhanced rainfall during the monsoon monsoon (mŏnsn) [Arab., mausium=season], wind that changes direction with change of season, notably in India and SE Asia.  season, starting in June (10).

Rotaviruses belong to the genus Reoviridae and consist of 11 segments of double-stranded RNA RNA: see nucleic acid.
RNA
 in full ribonucleic acid

One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic
. Two outer capsid capsid /cap·sid/ (kap´sid) the shell of protein that protects the nucleic acid of a virus; it is composed of structural units, or capsomers.

cap·sid
n.
 proteins, VP7 (defining G genotypes) and VP4 (defining P genotypes), independently elicit neutralizing responses. Based on these proteins, a dual classification system of group A rotaviruses has been introduced (5). Rotaviruses can be serotyped by using neutralization neutralization, chemical reaction, according to the Arrhenius theory of acids and bases, in which a water solution of acid is mixed with a water solution of base to form a salt and water; this reaction is complete only if the resulting solution has neither acidic nor  assays with panels of antisera and genotyped by type-specific primer-dependent reverse transcription-PCR (RT-PCR RT-PCR

reverse transcriptase-polymerase chain reaction. See PCR1.
) and nucleotide sequence analysis (11-13). So lar, [greater than or equal to] 15 G and 26 P genotypes have been described in humans and a variety of animals (6,14,15). The major human G types ate G1, G2, G3, G4, and G9, which, combined with the P types P[8], P[4], and P[6], account for >80% of rotavirus-associated gastroenteritis gastroenteritis: see enteritis.
gastroenteritis

Acute infectious syndrome of the stomach lining and intestines. Symptoms include diarrhea, vomiting, and abdominal cramps.
 episodes worldwide (16,17).

Rotaviruses show great genomic diversity, and several studies in different regions of Bangladesh have identified types not targeted by candidate rotavirus vaccines (18-21). Unicomb et al. (8) showed that frequent genomic reassortment among different rotavirus types was accelerated by mixed infection and generated huge genomic diversity. Although the importance of type-specific immunologic protection against rotavirus disease is still under discussion, many investigators suggest that genomic characterization of rotaviruses is needed to assess whether vaccine efficacy Vaccine efficacy is defined as the reduction in the incidence of a disease among people who have received a vaccine compared to the incidence in unvaccinated people. The efficacy of a new vaccine is measured in phase III clinical trials by giving one group of people a vaccine and

might be altered by the changing pattern in the distribution of different G and P genotypes (17,22,23).

In our study, stool samples from gastroenteritis patients admitted to 2 hospitals, 1 urban and 1 rural, within the hospital surveillance system of International Centre for Diarrhoeal Disease Research, Bangladesh The International Centre for Diarrhoeal Disease Research, Bangladesh (ICDDR,B) is an international health research organisation. It is located in Dhaka, Bangladesh and was established in 1978.  (ICDDR ICDDR International Centre for Diarrhoeal Disease Research (Bangladesh) ,B), from January 2001 through May 2006 were tested for the rotavirus VP6 antigen. The study objective was to clarify the genomic diversity of rotavirus in urban and rural areas in Bangladesh, with a goal of providing information for rotavirus vaccine development programs.

Materials and Methods

Study Population

The ICDDR, B runs an urban hospital situated in Dhaka, the capital city of Bangladesh, which has a population of [approximately or equal to] 10 million, and a rural hospital at Matlab, 45 km southeast of Dhaka, which has [approximately or equal to] 300,000 inhabitants
:This article is about the video game. For Inhabitants of housing, see Residency
Inhabitants is an independently developed commercial puzzle game created by S+F Software. Details
The game is based loosely on the concepts from SameGame.
. Each year, >100,000 patients are treated for diarrhea at the Dhaka hospital and [approximately or equal to] 15,000 at the Matlab hospital. At the Dhaka hospital, diarrhea surveillance is conducted in a systematic manner; stool samples are collected to determine the presence of enteric enteric /en·ter·ic/ (en-ter´ik) within or pertaining to the small intestine.

en·ter·ic
adj.
1. Of, relating to, or within the intestine.

2.
 pathogens in every 50th (2%) patient attending the hospital for treatment of diarrhea. In Matlab hospital, stool samples are collected from all patients from the community, which is under active rotavirus surveillance.

Rotavirus Antigen Detection

As part of the surveillance system, rotavirus antigens (group A rotavirus-specific VP6 proteins) were detected in the stool specimens using a solid-phase sandwich-type enzyme immunoassay Immunoassay

An assay that quantifies antigen or antibody by immunochemical means. The antigen can be a relatively simple substance such as a drug, or a complex one such as a protein or a virus.
 modeled after the Dakopatts commercial kit (Dakopatts, Copenhagen, Denmark), incorporating rabbit hyperimmune hyperimmune /hy·per·im·mune/ (hi?per-i-mun´) possessing very large quantities of specific antibodies in the serum.

hyperimmune

possessing very large quantities of specific antibodies in the serum.
 antisera produced at ICDDR,B and an anti-human rotavirus--horseradish peroxidase peroxidase /per·ox·i·dase/ (per-ok´si-das) any of a group of iron-porphyrin enzymes that catalyze the oxidation of some organic substrates in the presence of hydrogen peroxide.

per·ox·i·dase
n.
 conjugate conjugate /con·ju·gate/ (kon´jdbobr-gat)
1. paired, or equally coupled; working in unison.

2. a conjugate diameter of the pelvic inlet; used alone usually to denote the true conjugate diameter; see
.

The same criteria as those used by the Dakopatts kit were used for determination of positivity (8).

RNA Extraction

Rotavirus RNA was extracted from the stool samples. The QIAamp Viral RNA mini kit (Qiagen/Westburg, Leusden, the Netherlands) was used according to according to
prep.
1. As stated or indicated by; on the authority of: according to historians.

2. In keeping with: according to instructions.

3.
 the manufacturer's instructions

RT-PCR

A multiplex RT-PCR was performed by using the Qiagen OneStep RT-PCR Kit (Qiagen/Westburg) for rotavirus G and P genotypes using type-specific oligonucleotide primers as previously described (Table 1) (11,13,24). The reaction was carried out with an initial reverse-transcription step at 45[degrees]C for 30 min, followed by 35 cycles of amplification (30 sec at 94[degrees]C, 30 sec at 48[degrees]C, 1 min at 72[degrees]C), anda final extension of 7 min at 72[degrees]C in a thermal cycler The Thermal cycler (also known as a thermocycler, PCR machine or DNA amplifier) is a laboratory apparatus used for PCR. The device has a thermal block with holes where tubes with the PCR reaction mixtures can be inserted.  (Eppendorf, Hamburg, Germany). PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
 products were subjected to electrophoresis on a 2% agarose agarose

more highly purified form of agar with similar uses to agar and widely used in the separation of nucleic acid fragments.
 gel, stained with ethidium bromide Ethidium bromide (sometimes abbreviated as EtBr) is an intercalating agent commonly used as a nucleic acid stain in molecular biology laboratories for techniques such as agarose gel electrophoresis. , and observed under ultraviolet light Ultraviolet light
A portion of the light spectrum not visible to the eye. Two bands of the UV spectrum, UVA and UVB, are used to treat psoriasis and other skin diseases.
. Specific segment sizes for different G and P genotypes were observed on the stained gel.

Nucleotide Sequencing

The PCR products were purified with the QIAquick PCR purification kit (Qiagen/Westburg) and sequenced by using the dideoxy-nucleotide chain termination For the DNA sequencing method, see .

Chain termination is any chemical reaction leading to the destruction of a reactive intermediate in a chain propagation step in the course of a polymerization, effectively bringing it to a halt.
 method with the ABI Abi (ā`bī) [short for Abijah], in the Bible, King Hezekiah's mother.


(Application Binary Interface) A specification for a specific hardware platform combined with the operating system.
 PRISM BigDye Terminator Cycle Sequencing Reaction kit (Applied Biosystems Applied Biosystems, Inc. (formerly NASDAQ: ABIO) is the original name of a pioneer biotechnology company founded in 1981 in Foster City, California, among the Silicon Valley cities of the southern San Francisco Bay Area. , Foster City, CA, USA) on an automated sequencer See MIDI sequencer.

(music) sequencer - Any system for recording and/or playback of music via a programmable memory which stores music not as audio data, but as some representation of notes.
. The consensus forward primer Beg9 and reverse primer End9 were used to amplify and sequence the VP7 gene. For the VP4 gene, the forward primer Con3 and reverse primer Con2. were used as described previously (11).

Data Analysis and DNA Sequence DNA sequence Genetics The precise order of bases–A,T,G,C–in a segment of DNA, gene, chromosome, or an entire genome. See Base pair, Base sequence analysis, Chromosome, Gene, Genome.  Submission

Data were analyzed by SPSS A statistical package from SPSS, Inc., Chicago (www.spss.com) that runs on PCs, most mainframes and minis and is used extensively in marketing research. It provides over 50 statistical processes, including regression analysis, correlation and analysis of variance.  for Windows, release 11.5.1 (SPSS Inc., Chicago, IL, USA). The nucleotide sequence data of the rotavirus strains were submitted to the GenBank under the accession nos. DQ482712, DQ482718, DQ482725, DQ146652, DQ146653, DQ146654, DQ146658, DQ146663, DQ146664, DQ146665, DQ146669, EF033338, EF033339, and EF033340.

Results

Detection of Rotavirus Antigen

From January 2001 through May 2006, 19,039 stool specimens were tested for group A rotavirus VP6 antigen; 4,644 (24.4%) samples had positive results. Table 2 shows the distribution of rotavirus-positive patients in the hospital surveillance systems in Dhaka and Matlab. The average detection rate of rotavirus was 25.2% in Dhaka and 23.3% in Matlab.

Quality Control

Stool specimens obtained from 311 patients with diarrhea were tested for the presence of rotavirus particles using the IDEIA IDEIA Individuals with Disabilities Education Improvement Act of 2004 (US law)  rotavirus kit (DAKO Ltd., Cambridgeshire, UK). By using the IDEIA kit, 234 samples were found to be positive and 77 negative. By comparison, our in-house ELISA ELISA (e-li´sah) Enzyme-Linked Immuno-Sorbent Assay; any enzyme immunoassay using an enzyme-labeled immunoreactant and an immunosorbent.

ELISA
n.
 kit could detect rotavirus antigen in 232 of the IDEIA-positive samples. Among the IDEIA-negative samples, 74 were negative for rotavirus antigen by our in-house kit. Thus, a comparison of the results indicated that our in-house ELISA kit had an overall sensitivity of 99.1% and specificity of 96.1% compared with the IDEIA rotavirus kit.

Age of the Rotavirus-positive Patients

The age range of the rotavirus diarrhea patients (2001-2005) was 1 month-63.2 years, median age 10 months, and mean age 22.8 months. Most of the rotavirus-positive patients (91%) were <2 years ofage (Figure 1). Infection rates were lowest in patients <3 months and >5 years of age.

[FIGURE 1 OMITTED]

Seasonal Pattern of Rotavirus Infection

Figure 2 shows the monthly distribution of rotavirus diarrhea in Dhaka and Matlab. Rotaviruses were detected throughout the year in both settings, even though 2 clear seasonal rotavirus peaks were observed each year: a sharp winter peak in January and February, and a monsoon peak in July and August. Taking the average for each setting into account, our model suggests that the rotavirus season in Bangladesh usually starts in June and ends in May (year-round).

[FIGURE 2 OMITTED]

Air temperature records for Dhaka and water level data for the Buriganga River The Buriganga River (Bangla: বুড়িগঙ্গা Buŗigônga "Old Ganges") is the main river flowing beside Dhaka city, capital of Bangladesh.  (Sadarghat point, Dhaka) for the 5 years of the study (2001-2005) were obtained from the Institute of Water Modelling, Dhaka, Bangladesh (www.iwmbd.org). These data and the number of rotavirus patients admitted to the Dhaka hospital by month ate shown in Figure 3. The temperature was lowest from December through February each year, which coincided with the increased number of rotavirus diarrhea cases. On the other hand, the monsoon peaks of rotavims diarrhea were correlated with the water level. The water level reached the highest mark during July--August each year, which corresponded to the increase of the proportion of rotavirus diarrhea. The meteorologic me·te·or·ol·o·gy  
n.
The science that deals with the phenomena of the atmosphere, especially weather and weather conditions.



[French météorologie, from Greek
 data from Matlab also correlated to the increased incidence of rotavirus infection, as was seen for Dhaka (data not shown).

[FIGURE 3 OMITTED]

Distribution of G and P Types

G and P genotyping were carried out on 471 rotavims antigen-positive stool samples (10% of all rotavims-positive patients) by using a type-specific primer--based multiplex RT-PCR that could detect 6 G genotypes (G1, G2, G3, G4, G8, G9) and 5 P genotypes (P[8], P[4], P[6], P[9], P[11]). The untypeable and suspicious samples with lower amounts of PCR products were successfully typed and confirmed by using nucleotide sequencing. Table 3 shows the distribution of G and P types of rotavirus strains detected in Dhaka and Matlab. No significant difference was observed between the distribution of rotavirus strains in Dhaka and Matlab (p>0.05). Overall, the most prevalent genotype genotype (jēn`ətīp'): see genetics.
genotype

Genetic makeup of an organism. The genotype determines the hereditary potentials and limitations of an individual.
 was GIP GIP - 1. General Interpretive Programme.

A 1956 interpreted language for the English Electric DEUCE, with array operations and an extensive library of numerical methods.
[8] (33.8%), which was followed by G9P[8] (25.3%), G2P[4] (20.2%), and G4P[8] (8.3%). Mixed infections were detected in 3.2% of the samples. Strains with unusual G-P G-P Gel'fand - Pinsker (channel code)  combinations, such as G1P[6], G2P[6], and G2P[8], were also detected.

Unusual porcine-like G11 rotavirus strains were detected in 3 patients (0.6%). These strains were untypeable by multiplex PCR because no G11-specific primer was included in the routine primer set. Therefore, sequencing of the VP7 and VP4 genes was required. The partial VP7 gene sequences of the 3 G11 rotavirus strains (Dhaka22-01, Matlab36-02, and Dhakal3-06) were most similar (>98% similarities at the nucleotide and >97% at the amino acid amino acid (əmē`nō), any one of a class of simple organic compounds containing carbon, hydrogen, oxygen, nitrogen, and in certain cases sulfur. These compounds are the building blocks of proteins.  level) to the porcine-like G11 strain Dhaka6 (15). On the other hand, the VP4 genes were most similar to human P[8] or P[6] strains (Malawi strain OP351, Thai strain 15vp4w, and US strain Se585).

Uncommon human G12 rotavirus strains (5.6%), were also detected during our study period. Because the G 12 strains were untypeable by using our routine primers, nucleotide sequencing of their VP7 genes was required. All the VP7 gene sequences of the Bangladeshi G12 strains were most similar to the recently isolated G 12 strains (Indian strain ISO- iso- or is-
pref.
1. Equal; uniform: isobar.

2. Isomeric: isopropyl.

3.
2) but distantly related to the prototype G12 strain L26 isolated in the Philippines. The gene segments encoding the VP4, VP6, and NSP (1) (Network Service Provider) An organization that provides a high-speed Internet backbone to ISPs and other service providers. Sprint, MCI and UUNET are examples of NSPs. See Internet backbones. 4 proteins were sequenced for Bangladeshi G12 strains Dhaka25-02 (G12P[8]) and Dhakal2-03 (G12P[6]). The VP4 gene sequence of strain Dhaka25-02 was most similar to the human P[8] rotavirus strain DRC DRC Democratic Republic of Congo
DRC Down (Stage) Right Center
DRC Director(ate) of Reserve Components
DRC Disability Rights Commission (United Kingdom) 
88 (98% similarity at the amino acid level) isolated in Democratic Republic of the Congo, and strain Dhakal2-03 was most similar to the human P[6] strain US 1205 (99% similarity at the amino acid level) isolated in the United States. The VP6 and NSP4 sequences of both strains were also most similar to human rotavirus strains (Indian rotavirus strains RMC RMC Royal Military College
RMC Radio Monte Carlo
RMC Randolph-Macon College (Ashland, Virginia)
RMC Regional Medical Center
RMC Robert Morris College (Illinois)
RMC Rocky Mountain College
 100, G25795, and V 13520).

Polyacrylamide gel electrophoresis polyacrylamide gel electrophoresis
n.
A technique for determining the molecular weight of proteins, in which proteins that have been coated in an anionic detergent undergo electrophoresis in a polyacrylamide gel.
 was performed for the 26 GI2 strains isolated in our study, and 18 showed a clear RNA migration pattern. Long electropherotypes were detected in 15 (83.3%) samples, which included both G12P[8] and G12P[6] strains. Short electropherotypes were detected in only 3 (16.7%) samples, which also included both G12P[8] and G12P[6] strains.

Fluctuation of the G and P Types Distribution over Time

Large fluctuations of the rotavirus genotype distribution were observed both in Dhaka and Matlab. However, no significant difference was observed between the urban and rural setting with regard to the yearly distribution of genotypes (p>0.05). The overall distribution of the major genotypes over time is shown in Figure 4. The G1P[8] strains were less common in 2001, became the most predominant strains in the following years, but decreased again in 2005-06. G9P[8] strains dominated in the first 2 rotavirus seasons, decreased sharply during 2002-03, dominated again for the next 2 years, and decreased again during 2005-06. G4P[8], which had been the most prevalent strain in the 1990s in Bangladesh, was found to be less common in our study and constituted only 1.2% during 2005-06. Most interestingly, the strain G2P[4] was the most predominant (43.2%) during the 2005-06 rotavirus season, although it was less common during the previous seasons (15.4% 2001-05). The uncommon strains G12P[6] and G12P[8], introduced in Bangladesh for the first time during the 2000-01 season, became more prevalent (13.6%) in this region by the 2005-06 season.

[FIGURE 4 OMITTED]

Discussion

Rotavirus was found in approximately one fourth of all patients with diarrhea who were treated at ICDDR,B hospitals; most rotavirus cases (92.5%) occurred in children during their first 2 years of life. A recent report indicated that 33% of children <5 years age admitted to the ICDDR,B from 1993 through 2004 were rotavirus positive (2). Reports from other Asian countries also indicated that rotaviruses were present in 20%-58% of patients with diarrhea who were <5 years of age. Thus, the rotavirus detection rate from our study is comparable to rates from some other Asian countries, including India, South Korea, and Hong Kong Hong Kong (hŏng kŏng), Mandarin Xianggang, special administrative region of China, formerly a British crown colony (2005 est. pop. 6,899,000), land area 422 sq mi (1,092 sq km), adjacent to Guangdong prov.  (20%-30%), but much lower than those reported in Taiwan, Thailand, China, Japan, Mayanmar, and Vietnam (43%-58%) (25-34).

Although rotavirus-associated diarrhea was documented year-round in Dhaka and Matlab, a sbarp winter peak and a monsoon peak were observed each year. The winter rotavirus peak is usually observed worldwide, but the monsoon peak is not common in settings with temperate climates. We analyzed environmental data including rainfall and water level of the nearest river and found that the monsoon rotavirus peaks in Bangladesh could be defined by high water levels due to heavy rainfall, which normally starts in the second week of June (35). Because of the heavy rainfall, the water level of the rivers begins to increase and reaches its highest level during July--August each year, resulting in inundation INUNDATION. The overflow of waters by coming out of their bed.
     2. Inundations may arise from three causes; from public necessity, as in defence of a place it may be necessary to dam the current of a stream, which will cause an inundation to the upper lands;
 of the surrounding areas and increasing the chance of fecal contamination of water. Ahmed and colleagues reported that the number of rotavirus diarrhea cases increased remarkably, and mixed rotavirus types were frequently isolated during the floods in 1988 in Dhaka (10). In July and August 2004 in Matlab (Figure 2), a large increase in rotavirus-associated diarrhea was observed. Analysis of the water level of the nearest river (Chandpur point of the Meghna River Meghna River

River, Bangladesh. It is formed by the Surma River. Flowing south, it is joined southeast of Dhaka by the Padma River, which is formed from the waters of the Ganges and Brahmaputra rivers.
, data not shown) showed that this increase correlated directly with an increased water level. The water level reached the 5.42 meter mark in July 2004, the highest in that region during our study period.

Our main goal was to characterize the VP7 (G genotype) and VP4 (P genotype) gene segments of the rotavirus strains. We identified most of the globally common rotavirus types (G1, G2, G4, and G9) in our study. Surprisingly, no G3 strain has been detected in Bangladesh since 1993, even though G3 is one of the most prevalent rotavirus types worldwide (8,25,29). Results of rotavirus diversity from this study were compared with previous findings in Bangladesh (8), and we observed that the distribution of rotavirus genotypes was changing over time. From 1992 through 1997, the most common rotavirus genotype was G4 (47% of the typeable rotavirus strains), but this genotype's prevalence gradually decreased, and it became a less common rotavirus strain over time (1.2% in 2005-06). The distribution of G2 strains, on the other hand, remained nearly unchanged through rotavirus season 2004-05 (19.5% in 1992-1997 and 16.2% in 2001-2005). However, G2 suddenly became the most prevalent genotype in 2005-06 (43.2%).

Three G11 strains, commonly found in pigs, were isolated from humans in the present study. In Bangladesh, pigs are uncommon farm animals, and no genotyping studies on pigs or other animals have been conducted. Therefore, the identification of the strains with an animal-like G11 VP7 specificity and a human P[8] or P[6] specificity raises the question whether these strains are reassortants of human and animal rotavirus strains. This finding underscores the need to include animal rotavirus strains rotavirus surveillance programs. At the same time, water samples, particularly those collected during floods, can be evaluated for the presence of unusual rotavirus strains that might have been introduced from domestic animals.

For the first time in Bangladesh, a very uncommon human rotavirus strain, G12, was detected. The strain was first detected in 1987-1988 in the Philippines, and since then, it has been emerging all over the world (36-40). G12 is reported as an important rotavirus strain in India (17.1% in 2003-2005) and in Argentina (6% in 1999-2003) (17,36). A considerable proportion of G12 was also documented during our study period and reached 13.6% in the latest rotavirus season (2005-06). Thus, the emergence of G12 strains has led to the need for prospective surveillance using new diagnostic RT-PCR primers for G12 strains.

Genetic analysis of the VP4, VP6, and NSP4 gene segments showed that the Bangladeshi G12 strains contained typical human rotavirus gene segments distantly related to the prototype G12 strains L26 and T152. It is possible that the VP7 gene segments from the prototype G12 strains were reassorted with the typical human rotavirus strains. More genetic analyses of complete genome sequences would be helpful to investigate the possible reassortment events and evolution of the recently emerging G12 strains.

P genotype analysis showed that the rotavirus strains with the P[8] specificity made up 76.4% of the circulating strains during 2001-2005; non-P[8] strains constituted 21.9%. The most interesting finding about P types in our study was that the non-P[8] strains represented more than half of the strains (56.8%) during the rotavirus season 2005-06. The currently licensed rotavirus vaccines have shown high efficacy rates in trials and have focused on the role of the major G genotypes, but the role of P genotypes has not been addressed clearly (3,4). These vaccines include the P[8] specificity, but it is unknown how the vaccines will perform in settings where the non-P[8] types are prevalent. An efficacy trial of the rotavirus vaccine RotaTeq will begin soon in Bangladesh, so the findings of our study regarding rotavirus strain diversity will be important for evaluating the results of this trial.

This study was funded by World Health Organization (WHO) (Ref. V27- l 81-176) and Government of Bangladesh/Debt Relief Grant Aid (DRGA) (grant No. GR-00410). International Centre for Diarrhoeal Disease Research, Bangladesh, acknowledges with gratitude the commitment of WHO and DRGA to the Centre's research efforts. Mr Rahman was supported by Interfaculty Council for Development Co-operation Scholarship of the University of Leuven, Belgium.

References

(1.) Parashar UD, Gibson CJ, Bresse JS, Giass RI. Rotavirus and severe childhood diarrhea. Emerg Infect Dis. 2006; 12:304-6.

(2.) International Centre for Diarrhoeal Disease Research, Bangladesh. Centre for Health and Population Research. Estimated deaths due to rotavirus in Bangladesh. Health and Science Bulletin. 2006;4:6-10.

(3.) Ruiz-Palacios GM, Perez-Schael I, Velazquez FR, Abate H, Breuer T, Clemens SC, et al. Safety and efficacy of an attenuated Attenuated
Alive but weakened; an attenuated microorganism can no longer produce disease.

Mentioned in: Tuberculin Skin Test


attenuated

having undergone a process of attenuation.
 vaccine against severe rotavirus gastroenteritis. N Engl J Med. 2006;354: 11-22.

(4.) Vesikari T, Matson DO, Dennehy P, van Darnme P, Santosham M, Rodrigue Z, et al. Safety and efficacy of a pentavalent pentavalent

having a valence of five.


pentavalent antimony compounds
see antimony.

pentavalent organic arsenicals
includes the pharmaceuticals arsanilic acid, roxarsone, nitarsone. See also organic arsenical.
 human-bovine (WC3) reassortant rotavirus vaecine. N Engl J Med. 2006;354: 23-33.

(5.) Estes MK. Rotaviruses and their replication. In: Howley PM, editor. Fields virology virology, study of viruses and their role in disease. Many viruses, such as animal RNA viruses and viruses that infect bacteria, or bacteriophages, have become useful laboratory tools in genetic studies and in work on the cellular metabolic control of gene expression , 4th ed., vol 2. Philadelphia: Lippincott Williams & Wilkins; 2001. pp. 1747-86.

(6.) Kapikian AZ, Hoshino Y, Chanock RM. Rotaviruses. In: Howley PM, editor. Fields virology, 4th ed., vol 2. Philadelphia: Lippincott Williams & Wilkins; 2001. pp. 1787-1833.

(7.) Turcios RM, Curas AT, Holman RC, Pandya-Smith I, Lamonte A, Bresee JS, et al. Temporal and geographic trends of rotavirus activity in the United States, 1997-2004. Pediatr Infect Dis J. 2006; 25: 45-14.

(8.) Unicomb LE, Podder G, Gentsch JR, Woods PA, Hasan KZ, Faruque ASG ASG Assign
ASG Allen Systems Group (Naples, FL)
ASG Abu Sayyaf Group (terrorist group)
ASG Associated Student Government
ASG Area Support Group
ASG Adaptive Services Grid
ASG Assistant Secretary General
, et al. Evidence of high-frequency genomic reassortment of group A rotavirus strains in Bangladesh: emergence of type G9 in 1995. J Clin Microbiol. 1999;37:1885-91.

(9.) Ahmed MU, Urasawa S, Taniguchi K, Urasawa T, Kobayashi N, Wakasugi F, et al. Analysis of human rotavirus strains prevailing in Bangladesh in relation to nationwide floods brought by the 1988 monsoon. J Clin Microbiol. 1991;29:2273-9.

(10.) Ali A. Climate change impacts and adaptation assessment in Bangladesh. Climate Research. 1999;12:109-16.

(11.) Gentsch JR, Glass RI, Woods P, Gouvea V, Gorziglia M, Flores Flores, town, Guatemala
Flores (flōrəs), town (1990 est. pop. 2,200), capital of Petén department, N Guatemala. Flores was built on an island in the southern part of Lake Petén Itzá and on the site of the
 J, et al. Identification of group A rotavirus gene 4 types by polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is . J Clin Microbiol. 1992;30:1365-73.

(12.) Gorziglia M, Larralde G, Kapikian AZ, Chanock RM. Antigenic relationships among human rotaviruses as determined by outer capsid protein VP4. Proc Natl Acad Sci U S A. 1990;87:7155-9.

(13.) Gouvea V, Glass RI, Woods P, Taniguchi K, Clark HF, Forrester B. Polymerase chain reaction amplification and typing of rotavirus nucleic acid nucleic acid, any of a group of organic substances found in the chromosomes of living cells and viruses that play a central role in the storage and replication of hereditary information and in the expression of this information through protein synthesis.  from stool specimens. J Clin Microbiol. 1990;28:276-82.

(14.) Martella V, Ciarlet M, Banyai K, Lorusso E, Cavalli A, Conente M, et al. Identification of a novel VP4 genotype camed by a serotype serotype /se·ro·type/ (ser´o-tip) the type of a microorganism determined by its constituent antigens; a taxonomic subdivision based thereon.

se·ro·type
n.
See serovar.

v.
 G5 porcine porcine /por·cine/ (por´sin) pertaining to swine.

porcine

pertaining to pig. See also hog (1), swine.


porcine circovirus 1
a nonpathogenic virus.
 rotavirus strain. Virology. 2006;346:301-11.

(15.) Rahman M, Matthijnssens J, Nahar S, Podder G, Sack DA, Azim T, et al. Characterization of a novel P[25],G11 human group a rotavirus. J Clin Microbiol. 2005;43:3208-12.

(16.) Gentsch JR, Laird AR, Bielfelt B, Griffin DD, Banyai K, Ramachandran M, et al. Serotype diversity and reassortment between human and animal rotavirus strains: Implications for rotavirus vaccine programs. J Infect Dis. 2005;192:S146-59.

(17.) Santos N, Hoshino Y. Global distribution of rotavirus serotypes/genotypes and its implication for the development and implementation of an effective rotavirus vaccine. Rev Med Virol. 2005; 15:29-56.

(18.) Fun BN, Unicomb LE, Rahim Z, Banu NN, Podder G, Clemens J, et al. Rotavirus-associated diarrhea in rural Bangladesh: two-year study of incidence and serotype distribution. J Clin Microbiol. 1991;29:1359-63.

(19.) Unicomb LE, Bingnan F, Rahim Z, Banu NN, Gomes JG, Podder G, et al. A one-year survey of rotavirus strains from three locations in Bangladesh. Arch Virol. 1993;132:201-8.

(20.) Unicomb LE, Kilgore PE, Faruque ASG, Hamadani JD, Fuchs GJ, Albert MJ, et al. Anticipating rotavirus vaccines: hospital-based surveillance for rotavirus diarrhea and estimates of disease burden in Bangladesh. Pediatr Infect Dis J. 1997;16:947-51.

(21.) Ward RL, McNeal MM, Clemens JD, Sack DA, Rao M, Huda N, et al. Reactivities of serotyping monoclonal antibodies This is a list of monoclonal antibodies, antibodies which are clones of a single parent cell. When used as medications, the generic names end in -mab (see "Nomenclature of monoclonal antibodies").  with culture-adapted human rotaviruses. J Clin Microbiol. 1991;29:449-56.

(22.) Bernstein DI, Glass RI, Rodgers G, Davidson BL, Sack DA. Evaluation of rhesus rotavirus monovalent monovalent /mono·va·lent/ (-va´lent)
1. having a valency of one.

2. capable of combining with only one antigenic specificity or with only one antibody specificity.
 and tetravalent tetravalent /tet·ra·va·lent/ (tet?rah-va´lent) having a valence of four.

tet·ra·va·lent
adj.
Having a valence of four; quadrivalent.



tetravalent

having a valence of four.
 reassortant vaccines in US children. JAMA JAMA
abbr.
Journal of the American Medical Association
. 1995;273:1191-6.

(23.) Bresee JS, Hummelman E, Nelson EA, Glass RI. Rotavirus in Asia: the value of surveillance for informing decisions about the introduction of new vaccines. J Infect Dis. 2005;192:S1-5.

(24.) Rahman M, Sultana R, Podder G, Faruque ASG, Matthijnssens J, Zaman K, et al. Typing of human rotaviruses: nucleotide mismatches between VP7 gene and primer are associated with genotyping failure. Virol J. 2005;2:24.

(25.) Bahl R, Ray P, Subodh S, Shambharkar P, Saxena M, Parashar U, et al. Incidence of severe rotavirus diarrhea in New Delhi New Delhi (dĕl`ē), city (1991 pop. 294,149), capital of India and of Delhi state, N central India, on the right bank of the Yamuna River. , India, and G and P types of the infecting rotavirus strains. J Infect Dis. 2005; 192: S114-9.

(26.) Chen KT, Chen PY, Tang RB, Huang YF, Lee PI, Yang JY, et al. Sentinel hospital surveillance for rotavirus diarrhea in Taiwan, 2001-2003. J Infect Dis. 2005;192:$44-8.

(27.) Fang ZY, Wang B, Kilgore PE, Bresee JS, Zhang LJ, Sun LW, et al. Sentinel hospital surveillance for rotavirus diarrhea in the People's Republic People's Republic
n.
A political organization founded and controlled by a national Communist party.
 of China, August 2001-July 2003. J Infect Dis. 2005; 192: $94-9.

(28.) Jiraphongsa C, Bresee JS, Pongsuwanna Y, Kluabwang P, Poonawagul U, Arporntip P, et al. Epidemiology and burden of rotavirus diarrhea in Thailand: results of sentinel surveillance. J Infect Dis. 2005;192:S87-93.

(29.) Kang G, Kelkar SD, Chitambar SD, Ray P, Naik T. Epidemiological profile of rotaviral infection in India: challenges for the 21st century. J Infect Dis. 2005;192:S120-6.

(30.) Kim JS, Kang JO, Cho SC, Jang YT, Min SA, Park TH, et al. Epidemiological profile of rotavirus infection in the Republic of Korea: results from prospective surveillance in the Jeongeub District, 1 July 2002 through 30 June 2004. J Infect Dis. 2005;192:S49-56.

(31.) Moe K, Hummelman EG, Oo WM, Lwin T, Htwe TT. Hospital-based surveillance for rotavirus diarrhea in children in Yangon, Myanmar. J Infect Dis. 2005;192:S111-3.

(32.) Nakagomi T, Nakagomi O, Takahashi Y, Enoki e·no·ki  
n. pl. e·no·kis
Enokidake.



[Short for enokidake.]
 M, Suzuki T, Kilgore PI. Incidence and burden of rotavirus gastroenteritis in Japan, as estimated from a prospective sentinel hospital study. J Infect Dis. 2005;192:S106-10.

(33.) Nelson EA, Taro JS, Yu LM, Ng YC, Bresee JS, Poon poon  
n.
Any of several trees of the genus Calophyllum, of southern Asia, having light hard wood used for masts and spars.



[Sinhalese p
 KH, et al. Hospital-based study of the economic burden associated with rotavirus diarrhea in Hong Kong. J infect Dis. 2005; 192:S64-70.

(34.) Van Man N, Luan Le T, Trach DD, Thanh NT, Van Tu P, Long NT, et al. Epidemiological profile and burden of rotavirus diarrhea in Vietnam: 5 years of sentinel hospital surveillance, 1998-2003. J Infect Dis. 2005;192:S127-32.

(35.) Singh OP. Cause-effect relationships between sea surface temperature Sea surface temperature (SST) is the water temperature at the surface. In practical terms, the exact meaning of "surface" will vary according to the measurement method used. , precipitation and sea level along the Bangladeshi coast. Theoretical and Applied Climatology climatology

Branch of atmospheric science concerned with describing climate and analyzing the causes and practical consequences of climatic differences and changes. Climatology treats the same atmospheric processes as meteorology, but it also seeks to identify slower-acting
. 2001;68:233-43.

(36.) Samajdar S, Varghese V, Barman P, Ghosh S, Mitra U, Dutta P, et al. Changing pattem of human group A rotaviruses: emergence of G12 as an important pathogen among children in eastern India. J Clin Virol. 2006;36:183-8.

(37.) Das S, Varghese V, Chaudhury S, Barman P, Mahapatra S, Kojima K, et al. Emergence of novel human group A rotavirus G12 strains in India. J Clin Microbiol. 2003;41:2760-2.

(38.) Griffin DD, Nakagomi T, Hoshino Y, Nakagomi O, Kirkwood CD, Parashar UD, et al. Characterization of nontypeable rotavirus strains from the United States: identification of a new rotavirus reassortant (P2A P2A Process-to-Application [6],G12) and rare P3[9] strains related to bovine rotaviruses. Virology. 2002;294:256-69.

(39.) Pongsuwanna Y, Guntapong R, Chiwakul M, Tacharoenmuang R, Onvimala N, Wakuda M, et al. Detection of a human rotavirus with GI2 and P[9] specificity in Thailand. J Clin Microbiol. 2002;40:1390-4.

(40.) Shinozaki K, Okada M, Nagashima S, Kaiho I, Taniguchi K. Characterization of human rotavirus strains with G12 and P[9] detected in Japan. J Med Virol. 2004;73:612-6.

Mustafizur Rahman, * ([dagger]) Rasheda Sultana,* Giasuddin Ahmed, * Sharifun Nahar, * Zahid M. Hassan, * Farjana Saiada, * Goutam Podder, * Abu S. G. Faruque, * A. K. Siddique, * David A. Sack, * Jelle Matthijnssens, ([dagger]) Marc Van Ranst, ([dagger]) and Tasnim Azim *

* International Centre for Diarrhoeal Disease Research, Bangladesh, Dhaka, Bangladesh; and ([dagger]) University of Leuven, Leuven, Belgium

Mr Rahman is a PhD student at the University of Leuven, Belgium, and a research officer in the Virology Laboratory, Laboratory Sciences Division, International Centre for Diarrhoeal Disease Research, Bangladesh, Dhaka, Bangladesh. His research interests focus on the molecular characterization and evolution of rotaviruses.

Address for correspondence: Mustafizur Rahrnan, Virology Laboratory, Laboratory Sciences Division, ICDDR,B, GPO Box-128, Dhaka-1000, Bangladesh; email: icddrb@gmail.com
Table 1. Oligonucleotide primers used in the study for PCR
amplification

Primer   Type    Position (nt)   Strand   Sequence (5'-3')

Beg9     VP7          1-28       Plus     GGCTTTAAAAGAGAGAATTTCCGTCTGG
End9     VP7       1062-1036     Minus    GGTCACATCATACAATTCTAATCTAAG
RVG9     VP7       1062-1044     Minus    GGTCACATCATACAATTCT
Con2     VP4        868-887      Minus    ATTTCGGACCATTTATAACC
Con3     VP4         11-32       Plus     TGGCTTCGCCATTTTATAGACA
MR-G1    G1         314-335      Plus     CAAGTACTCAAATCAGTGATGG
MR-G2    G2         436-459      Plus     CTATGAATCCACAACTGTATTGTG
aET3     G3         689-709      Plus     CGTTTGAAGAAGTTGCAACAG
MR-G4    G4         480-499      Plus     GCTTCTGGTGAAGAGTTG
aAT8     G8         178-198      Plus     GTCACACCATTTGTAAATTCG
MR-G9    G9         757-776      Plus     GAACCATAAACTTGATGTG
MR-P8    P[8]       314-335      Minus    TCTACTGGATCGACGTGC
MR-P4    P[4]       474-494      Minus    CTATTATTAGAGGTTAAAGTC
3T-1     P[6]       259-278      Minus    TGTTGATTAGTTGGATTCAA
4T-1     P[9]       385-402      Minus    TGAGACATGCAATTGGAC
ND2      P[11]      116-133      Minus    AGCGAACTCACCAATCTG

Primer   Reference

Beg9     (13)
End9     (13)
RVG9     (13)
Con2     (11)
Con3     (11)
MR-G1    Present study
MR-G2    Present study
aET3     (13)
MR-G4    Present study
aAT8     (13)
MR-G9    Present study
MR-P8    Present study
MR-P4    Present study
3T-1     (11)
4T-1     (11)
ND2      (11)

Table 2. Distribution of specimens positive for rotavirus, Bangladesh,
January 2001-May 2006

                             Dhaka                   Matlab

                       No.      Rotavirus      No.      Rotavirus
Rotavirus season *   tested   positive (%)   tested   positive (%)

2000-01 ([dagger])      879     214 (24.3)      715     202 (28.3)
2001-02               1,824     563 (30.9)    1,665     428 (25.7)
2002-03               1,806     458 (25.4)    1,583     338 (21.4)
2003-04               1,786     458 (25.6)    1,425     281 (19.7)
2004-05               2,374     521 (21.9)    1,547     350 (22.6)
2005-06               2,070     492 (23.8)    1,365     339 (24.8)
Total                10,739   2,706 (25.2)    8,300   1,938 (23.3)

* Each season starts in June and ends in May of the following year.

([dagger]) Data from January-May 2001 only.

Table 3. Distribution of G and P genotypes of rotavirus strains,
Bangladesh, January 2001-May 2006

                              No. (%)
                        rotavirus strains *     Total no. (%)
                                                  rotavirus
G type      P type      Dhaka        Matlab        strains

G1           P[6]      1 (0.4)       2 (1.0)        3 (0.6)
G1           P[8]     85 (31.3)     74 (37.2)     159 (33.8)
G2           P[4]     55 (20.2)     40 (20.1)      95 (20.2)
G2           P[6]      1 (0.4)          0           1 (0.2)
G2           P[8]      2 (0.7)          0           2 (0.4)
G4           P[8]     26 (9.6)      13 (6.5)       39 (8.3)
G9           P[6]      7 (2.6)       2 (1.0)        9 (1.9)
G9           P[8]     67 (24.6)     52 (26.1)     119 (25.3)
G11          P[61      1 (0.4)          0           1 (0.2)
G11          P[8]      1 (0.4)       1 (0.5)        2 (0.4)
G12          P[6]     16 (5.9)       5 (2.5)       21 (4.5)
G12          P[8]      2 (0.7)       3 (1.5)        5 (1.1)
Mixed G/P              8 (3.0)       7 (3.5)       15 (3.2)
Total                272 (100.1)   199 (99.9)     471 (100.0)

* The percentage of the total for Dhaka is >100% and for Matlab <100%
because each number was rounded off to the nearest one tenth of 1%.
COPYRIGHT 2007 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2007, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:RESEARCH
Author:Azim, Tasnim
Publication:Emerging Infectious Diseases
Date:Jan 1, 2007
Words:5256
Previous Article:Vaccine effectiveness estimates, 2004-2005 mumps outbreak, England.(RESEARCH)
Next Article:Elimination of arctic variant rabies in red foxes, Metropolitan Toronto.(RESEARCH)



Related Articles
Expanding global distribution of rotavirus serotype G9: detection in Libya, Kenya, and Cuba. (Dispatches).
Global illness and deaths caused by rotavirus disease in children. (Research).
First report from the Asian Rotavirus Surveillance Network.(Perspectives)
Rotavirus serotype G9P[8] and acute gastroenteritis outbreak in children, northern Australia.(Research)
Enterotoxigenic Escherichia coli and Vibrio cholerae diarrhea, Bangladesh, 2004.(DISPATCHES)
Molecular Characterization of rotavirus gastroenteritis strains, Iraqi Kurdistan.
Human rotavirus serotype G9, Sao Paulo, Brazil, 1996-2003.(RESEARCH)(infectious diseases research)(includes statistical tables)
Human rotavirus G9 and G3 as major cause of diarrhea in hospitalized children, Spain.
Detection of G12 human rotaviruses in Nepal.(DISPATCHES)
Symptomatic and subclinical infection with rotavirus P[8]G9, rural Ecuador.(RESEARCH)

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles