Printer Friendly
The Free Library
5,071,953 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Predominance of ancestral lineages of Mycobacterium tuberculosis in India.


Although India has the highest prevalence of tuberculosis (TB) worldwide, the genetic diversity of Mycobacterium tuberculosis Mycobacterium tuberculosis
n.
Tubercic bacillus.


Mycobacterium tuberculosis
 in India is largely unknown. A collection of 91 isolates originating from 12 different regions spread across the country were analyzed by genotyping Genotyping refers to the process of determining the genotype of an individual with a biological assay. Current methods of doing this include PCR, DNA sequencing, and hybridization to DNA microarrays or beads.  using 21 loci loci

[L.] plural of locus.

loci Plural of locus, see there
 with variable-number tandem repeats (VNTRs), by spoligotyping, by principal genetic grouping (PGG PGG Purple, Green, and Gold (Mardi Gras beads colors)
PGG Project Galactic Guide
PGG Patrol Gunboat (Missile)
PGG Pendleton Grain Growers, Inc. (Pendleton, OR, USA) 
), and by deletion analysis of M. tuberculosis--specific deletion region 1. The isolates showed highly diverse VNTR VNTR Variable Number of Tandem Repeat(s)  genotypes. Nevertheless, highly congruent con·gru·ent  
adj.
1. Corresponding; congruous.

2. Mathematics
a. Coinciding exactly when superimposed: congruent triangles.

b.
 groupings identified by using the 4 independent sets of markers permitted a clear definition of 3 prevalent PGG1 lineages, which corresponded to the "ancestral" East African--Indian, the Delhi, and the Beijing/W genogroups. A few isolates from PGG2 lineages and a single representative of the presumably pre·sum·a·ble  
adj.
That can be presumed or taken for granted; reasonable as a supposition: presumable causes of the disaster.
 most recent PGG3 were identified. These observations suggest a predominance pre·dom·i·nance   also pre·dom·i·nan·cy
n.
The state or quality of being predominant; preponderance.

Noun 1. predominance - the state of being predominant over others
predomination, prepotency
 of ancestral M. tuberculosis M. tuberculosis,
n the bacterium responsible for tuberculosis, generally a respiratory infection in man; nonrespiratory tuberculosis is considered an indicator disease for AIDS. See also tuberculosis.
 genotypes in the Indian subcontinent Indian subcontinent, region, S central Asia, comprising the countries of Pakistan, India, and Bangladesh and the Himalayan states of Nepal, and Bhutan. Sri Lanka, an island off the southeastern tip of the Indian peninsula, is often considered a part of the subcontinent. , which supports the hypothesis that India is an ancient endemic focus of TB.

**********

Tuberculosis (TB) in humans has been described since ancient times. Mycobacterium tuberculosis, its main causative caus·a·tive  
adj.
1. Functioning as an agent or cause.

2. Expressing causation. Used of a verb or verbal affix.



caus
 agent, is widely disseminated and is one of the most successful human pathogens today, with 2 billion persons infected. Most of the disease's effects are now concentrated in countries with few resources; India has the highest number of cases (1).

Because of the clonal structure of M. tuberculosis (2-4), comparative genotypic genotypic

emanating from or pertaining to genotype.


genotypic selection
selection of breeding stock on the basis of known inherited characteristics.
 analyses from widespread geographic areas, such as the Indian subcontinent, or from different human populations can give unique insights into dissemination dynamics and evolutionary genetics Evolutionary genetics is the broad field of studies that attempts to account for evolution in terms of changes in gene and genotype frequencies within populations and the processes that convert the variation with populations into more or less permanent variation between species.  of the pathogen Pathogen

Any agent capable of causing disease. The term pathogen is usually restricted to living agents, which include viruses, rickettsia, bacteria, fungi, yeasts, protozoa, helminths, and certain insect larval stages.
 (5,6). IS6110 restriction fragment Noun 1. restriction fragment - the fragment of DNA that is produced by cleaving DNA with a restriction enzyme
fragment - a piece broken off or cut off of something else; "a fragment of rock"
 length polymorphism--based fingerprinting (7) has been used to study the mycobacterial mycobacterial

emanating from or pertaining to mycobacterium.


mycobacterial granuloma
may be caused by Mycobacterium tuberculosis (see cutaneous tuberculosis), M.
 population structure from southern India, northern India, and the Delhi region (8-11). However, IS6110 fingerprinting is of limited use because a high proportion of M. tuberculosis strains have low copy numbers or are devoid of IS6110 in several regions of India (8,10). IS6110 typing also has a relative lack of portability, which hinders comparison between separate studies (12). Fingerprinting methods targeting polymorphic polymorphic - polymorphism  spacer sequences in the direct repeat (DR) region, including spoligotyping, have been used in some of these regions and in Bombay (13-15). However, when used alone, these methods considerably underestimate the clonal diversity (16). Because of these limitations, knowledge about the mycobacterial population structure in India remains incomplete.

More recently, molecular typing methods based on variable-number tandem repeats (VNTRs) of genetic elements named mycobacterial interspersed repetitive units (MIRUs) (17) have been developed (18,19). MIRU-VNTR typing shows a discriminatory power close to that of IS6110 fingerprinting and is particularly efficient in distinguishing M. tuberculosis isolates with few IS6110 elements or none (19-21). MIRU-VNTRs are sufficiently stable to track epidemic strains (19,20,22).

We analyzed M. tuberculosis strain diversity in a sample of 91 isolates from 12 different regions, including northern, central, and southern India, by using a set of 21 VNTR loci, including the 12 MIRU-VNTR loci described previously (17,18) and 9 additional loci containing VNTRs of other interspersed genetic elements (23-25). All of these loci are collectively designated MIRU-VNTR loci in this study. Spoligotyping was used as a complementary technique because this procedure, albeit less discriminatory, is useful in identifying genotype genotype (jēn`ətīp'): see genetics.
genotype

Genetic makeup of an organism. The genotype determines the hereditary potentials and limitations of an individual.
 families (16,26,27). In addition, single nucleotide polymorphism Noun 1. single nucleotide polymorphism - (genetics) genetic variation in a DNA sequence that occurs when a single nucleotide in a genome is altered; SNPs are usually considered to be point mutations that have been evolutionarily successful enough to recur in a  (SNP SNP Scottish National Party

Noun 1. SNP - (genetics) genetic variation in a DNA sequence that occurs when a single nucleotide in a genome is altered; SNPs are usually considered to be point mutations that have been evolutionarily
) genotyping on the katG and gyrA genes and genomic deletion analysis with M. tuberculosis--specific deletion region 1 (TbD1) were used to assess consistency of the genetic relationships obtained by VNTR typing and spoligotyping at a broader evolutionary level. SNPs in the katG and gyrA genes classify M. tuberculosis isolates into 3 principal genetic groups (PGGs) thought to have evolved sequentially from group 1 to group 3 (2). TbD1 is specifically present in a subset of PGG1 strains, but absent in other strains of PGG 1, and in PGG2 and PGG3 strains; TbD1+ strains have therefore been proposed to constitute an ancestral lineage of M. tuberculosis (28). Using a combination of all 4 markers, we found that ancestral lineages prevail in our collection, which suggests an ancient focus of TB in the Indian subcontinent.

