Printer Friendly
The Free Library
14,457,828 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Polychlorinated biphenyls disturb differentiation of normal human neural progenitor cells: clue for involvement of thyroid hormone receptors.


Polychlorinated biphenyls polychlorinated biphenyls, (pol´ēklôr´nā´tid bīfē´n  (PCBs) are ubiquitous environmental chemicals that accumulate in adipose tissues over the food chain. Epidemiologic studies have indicated that PCBs influence brain development. Children who are exposed to PCBs during development suffer from neuropsychologic deficits such as a lower full-scale IQ (intelligence quotient intelligence quotient
n. Abbr. IQ
An index of measured intelligence expressed as the ratio of tested mental age to chronological age, multiplied by 100.
), reduced visual recognition memory, and attention and motor deficits. The mechanisms leading to these effects are not fully understood. It has been speculated that PCBs may affect brain development by interfering with thyroid hormone (TH) signaling. Because most of the data are from animal studies, we established a model using primary normal human neural progenitor pro·gen·i·tor
n.
1. A direct ancestor.

2. An originator of a line of descent.



progenitor

ancestor, including parent.


progenitor cell
stem cells.
 (NHNP NHNP Nahuel Huapi National Park (Argentina) ) cells to determine if PCBs interfere with TH-dependent neural differentiation. NHNP cells differentiate into neurons, astrocytes astrocytes (as´trōsī´ts),
n a large, star-shaped cell found in certain tissues of the nervous system. A mass of astrocytes is called astroglia. See also astrocytoma.
, and oligodendrocytes in culture, and they express a variety of drug metabolism enzymes and nuclear receptors. Like triiodothyronine triiodothyronine /tri·io·do·thy·ro·nine/ (tri?i-o?do-thi´ro-nen) one of the thyroid hormones, an organic iodine-containing compound liberated from thyroglobulin by hydrolysis. It has several times the biological activity of thyroxine.  ([T.sub.3]), treatment with the mono-ortho-substituted PCB-118 (2,3",4,4",5-pentachlorobiphenyl; 0.01-1 [micro]M) leads to a dose-dependent increase of oligodendrocyte oligodendrocyte /ol·i·go·den·dro·cyte/ (-den´dro-sit) a cell of the oligodendroglia.

ol·i·go·den·dro·cyte
n.
One of the cells comprising the oligodendroglia.
 formation. This effect was congener congener /con·ge·ner/ (kon´je-ner) something closely related to another thing, as a member of the same genus, a muscle having the same function as another, or a chemical compound closely related to another in composition and exerting  specific, because the coplanar co·pla·nar  
adj.
Lying or occurring in the same plane. Used of points, lines, or figures.



copla·nar
 PCB-126 (3,3',4,4',5-pentachlorobiphenyl) had no effect. Similar to the [T.sub.3] response, the PCB-mediated effect on oligodendrocyte formation was blocked by retinoic acid and the thyroid hormone receptor The thyroid hormone receptor[1] is a type of nuclear receptor that is activated by binding thyroid hormone.[2] Among its most important functions are regulation of metabolism and heart rate.  antagonist NH-3. These results suggest that PCB-118 mimics [T.sub.3] action via the TH pathway. Key words: NH-3, NHNP cells, oligodendrocyte, PCB PCB: see polychlorinated biphenyl.
PCB
 in full polychlorinated biphenyl

Any of a class of highly stable organic compounds prepared by the reaction of chlorine with biphenyl, a two-ring compound.
, retinoic acid, thyroid hormone receptors. doi:10.1289/ehp.7793 available via http://dx.doi.org/[Online 18 April 2005]

**********

Polychlorinated biphenyls (PCBs) are anthropogenic an·thro·po·gen·ic  
adj.
1. Of or relating to anthropogenesis.

2. Caused by humans: anthropogenic degradation of the environment.
 industrial chemicals, the production of which was banned in the 1970s because of their presumed carcinogenicity carcinogenicity /car·ci·no·ge·nic·i·ty/ (kahr?si-no-je-nis´i-te) the ability or tendency to produce cancer.

carcinogenicity

the ability or tendency to produce cancer.
 (Chana et al. 2002). However, these chemicals are still present in the food chain; they accumulate in animal and human tissues and are among the most abundant persistent organic pollutants found in humans (DeKoning and Karmaus 2000; Kim et al. 2004). Depending on their degree of chlorination chlorination Public health Addition of chlorinated compounds to drinking water as disinfectants. Cf Ozonation. , they are metabolized to their hydroxy- and/or sulfur-containing metabolites Metabolites
Substances produced by metabolism or by a metabolic process.

Mentioned in: Interactions
 (Haraguchi et al. 1997). PCBs can cross the placenta, and infants are exposed via contaminated breast milk (DeKoning and Karmaus 2000).

Epidemiologic studies have indicated that PCBs influence brain development (reviewed by Schantz et al. 2003). Children who are exposed during development exhibit neuropsychologic deficits such as lower full-scale IQ (intelligence quotient), reduced visual recognition memory, and attention and motor deficits (Ayotte et al. 2003; Darvill et al. 2000; Huisman et al. 1995a, 1995b; Osius et al. 1999; Walkowiak et al. 2001). Results from studies in rodents supported these findings (Berger et al. 2001; Lilienthal et al. 1990; Roegge et al. 2000; Widholm et al. 2001). PCBs decrease circulating levels of thyroxine ([T.sub.4]) in animals (Brouwer et al. 1998; Gauger GAUGER. An officer appointed to examine all tuns, pipes, hogsheads, barrels, and tierces of wine, oil, and other liquids, and to give them a mark of allowance, as containing lawful measure.  et al. 2004; Meerts et al. 2002). The neuropsychologic findings in offspring after developmental exposure to PCBs overlap with those described for maternal thyroid insufficiency (Haddow et al. 1999; Morreale et al. 2000; Pop et al. 1999). However, exposure at doses that lower serum thyroid hormone (TH) did not always produce signs of hypothyroidism hypothyroidism: see thyroid gland.  [e.g., no elevation in TSH TSH thyroid-stimulating hormone; see thyrotropin.

TSH
abbr.
thyroid-stimulating hormone


Thyroid-stimulating hormone (TSH) 
 (Barter and Klaassen 1992; Kolaja and Klaassen 1998), no lowering of body weight of rat pups (Zoeller et al. 2000), and acceleration of eye opening in rat pups that can also be caused by high levels of TH (Goldey et al. 1995)].

Epidemiologic studies do not uniformly find an association between PCBs and thyroid homeostasis homeostasis

Any self-regulating process by which a biological or mechanical system maintains stability while adjusting to changing conditions. Systems in dynamic equilibrium reach a balance in which internal change continuously compensates for external change in a feedback
. A negative correlation between circulating levels of TH and PCB exposure and a positive correlation between the TH-regulating hormone thyrotropin thyrotropin (thī'rätrō`pĭn) or thyroid-stimulating hormone (TSH), hormone released by the anterior pituitary gland that stimulates the thyroid gland to release thyroxine.  (TSH) and PCB exposure have been observed (Osius et al. 1999; Schell et al. 2002). Others found no association between PCB exposure and disturbances of the TH pathway. This may be due to comparing combined high- and low-exposure groups to the reference group. Nevertheless, all observed hormone levels in these epidemiologic studies were within the normal range (Hagmar 2003) [i.e., accidental exposure to PCBs was not associated with overt hypothyroidism (Nagayama et al. 2001)].

Because there is no clear relationship between PCB exposure, blood TH levels, and symptoms of hypothyroidism in animals or in humans, several investigators have speculated that PCBs may affect brain development by directly interfering with TH signaling (McKinney and Waller 1998; Porterfield 2000; Porterfield and Hendry 1998). Dowling and Zoeller (2000) showed that RC3/neurogranin expression in the fetal rat brain is controlled by TH of maternal origin. This laboratory also demonstrated that the technical PCB mixture Aroclor 1254 regulated the TH-dependent genes