Materials and Methods

Strains and Genomic DNA genomic DNA
n.
The full complement of DNA contained in the genome of a cell or organism.
 Extraction

A sample of 100 clinical isolates of M. tuberculosis was initially selected; the isolates originated in 12 different regions, from northern, central, and southern India and part of eastern India (Table 1). For 9 isolates, mixed infections or laboratory cross-contamination was suspected after MIRU-VNTR typing (see Results), and they were excluded from further analysis. The isolates were collected from patients with pulmonary TB pulmonary TB Pulmonary tuberculosis, see there  who had voluntarily visited their nearest medical college or hospital for diagnosis and treatment. Therefore, in most of the cases, the patients lived near the respective cities reported in Table 1. Patients were adults, 20 to 45 years of age, and represented both men and women, except those from Ranchi where all reported cases were in male army personnel. Information regarding the extent of disease and treatment status (new or recurrent cases of disease) was not available. From these hospitals, most of the isolates (designated hereafter In the future.

The term hereafter is always used to indicate a future time—to the exclusion of both the past and present—in legal documents, statutes, and other similar papers.
 as ICC ICC

See: International Chamber of Commerce
, VA, VK, HA, BC, and ASN (1) (Autonomous System Number) A unique identifier of an autonomous system on the Internet. Of the 65 thousand ASNs available, more than 30 thousand have been assigned to ISPs and NSPs. ISPs usually have only one ASN, but NSPs may have more than one. ) were transported to the repository collection maintained at the Jalma Institute in Agra for further characterization and drug susceptibility testing susceptibility test Antimicrobial susceptibility test, see there , which was performed by the proportion method. Table 2 includes sensitivity profiles of isolates tested at the Jalma laboratory. The isolates from New Delhi New Delhi (dĕl`ē), city (1991 pop. 294,149), capital of India and of Delhi state, N central India, on the right bank of the Yamuna River.  were collected between March 1997 and March 1998, from Ahmedabad between November 1996 and July 1997, from Ranchi between February and March 1999, from Chandigarh in September 1997, from Bangalore in November 1996, from Jammu between May and July 2001, from Jaipur in May 2001, from Agra in May 2001, and from Varanasi between June and November 1999. The isolates designated as MHRC MHRC Maine Human Rights Commission
MHRC Mercer Human Resource Consulting
MHRC Manitoba Health Research Council
MHRC Malawi Human Rights Commission
MHRC Medical Health and Research Council
 were from pulmonary TB patients who sought treatment at the Mahavir Hospital, Hyderabad, between 2000 and 2002. The isolates designated as TRC TRC
Noun

(in South Africa) Truth and Reconciliation Commission: a commission which encourages people who committed human rights abuses or acts of terror during the apartheid era to reveal the truth about their crimes in return for immunity from prosecution
 were from pulmonary TB patients at the Tuberculosis Research Centre, Chennai. M. tuberculosis DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 was extracted by using the standardized protocol as described (7).

TbD1 Analysis

The presence of TbD1 was analyzed by PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
 (28). Briefly, 2 PCR assays were performed per isolate tested, by using either primers complementary to the sequences flanking the deleted region or primers complementary to the internal sequences. For the isolates that did (TbD1+) or did not (TbD1-) contain the TbD1 region, an amplicon was obtained only with internal primers or only with flanking primers, respectively.

Single Nucleotide Polymorphism Analysis

To define the PGGs, the polymorphisms at the katG codon codon: see nucleic acid.  463 and the gyrA codon 95 were determined by sequence analysis after PCR amplification with the same primers as in Sreevatsan et al. (2). The amplification products were sequenced by using an ABI Abi (ā`bī) [short for Abijah], in the Bible, King Hezekiah's mother.


(Application Binary Interface) A specification for a specific hardware platform combined with the operating system.
 3700 DNA sequencer A DNA sequencer is an instrument used to automate the DNA sequencing process.

DNA sequencers have become more important due to large genomics projects and the need to increase productivity.
 and the BigDye Terminator (1) A character that ends a string of alphanumeric characters.

(2) A hardware component that is connected to the last peripheral device in a series or the last node in a network.
 v3.1 Cycle sequencing kit (PE Applied Biosystems Applied Biosystems, Inc. (formerly NASDAQ: ABIO) is the original name of a pioneer biotechnology company founded in 1981 in Foster City, California, among the Silicon Valley cities of the southern San Francisco Bay Area. , Foster City, CA, USA).

Spoligotyping

Spoligotyping was performed by using a commercial kit (Isogen Bioscience BV, Maarsen, the Netherlands) according to according to
prep.
1. As stated or indicated by; on the authority of: according to historians.

2. In keeping with: according to instructions.

3.
 the previously described method (29). Reverse blotting analysis of spacer sequences in the DR region was performed by using a streptavidin-horseradish peroxidase--enhanced enzyme chemiluminescence chemiluminescence /chemi·lu·mi·nes·cence/ (kem?i-loo?mi-nes´ens) luminescence produced by direct transformation of chemical energy into light energy.  assay (Amersham Pharmacia-Biotech, Roosendaal, the Netherlands).

MIRU-VNTR Typing

The M. tuberculosis isolates were genotyped by PCR amplification of the 12 MIRU-VNTR loci (18) and 9 additional VNTR loci (23-25) by using an automated technique as described (19). The set of loci thus included (alternative designation in parentheses See parenthesis.

parentheses - See left parenthesis, right parenthesis.
) MIRU-VNTR loci 2, 4 (ETR-D), 10, 16, 20, 23, 24, 26, 27, 31 (ETR-E), 39 and 40; and VNTR loci 424, 577 (ETR-C), 1895 (QUB-1895), 2347, 2401, 2461 (ETR-B), 3171, 3690, and 4156 (QUB-4156). The primers against the MIRU-VNTR flanking regions flanking regions

noncoding sequences on either side of the coding region of a gene that contain various regulatory sequences (motifs).
 were the same as described (18), except that hex labeling was replaced by Vie labeling. The primers corresponding to the 9 additional VNTR loci and the conditions for their amplification by multiplex See multiplexing.  PCR are described in Table 3. The PCR fragments were sized and the various VNTR alleles were assigned after electrophoresis electrophoresis (ĭlĕk'trōfərē`sĭs): see colloid.
electrophoresis

Movement of electrically charged particles in a fluid under the influence of an electric field.
 on a 96-well ABI 377 sequencer See MIDI sequencer.

(music) sequencer - Any system for recording and/or playback of music via a programmable memory which stores music not as audio data, but as some representation of notes.
 with customized GeneScan and Genotyper software packages (PE Applied Biosystems), as described (19) and on the basis of data described in Table 3. Tables used for MIRU-VNTR allele allele (əlēl`): see genetics.
allele

Any one of two or more alternative forms of a gene that may occur alternatively at a given site on a chromosome.
 scoring are available at http://www.ibl.fr/mirus/mirus.html.

Analysis of Genetic Relationships

MIRU-VNTR profiles and spoligotypes were computed as character data into the Bionumerics program (Bionumerics version 2.5, Applied Maths, Saint-Martens-Latem, Belgium). MIRU-VNTR profiles were compared to each other by using the neighbor-joining algorithm. For spoligotypes, the Jaccard index The Jaccard index, also known as the Jaccard similarity coefficient, is a statistic used for comparing the similarity and diversity of sample sets.

The Jaccard coefficient is defined as the size of the intersection divided by the size of the union of the sample
 was calculated to allow for the construction of a dendrogram A dendrogram is a tree diagram frequently used to illustrate the arrangement of the clusters produced by a clustering algorithm (see cluster analysis). Dendrograms are often used in computational biology to illustrate the clustering of genes.  by using the unweighted pair-group method with arithmetic averages. The spoligotypes were compared to fingerprints in an international database (31) that contained fingerprints from 13,008 isolates at the time of the consultation (June 2004). The genetic relationships between the isolates based on the MIRU-VNTR types were assessed by matching the spoligotypes with TbD1, and SNP analyses were carried out on a selected set of isolates representative of the different spoligotypes in each of the 3 predicted PGG1 groups and in the predicted PGG2/3 groups.

Results

MIRU-VNTR and Spoligotype Analysis

Nine of the 100 isolates of the study collection displayed 2 alleles in several independent MIRU-VNTR loci among the 21 tested, which suggested mixed DNA populations. These mixed populations could have originated from laboratory cross-contaminations or from mixed infections. Therefore, they were excluded from further analysis.

The remaining 91 isolates showed highly diverse MIRU-VNTR genotypes (Figure 1). Seventy-eight distinct genotypes were detected in this collection, including 6 cluster patterns and 72 unique patterns. The largest MIRUVNTR cluster included 8 isolates, 5 of which originated in Ranchi. Another cluster included 3 isolates from New Delhi, while the remaining 4 clusters contained 2 isolates each (1 with 2 isolates from Delhi; the others included isolates from Jammu and Chandigarh, from Hyderabad and Chennai, and from Bangalore and Chandigarh). Information about possible links between patients with clustered isolates was not available. The number of different spoligotypes (36 distinct spoligotypes, including 11 cluster patterns and 25 unique patterns) was lower than that of the MIRU-VNTR types, which was consistent with previous comparisons between spoligotyping and MIRU-VNTR systems based on 12 loci (19-21). None of the MIRU-VNTR clusters was split by spoligotyping, while of the 11 spoligotype clusters, 9 were split by MIRU-VNTR typing.

[FIGURE 1 OMITTED]

The genetic relationships between the isolates based on the MIRU-VNTR types by using the neighbor-joining algorithm are displayed in Figure 1. This dendrogram indicates 3 main genotype groups. The identity of these groups was inferred by comparison with genetically well-characterized isolates from a worldwide collection (16), typed by using the same 21 MIRU-VNTR loci (19; E Supply et al., unpub, data). These groups are thereby predicted to correspond to the TbD1+ ancestral lineage (41 isolates, 45% of the total isolates), the recently described Delhi or Central Asian (CAS) genogroup (24 isolates, 26%), and the Beijing genogroup (9 isolates, 10%), respectively. These 3 groups belong to PGG1. The remaining isolates (17 isolates, 19%) are predicted to belong to PGG2 or PGG3 genogroups.

Congruence con·gru·ence  
n.
1.
a. Agreement, harmony, conformity, or correspondence.

b. An instance of this: "What an extraordinary congruence of genius and era" 
 of Groupings Between Markers

In accordance with the MIRU-VNTR typing results and the absence or presence of DR spacers 33-36 (26), katG and gyrA sequence analyses identified all tested representatives from Delhi and the ancestral genogroups as PGG1, whereas 14 tested isolates were assigned to PGG2 (Figure 1). One representative of PGG3, assumed to be the most recent group, was detected in this sample. The Beijing/W isolates were not tested for katG and gyrA polymorphism polymorphism, of minerals, property of crystallizing in two or more distinct forms. Calcium carbonate is dimorphous (two forms), crystallizing as calcite or aragonite. Titanium dioxide is trimorphous; its three forms are brookite, anatase (or octahedrite), and rutile. , since the fact that they all belong to PGG1 is well documented (26).

In agreement with Brosch et al. (28), we found the TbD1 region in all tested isolates from the predicted ancestral group but not in all tested Beijing/W, PGG2, and PGG3 isolates (Figure 1). We also found that all the tested Delhi isolates lacked TbD1.

Already known spoligotype signatures (16,26-28, 31,32), and a few new variants, were found within the 4 groups defined by MIRU-VNTR analysis (Figure 1 and Table 4). The TbD1+ isolates were characterized by the absence of spacers 29 to 32 and 34, and (except in 4 cases) by the presence of spacer 33. Most isolates (35 of 43, taking into account 2 Indian isolates from the collection of Kremer et al. [16]) also lacked spacers 2 and 3. Based on these results, three fourths of the TbD1+ isolates were included in the spoligotype EAI (Enterprise Application Integration) Refers to various techniques used to share data and business processes in large enterprises. When companies acquire another organization, disparate information systems have to be made to work together. 3 class (33), while 1 isolate belonged to the EAI1 class. The remaining TbD1+ isolates represented new EAI variants. EAI classes 2, 4, and 5 were not found in this collection. Typically, the Beijing/W isolates only harbored spacers 35-43 (with spacers 39 and 40 missing in 1 case) (5,32). As described recently (11), the Delhi isolates shared the block of 9 final spacers (with some internal variation) with the Beijing/W strains but included 2 additional blocks among spacers 1-22. They specifically lacked spacers 4-7, and 23-34. The Delhi types are thus included in the CAS spoligotype family (33). Fourteen and 4 isolates out of 25 (taking into account 1 Indian isolate from the collection of Kremer et al. [16]) conformed to the 2 main spoligotype prototypes, CAS1 and CAS2, respectively (33).

As expected, the prototypes of the Latin American--Mediterranean (LAM, 3 cases), X (1 case), and Y (8 cases) spoligotype families were detected among the isolates of the PGG2/3group. The single PGG3 isolate (ICC399) had a T spoligotype, which includes both PGG2 and PGG3 strains (26,33). Highly similar groupings of the isolates were observed when a dendrogram was built based on spoligotypes alone or on a combination of VNTR and spoligotypes, although the resolution was lower when spoligotyping was used alone (data not shown).

Comparison of Spoligotypes with an International Database

Table 5 shows the results from a comparison of the Indian spoligotypes with SpolDB3.0, a database containing data from >13,000 M. tuberculosis complex isolates obtained worldwide (31). Of 36 different spoligotypes found in the Indian strains, 15 (41.7%) were not present in SpolDB3.0. Most (11, 73%) of these new spoligotypes correspond to PGG1 isolates. Conversely, only 1 Indian isolate had the second most frequent spoligotype worldwide, S53. These observations reflect the current underrepresentation of strains from India in SpolDB3.0 (n = 44).

Discussion

This report describes the diversity of M. tuberculosis strains obtained from patients in various regions in India This is a list of unofficial, or quasi-official regions of India. Some are geographic regions, others ethnic, linguistic, dialect, or cultural regions, and some correspond to historic countries, states or provinces. For ecological regions, see Ecoregions of India. , relying on a conveniently available set of isolates collected between 1997 and 2002. While these data are not representative of all TB patients in those regions and lack information regarding clinical characteristics, they provide valuable first insights into the diversity of circulating M. tuberculosis strains in this country. The excellent congruence observed between the 4 independent sets of genetic markers genetic marker
n.
A gene phenotypically associated with a particular, easily identified trait and used to identify an individual or cell carrying that gene.
 used here lends strong support to the assignment of different prevalent lineages. This congruence is consistent with the clonal population structure of M. tuberculosis (2-4) and reflects the respective informative values of the markers used. In particular, the results show that the use of a large set of VNTR loci simultaneously allows for both reliable identification of genogroups and high-resolution analysis of intralineage diversity, without the limitations that apply to IS6110 fingerprinting or other typing methods used in the few previous molecular studies on Indian isolates. Within the framework of the current evolutionary scenario of M. tuberculosis, which proposes phylogenies based on PGGs and genomic deletion analyses (e.g., TbD1) (2,3,28), we found a striking prevalence of ancestral genotypes (TbD1+) and the concurrent poor representation of the most recent lineages in this Indian collection (PGG2 and especially PGG3). This finding contrasts with the situation in other regions of the world, such as Europe and North and South America South America, fourth largest continent (1991 est. pop. 299,150,000), c.6,880,000 sq mi (17,819,000 sq km), the southern of the two continents of the Western Hemisphere. , where PGG2 and PGG3 constitute most of the M. tuberculosis strains (31).

Ancestral isolates of M. tuberculosis are characterized by the presence of the TbD1 region, which has been recently identified as an evolutionary landmark in the genome of this species. This region was detected initially in a few M. tuberculosis strains belonging to PGG1, as well as in M. canettii, M. bovis, M. africanum, and M. microti, whereas this region was shown to be absent in all PGG2 and PGG3 strains as well as in the other PGG1 strains tested (28). The grouping of all the tested TbD1+ isolates by MIRU-VNTR typing and spoligotyping (16,19, this study) support their assignment to a single lineage (28), the East African-Indian lineage (27). Consistently, all tested representatives of known modern M. tuberculosis genotype families were TbD1-. A similar systematic association has recently been observed in strains from Singapore (34) and from Bangladesh (35), which supports the notion that the deletion of TbD1 occurred as a single evolutionary event in a common ancestor rather than on independent multiple occasions (28).

In this study, all isolates that contain [greater than or equal to] 2 repeats in MIRU-VNTR locus 24 belong to the ancestral (TbD1+ group, and all but 2 isolates containing 1 repeat unit in locus 24 belong to the modern (TbD1-) groups. This correlation, also seen in previous studies on isolates from Singapore (34) and Bangladesh (35), indicates that this locus alone is highly informative in the identification of ancestral and modern M. tuberculosis strains.

The few previously identified TbD1+ strains were isolated from patients from East Africa and South Asia This article is about the geopolitical region in Asia. For geophysical treatments, see Indian subcontinent.
South Asia, also known as Southern Asia
. These strains have low copy numbers of IS6110 (16,28) and belong to cluster I within PGG1 (3). This lineage is distinct from IS6110 low-copy-number strains in PGG2 (3), which was isolated from patients in English-speaking countries (33). IS6110 low- copy-number strains are prevalent with variable proportions among patients from several countries in Southeast Asia Southeast Asia, region of Asia (1990 est. pop. 442,500,000), c.1,740,000 sq mi (4,506,600 sq km), bounded roughly by the Indian subcontinent on the west, China on the north, and the Pacific Ocean on the east.  (36), and the analysis of the available spoligotype data suggests that most of them belong to the TbD1+/EAI lineage (26,31,37). Frequencies of TbD1+/EAI isolates have recently been reported to range from 25% to 50% in Bangladesh (35,36) and Singapore (34). A frequency of 8% has been reported in a study that only used spoligotyping for genetic characterization of 105 isolates from the Delhi area (15). Until now, the highest prevalence of IS6110 low-copy-number isolates ([approximately equal to] 60%) has been observed in southern India (8,9,38). Consistent with these studies, we found that 80% of the samples obtained from the southern regions from India were TbD1+/EAI isolates, although such isolates were found in nearly all regions (Figure 2). Also consistent with our findings, most spoligotypes observed in an ongoing population-based study (>1,200 isolates) in the southern state of Tamil Nadu Tamil Nadu (tăm`əl nä`d), formerly Madras (mədrăs`, mədräs`), state (2001 provisional pop.  were of the EAI3 class (S. Narayanan et al., unpub, data), found to be predominant in our collection (Table 4 and Figure 1).

[FIGURE 2 OMITTED]

The prevalence of these low-copy-number strains in regions of such high endemicity has raised the question of the true extent of genetic variation beyond their restricted IS6110 distribution (9). The MIRU-VNTR typing results obtained here indicate that the genetic diversity in the TbD1+/EAI lineage goes far beyond the commonly observed restricted spectrum of IS6110 low copy-number fingerprints and of known spoligotypes (31,36). For instance, most isolates with identical spoligotype 11 of the predominant EAI3 class in this study were of different MIRU-VNTR types (Figure 1). Moreover, the EAI lineage contains 3 additional spoligo-prototypes (EAI2, 4, and 5) that were absent from the population studied here. In addition, at least 1 group of TbD1+/EAI strains recently isolated in Singapore had high-copy numbers (up to 15) of IS6110 (39). Altogether these observations indicate that the TbD1+ strains constitute a highly diversified lineage, which is consistent with an ancestral phylogenetic phy·lo·ge·net·ic
adj.
1. Of or relating to phylogeny or phylogenetics.

2. Relating to or based on evolutionary development or history.
 position.

In addition to the TbD1+ isolates, 2 other major PGG1 families were well represented in this Indian collection. They were qualified as modern groups by their TbD1- status. The recently identified Delhi type (11), classified as the CAS group by spoligotyping (33), represented approximately one fourth of the total sample. This genogroup made up 60 (72%) of 83 isolates collected from male patients attending 1 hospital and a clinic of the Delhi region over a 1-year period (11) and 38 (36%) of 105 isolates collected from patients attending other health centers in Delhi (15). Although this genogroup is less dominant in this region, representing 5 (20%) of the 26 isolates from Delhi, the Delhi genogroup was well represented among the isolates from northern and central India as well. The second TbD1- PGG1 family detected in this study corresponds to the widespread Beijing/W family, which accounted for 10% of the total sample. Most (7 of 9) of these isolates were from Delhi, where they represented 30% of the isolates studied, in contrast to the 1% to 8% noted in other studies on isolates from Delhi or other Indian regions (11,15,32).

The predominance of M. tuberculosis ancestral strains and the relatively poor representation of the most recent lineages in this Indian collection lend support to the hypothesis that India is a relatively ancient endemic focus of TB (28). On the basis of these findings, we speculate that the Indian subcontinent was an early step of the worldwide expansion of the M. tuberculosis complex, subsequent to the recently proposed emergence of tubercle tubercle (t`bərkyl') [Lat.,=little swelling], small, usually solid, nodule or prominence.  bacilli bacilli /ba·cil·li/ (bah-sil´i) plural of bacillus.

bacilli

see bacillus.
 in eastern Africa millions of years ago (40). However, we acknowledge that, as our collection represents a minuscule minuscule

Lowercase letters in calligraphy, in contrast to majuscule, or uppercase letters. Unlike majuscules, minuscules are not fully contained between two real or hypothetical lines; their stems can go above or below the line.
 fraction of the millions of TB cases in India, genotyping additional isolates from TB patients in this country will be necessary to determine if these initial observations hold true (as suggested by unpublished data from >1,200 isolates from southern Tamil Nadu) or substantially change for a larger fraction of reported cases. Nevertheless, we believe that our data constitute the most solid available foundation for future comparisons of these additional isolates and those obtained from patients in the rest of the world.

Acknowledgments

M. Hanif, V.K. Kataria, B. Malhotra, D. Khandalia, M. Sharma, and several research students from India are gratefully thanked for providing isolates.

This work was supported by a joint grant from the Institut National de la Sante et de la Recherche La Recherche is a monthly French language popular science magazine covering recent scientific news. It is published by the Société d'éditions scientifiques (the Scientific Publishing Group), a subsidiary of Financière Tallandier.  Medicale and the Indian Council Indian Council may refer to:

In India:
  • Indian Council of Agricultural Research, the apex body in agriculture and related allied fields in New Delhi, India
 for Medical Research.

References

(1.) World Health Organization. Global tuberculosis control: surveillance, planning, financing (WH/HTM/TB/2004.331). Geneva Geneva, canton and city, Switzerland
Geneva (jənē`və), Fr. Genève, canton (1990 pop. 373,019), 109 sq mi (282 sq km), SW Switzerland, surrounding the southwest tip of the Lake of Geneva.
: The Organization; 2004.

(2.) Sreevatsan S, Pan X, Stockbauer KE, Connell ND, Kreiswirth BN, Whittam TS, et al. Restricted structural gene polymorphism in the Mycobacterium tuberculosis complex indicates evolutionarily recent global dissemination. Proc Natl Acad Sci U S A. 1997;94:9869-74.

(3.) Gutacker MM, Smoot JC, Migliaccio CA, Ricklefs SM, Hua S, Cousins DV, et al. Genome-wide analysis of synonymous single nucleotide polymorphisms in Mycobacterium tuberculosis complex organisms: resolution of genetic relationships among closely related microbial microbial

pertaining to or emanating from a microbe.


microbial digestion
the breakdown of organic material, especially feedstuffs, by microbial organisms.
 strains. Genetics. 2002;162:1533-43.

(4.) Supply P, Warren RM, Banuls AL, Lesjean S, Van Der Spuy GD, Lewis LA, et al. Linkage disequilibrium linkage disequilibrium
n.
The nonrandom association between two or more alleles such that certain combinations of alleles are more likely to occur together on a chromosome than other combinations of alleles.
 between minisatellite loci supports clonal evolution of Mycobacterium tuberculosis in a high tuberculosis incidence area. Mol Microbiol. 2003;47:529-38.

(5.) Bifani PJ, Mathema B, Kurepina NE, Kreiswirth BN. Global dissemination of the Mycobacterium tuberculosis W-Beijing family strains. Trends Microbiol. 2002; 10:45-52.

(6.) Hirsh AE, Tsolaki AG, DeRiemer K, Feldman MW, Small PM. Stable association between strains of Mycobacterium tuberculosis and their human host populations. Proc Natl Acad Sci U S A. 2004;101: 4871-6. Epub 2004 Mar 23.

(7.) van Embden JD, Cave MD, Crawford JT, Dale JW, Eisenach KD, Gicquel B, et al. Strain identification of Mycobacterium tuberculosis by DNA fingerprinting DNA fingerprinting or DNA profiling, any of several similar techniques for analyzing and comparing DNA from separate sources, used especially in law enforcement to identify suspects from hair, blood, semen, or other biological materials found at : recommendations for a standardized methodology. J Clin Microbiol. 1993;31:406-9.

(8.) Das S, Paramasivan CN, Lowrie DB, Prabhakar R, Narayanan PR. IS6110 restriction fragment length polymorphism restriction fragment length polymorphism
n. Abbr. RFLP
Intraspecies variations in the length of DNA fragments generated by the action of restriction enzymes and caused by mutations that alter the sites at which these enzymes act, changing
 typing of clinical isolates of Mycobacterium tuberculosis from patients with pulmonary tuberculosis pulmonary tuberculosis
n.
Tuberculosis of the lungs.


pulmonary tuberculosis Infectious disease Infection by Mycobacterium tuberculosis
 in Madras Madras.

1 State and former province, India: see Tamil Nadu.

2 City, India: see Chennai.
, south India South India is a commonly used term that is used in India to refer to the South-of-India or Southern India. The Southern part of the Indian peninsula is a linguistic-cultural region of India that comprises the four states of Andhra Pradesh, Karnataka, Kerala and Tamil Nadu and the . Tuber tuber, enlarged tip of a rhizome (underground stem) that stores food. Although much modified in structure, the tuber contains all the usual stem parts—bark, wood, pith, nodes, and internodes.  Lung Dis. 1995;76:550-4.

(9.) Radhakrishnan I, K MY, Kumar RA, Mundayoor S, Harris KA, Jr., Mukundan U, et al. Implications of low frequency of IS6110 in fingerprinting field isolates of Mycobacterium tuberculosis from Kerala, India. J Clin Microbiol. 2001;39:1683.

(10.) Siddiqi N, Shamim M, Amin A, Chauhan DS, Das R, Srivastava K, et al. Typing of drug resistant isolates of Mycobacterium tuberculosis from India using the IS6110 element reveals substantive polymorphism. Infect Genet genet: see civet.  Evol. 2001; 1:109-16.

(11.) Bhanu NV, van Soolingen D, van Embden JD, Dar L, Pandey RM, Seth P. Predominance of a novel Mycobacterium tuberculosis genotype in the Delhi region of India. Tuberculosis (Edinb). 2002;82:105-12.

(12.) Braden CR, Crawford JT, Schable BA. Quality assessment of Mycobacterium tuberculosis genotyping in a large laboratory network. Emerg Infect Dis. 2002;8:1210-5.

(13.) Narayanan S, Sahadevan R, Narayanan PR, Krishnamurthy PV, Paramasivan CN, Prabhakar R. Restriction fragment length polymorphism of Mycobacterium tuberculosis strains from various regions of India, using direct repeat probe. Indian J Med Res. 1997; 106:44-54.

(14.) Mistry NF, Iyer AM, D'Souza DT, Taylor GM, Young DB, Antia NH. Spoligotyping of Mycobacterium tuberculosis isolates from multiple-drug-resistant tuberculosis patients from Bombay, India. J Clin Microbiol. 2002;40:2677-80.

(15.) Singh UB, Suresh N, Bhanu NV, Arora J, Pant H, Sinha S, et al. Predominant tuberculosis spoligotypes, Delhi, India. Emerg Infect Dis. 2004;10:1138-42.

(16.) Kremer K, van Soolingen D, Frothingham R, Haas WH, Hermans PW, Martin C, et al. Comparison of methods based on different molecular epidemiological markers for typing of Mycobacterium tuberculosis complex strains: interlaboratory study of discriminatory power and reproducibility. J Clin Microbiol. 1999;37:2607-18.

(17. Supply P, Magdalena J, Himpens S, Locht C. Identification of novel intergenic repetitive units in a mycobacterial two-component system operon. Mol Microbiol. 1997;26:991-1003.

(18.) Supply P, Mazars E, Lesjean S, Vincent V, Gicquel B, Locht C. Variable human minisatellite-like regions in the Mycobacterium tuberculosis genome. Mol Microbiol. 2000;36:762-71.

(19.) Supply P, Lesjean S, Savine E, Kremer K, van Soolingen D, Locht C. Automated high-throughput genotyping for study of global epidemiology of Mycobaeterium tuberculosis based on mycobacterial interspersed repetitive units. J Clin Microbiol. 2001 ;39:3563-71.

(20.) Mazars E, Lesjean S, Banuls AL, Gilbert M, Vincent V, Gicquel B, et al. High-resolution minisatellite-based typing as a portable approach to global analysis of Mycobaeterium tuberculosis molecular epidemiology molecular epidemiology Molecular medicine An evolving field that combines the tools of standard epidemiology–case studies, questionnaires and monitoring of exposure to external factors with the tools of molecular biology–eg, restriction endonucleases, . Proc Natl Acad Sci U S A. 2001;98:1901-6.

(21.) Cowan LS, Mosher A mosher is a person who is crossed between goth/punk/skater they have long hair and listen to music like slipknot and metal music. Some people call them headbangers. At certain music shows they have something called a mosh pit, basically its a fight pit with loads of people bashing each other.  L, Diem L, Massey JP, Crawford JT. Variable-number tandem repeat typing of Mycobacterium tuberculosis isolates with low copy numbers of IS6110 by using mycobacterial interspersed repetitive units. J Clin Microbiol. 2002;40:1592-602.

(22.) Savine E, Warren RM, van der Spuy GD, Beyers N, van Helden PD, Locht C, et al. Stability of variable-number tandem repeats of mycobacterial interspersed repetitive units from 12 loci in serial isolates of Mycobacterium tuberculosis. J Clin Microbiol. 2002;40:4561-6.

(23.) Frothingham R, Meeker-O'Connell WA. Genetic diversity in the Mycobacterium tuberculosis complex based on variable numbers of tandem DNA repeats. Microbiology. 1998;144:1189-96.

(24.) Roring S, Scott A, Brittain D, Walker I, Hewinson G, Neill S, et al. Development of variable-number tandem repeat typing of Mycobacterium bovis Mycobacterium bovis A mycobacterium that causes a TB-like infection in cows; before pasteurization was common, M bovis spread to humans via contaminated milk : comparison of results with those obtained by using existing exact tandem repeats and spoligotyping. J Clin Microbiol. 2002;40:2126-33.

(25.) Le Fleche flèche  
n.
A slender spire, especially one on a church above the intersection of the nave and transepts.



[French, arrow, flèche, from Old French, arrow, of Germanic origin; see
 P, Fabre M, Denoeud F, Koeck JL, Vergnaud G High resolution, on-line identification of strains from the Mycobacterium tuberculosis complex based on tandem repeat typing. BMC (BMC Software, Inc., Houston, TX, www.bmc.com) A leading supplier of software that supports and improves the availability, performance, and recovery of applications in complex computing environments.  Microbiol. 2002;2:37.

(26.) Soini H, Pan X, Amin A, Graviss EA, Siddiqui A, Musser JM. Characterization of Mycobacterium tuberculosis isolates from patients in Houston, Texas “Houston” redirects here. For other uses, see Houston (disambiguation).
Houston (pronounced /'hjuːstən/) is the largest city in the state of Texas and the
, by spoligotyping. J Clin Microbiol. 2000;38:669-76.

(27.) Sola C, Filliol I, Legrand E, Mokrousov I, Rastogi N. Mycobacterium tuberculosis phylogeny reconstruction based on combined numerical analysis numerical analysis

Branch of applied mathematics that studies methods for solving complicated equations using arithmetic operations, often so complex that they require a computer, to approximate the processes of analysis (i.e., calculus).
 with IS1081, IS6110, VNTR, and DR-based spoligotyping suggests the existence of two new phylogeographical clades. J Mol Evol. 2001;53:680-9.

(28.) Brosch R, Gordon SV, Marmiesse M, Brodin P, Buchrieser C, Eiglmeier K, et al. A new evolutionary scenario for the Mycobacterium tuberculosis complex. Proc Natl Acad Sci U S A. 2002;99:3684-9.

(29.) Kamerbeek J, Schouls L, Kolk A, van Agterveld M, van Soolingen D, Kuijper S, et al. Simultaneous detection and strain differentiation of Mycobacterium tuberculosis for diagnosis and epidemiology. J Clin Microbiol. 1997;35:907-14.

(30.) Warren RM, Victor TC, Streicher EM, Richardson M, van der Spuy GD, Johnson R, et al. Clonal expansion of a globally disseminated lineage of Mycobacterium tuberculosis with low IS6110 copy numbers. J Clin Microbiol. 2004;42:5774-82.

(31.) Filliol I, Driscoll JR, van Soolingen D, Kreiswirth BN, Kremer K, Valetudie G, et al. Snapshot of moving and expanding clones of Mycobacterium tuberculosis and their global distribution assessed by spoligotyping in an international study. J Clin Microbiol. 2003;41 : 1963-70.

(32.) van Soolingen D, Qian L, de Haas de Haas as a surname can refer to:
  • Dirk de Haas(17th century), Dutch merchant
  • Jacob de Haas
  • John Philip De Haas (1735-1786), American soldier
  • William de Haas (1830-1880), Dutch-born American painter
 PE, Douglas JT, Traore H, Portaels F, et al. Predominance of a single genotype of Mycobacterium tuberculosis in countries of east Asia East Asia

A region of Asia coextensive with the Far East.



East Asian adj. & n.
. J Clin Microbiol. 1995;33:3234-8.

(33.) Filliol I, Driscoll JR, van Soolingen D, Kreiswirth BN, Kremer K, Valetudie G, et al. Global distribution of Mycobacterium tuberculosis spoligotypes. Emerg Infect Dis. 2002;8:1347-9.

(34.) Sun YJ, Bellamy R, Lee AS, Ng ST, Ravindran S, Wong SY, et al. Use of mycobacterial interspersed repetitive unit-variable-number tandem repeat typing to examine genetic diversity of Mycobacterium tuberculosis in Singapore. J Clin Microbiol. 2004;42:1986-93.

(35.) Banu S, Gordon SV, Palmer S, Islam R, Ahmed S, Alam KM, et al. Genotypic analysis of Mycobacterium tuberculosis in Bangladesh and prevalence of the Beijing strain. J Clin Microbiol. 2004;42: 674-82.

(36.) Shamputa IC, Rigouts L, Eyongeta LA, El Aila NA, van Deun A, Salim AH, et al. Genotypic and phenotypic phe·no·type  
n.
1.
a. The observable physical or biochemical characteristics of an organism, as determined by both genetic makeup and environmental influences.

b.
 heterogeneity het·er·o·ge·ne·i·ty
n.
The quality or state of being heterogeneous.



heterogeneity

the state of being heterogeneous.
 among Mycobacterium tuberculosis isolates from pulmonary tuberculosis patients. J Clin Microbiol. 2004;42:5528-36.

(37.) Dale JW, Al-Ghusein H, Al-Hashmi S, Butcher P, Dickens AL, Drobniewski F, et al. Evolutionary relationships among strains of Mycobacterium tuberculosis with few copies of IS6110. J Bacteriol. 2003; 185:2555-62.

(38.) Narayanan S, Das S, Garg R, Hari L, Rao VB, Frieden TR, et al. Molecular epidemiology of tuberculosis in a rural area of high prevalence in South India: implications for disease control and prevention. J Clin Microbiol. 2002;40:4785-8.

(39.) Sun Y J, Lee AS, Ng ST, Ravindran S, Kremer K, Bellamy R, et al. Characterization of ancestral Mycobacterium tuberculosis by multiple genetic markers and proposal of genotyping strategy. J Clin Microbiol. 2004;42:5058-64.

(40.) Gutierrez MC, Brisse S, Brosch R, Omais B, Marmiesse M, Supply P, et al. Ancient origin and gene mosaicism of tubercle bacilli. PLoS Pathogens PLoS Pathogens is an open-access scientific journal published by the Public Library of Science. It publishes research and reviews on the biology of pathogens and host-pathogen interactions. . 2005;1 :e5.

M. Cristina Gutierrez, * (1) Niyaz Ahmed, ([dagger]) (1) Eve Willery, ([doble dagger]) Sujatha Narayanan, ([section]) Seyed E. Hasnain, ([dagger]) Devendra S. Chauhan, ([paragraph]) Vishwa M. Katoch, ([paragraph]) Veronique Vincent, * Camille Locht, ([double dagger double dagger
n.
A reference mark () used in printing and writing. Also called diesis.

Noun 1.
]) and Philip Supply ([double dagger])

* Institut Pasteur, Paris, France; ([dagger]) Center for DNA Fingerprinting and Diagnostics, Hyderabad, India; ([double dagger]) Institut Pasteur de Lille, Lille, France; ([section]) Tuberculosis Research Center, Chennai, India; and ([paragraph]) National Jalma Institute for Leprosy leprosy or Hansen's disease (hăn`sənz), chronic, mildly infectious malady capable of producing, when untreated, various deformities and disfigurements.  and Other Mycobacterial Diseases Mycobacterial diseases

Diseases caused by mycobacteria, a diffuse group of acid-fast, rod-shaped bacteria in the genus Mycobacterium. The two most important species are M. tuberculosis (the cause of tuberculosis) and M.
, Agra, India

(1) These authors contributed equally to this article.

Dr Gutierrez is a senior scientist at the Reference Laboratory for Mycobacteria mycobacteria

members of the genus Mycobacterium.


anonymous mycobacteria
see opportunist (atypical) mycobacteria (below).

nontubercular mycobacteria
see opportunist (atypical) mycobacteria (below).
, Institut Pasteur. Her current research interests include the evolution and the molecular epidemiology of the tubercle bacilli and other mycobacteria.

Address for correspondence: Philip Supply, 1NSERM U629, Institut Pasteur de Lille, 1 Rue du Prof Calmette, 59019 Lille CEDEX, France; email: Philip.Supply@pasteur-lille.fr
Table 1. Origin of the Mybacterlum tuberculosis
isolates genotyped in this study

Origin          No. isolates *

Agra                  2
Ahmedabad             7
Bangalore             6
Chandigarh            9
Chennai               9
Haridwar              2
Hyderabad            10
Jaipur                5
Jammu                 6
New Delhi            26
North India           1
Ranchi                5
Shimla                1
Varanasi              2

* Nine isolates, originally selected and for which mixed infection
or laboratory cross-contamination was suspected after typing with
mycobacterial interspersed repetitive unit-variable-number tandem
repeats (see Results), are not included.

Table 2. Available drug susceptibility profiles to rifampin (Rif)
and isoniazid (Inh) of Mycobacterium tuberculosis isolates

                                 Sensitivity
Isolate no.       Origin        to Rif, Inh *

ICC-101          New Delhi          S, R
ICC-102          New Delhi          S, R
ICC-103          New Delhi          R, R
ICC-104          New Delhi          R, R
ICC-105          New Delhi          R, R
ICC-107          New Delhi          S, S
ICC-109          New Delhi          S, R
ICC-114          New Delhi          S, R
ICC-1141           Jammu            S, S
ICC-124          New Delhi          S, R
ICC-128          New Delhi          R, R
ICC-132          Ahmedabad          S, S
ICC-133          Ahmedabad          R, R
ICC-137          Ahmedabad          S, R
ICC-138          Ahmedabad          S, S
ICC-144           Shimla            S, R
ICC-155         Chandigarh          S, R
ICC-161         Chandigarh          S, S
ICC-173         Chandigarh          S, S
ICC-174         Chandigarh          S, S
ICC-19           New Delhi          R, R
ICC-208          New Delhi          S, S
ICC-211          New Delhi          S, S
ICC-212          New Delhi          S, S
ICC-214          New Delhi          S, R
ICC-217          New Delhi          R, R
ICC-219          New Delhi          S, S
ICC-223          New Delhi          S, S
ICC-23           New Delhi          R, R
ICC-244          New Delhi          R, R
ICC-247         Chandigarh          R, R
ICC-248         Chandigarh          S, S
ICC-251         Chandigarh          S, S
ICC-254         Chandigarh          R, R
ICC-257         Chandigarh          R, S
ICC-275          New Delhi          R, S
ICC-286          New Delhi          R, R
ICC-327          New Delhi          R, R
ICC-33           Ahmedabad          R, R
ICC-332           Jaipur            R, R
ICC-37           Ahmedabad          R, R
ICC-399          Bangalore          R, S
ICC-95           Bangalore          S, S
ICC-96           Bangalore          R, R
ICC-98           New Delhi          S, S

* S, susceptible; R, resistant.

Table 3. Conditions for multiplex PCRs of 9 VNTR loci *

                    Conventional
                    designation       VNTR       Mg[Ck.sub.2]
Multiplex   Locus    ([dagger])    length (bp)      (mmol)

Mix E        46      VNTR 2347         57            1.5
             48      VNTR 2461         57
             49      VNTR 3171         54

Mix F        42      VNTR 0424         51            1.5
             43      VNTR 0577         58
             44      VNTR 1895         57

Mix G        47      VNTR 2401         58            3.0
             52      VNTR 3690         58
             53      VNTR 4156         59

                       PCR primer pairs (5' to 3',
Multiplex   Locus        with labeling indicated)

Mix E        46        GCCAGCCGCCGTGCATAAACCT (Fam)
                        AGCCACCCGGTGTGCCTTGTATGAC
             48       ATGGCCACCCGATACCGCTTCAGT (Vic)
                        CGACGGGCCATCTTGGATCAGCTAC
             49        GGTGCGCACCTGCTCCAGATAA (Ned)
                        GGCTCTCATTGCTGGAGGGTTGTAC

Mix F        42         CTTGGCCGGCATCAAGCGCATTATT
                      GGCAGCAGAGCCCGGGATTCTTC (Fam)
             43       CGAGAGTGGCAGTGGCGGTTATCT (Vic)
                        AATGACTTGAACGCGCAAATTGTGA
             44         GTGAGCAGGCCCAGCAGACT (Ned)
                        CCACGAAATGTTCAAACACCTCAAT

Mix G        47        CTTGAAGCCCCGGTCTCATCTGT (Fam
                        ACTTGAACCCCCACGCCCATTAGTA
             52       CGGTGGAGGCGATGAACGTCTTC (Vic)
                        TAGAGCGGCACGGGGGAAAGCTTAG
             53            TGACCACGGATTGCTCTAGT
                          GCCGGCGTCCATGTT (Ned)

* VNTR, variable-number tandem repeats.

([dagger]) VNTR 0577, 2461, 4156, 1895 correspond to ETRC, ETRB,
QUB 4156 and 1895, respectively (23,24). The conditions for PCR
amplification were the same as in (30).

Table 4. Specific spoligotype signatures observed
in this study *

                              Spacers in DR region

PGG    TbD1     Class         Absent          Present

1       +       EA11       29-32, 34,40     All others
1       +       EA13      2-3, 29-32, 34,   All others
                               37-39
1       +       EAIx      2-3, 29-32, 34    Most others
1       -       CAS1        4-7, 23-34      All others
1       -       CAS2        4-10, 23-34     All others
1       -       CASx       4-7 or 4-10,     Most others
                               23-34
1       -      Beijing         1-34         Most others
2-3     -     LAM, X, T        33-36        Most others

* DR, direct repeat; PGG, principal genetic grouping; TbD1, M.
tuberculosis--specific deletion region 1; EAI, East African--
Indian; CAS, Central Asian; LAM, Latin American--Mediterranean.

Table 5. Major spoligotypes in India * ([dagger])

                                                       Geographic
Spoligotype            India, no.    SpoIDB3.0,       distribution
                          (%)          no. (%)      ([double dagger])

S11 ([section])        27 (28.7)     121 (1.03)      ASI, EUR, OCE,
                                                      NAM, CAM, SAM
S26 ([section])        14 (14.9)     102 (0.87)      ASI, EUR, OCE,
                                                        NAM, CAM
S1 ([section])          8 (8.5)     1,282 (10.95)      Ubiquitous
S52 ([section])         4 (4.3)      163 (1.39)        Ubiquitous
S288 ([section])        4 (4.3)       6 (0.051)      ASI, EUR, OCE,
                                                           NAM
S138 ([section])        2 (2.1)       23 (0.20)       EUR, NAM, CAM
S342 ([section])        2 (2.1)       3 (0.026)            NAM
S357 ([section])        2 (2.1)       8 (0.068)       ASI, EUR, NAM
S361 ([section])        2 (2.1)       3 (0.026)         ASI, EUR
ICC09 ([paragraph])     2 (2.1)          --               India
ICC114 ([paragraph])    2 (2.1)          --               India

* n = 94.

([dagger]) Three Indian isolates from the collection of Kremer et
al. (16) were included as references. Only spoligotypes shared by
2 isolates are shown.

([double dagger]) Ubiquitous, spoligotype present in all 7 geographic
areas, AFR, Africa, ASI, Asia, EUR, Europe; OCE, Oceania, SAM, South
America; CAM, Central America; NAM, North America.

([section]) Designation of the spoligotype in SpoIDB3.0.

([paragraph]) New spoligotype not included in SpoIDB3.0.
COPYRIGHT 2006 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2006, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:RESEARCH
Author:Supply, Philip
Publication:Emerging Infectious Diseases
Geographic Code:9INDI
Date:Sep 1, 2006
Words:5926
Previous Article:Changing pattern of human listeriosis, England and Wales, 2001-2004.
Next Article:Extrapulmonary tuberculosis by nationality, the Netherlands, 1993-2001.(RESEARCH)
Topics:



Related Articles
New weapons for tubercular war. (strategies for fighting drug-resistant form of Mycobacterium tuberculosis)(Brief Article)
Genome sequence aids war on tuberculosis.(Brief Article)
Know Your Enemy.(genetic studies of tuberculosis)
Molecular identification of streptomycin monoresistant mycobacterium tuberculosis related to multidrug-resistant W strain. (Research).
Multidrug-resistant tuberculosis in prison inmates, Azerbaijan. (Research).
Mycobacterium tuberculosis Beijing genotype strains associated with febrile response to treatment. (Dispatches).
Mutations in putative mutator genes of Mycobacterium tuberculosis strains of the W-Beijing family. (Research).
Silent nucleotide polymorphisms and a phylogeny for mMycobacterium tuberculosis.(Research)
Multidrug-resistant Mycobacterium tuberculosis, Bangui, Central African Republic.
Prosthetic joint infection by Mycobacterium tuberculosis: an unusual case report with literature review.(Disease/Disorder overview)

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles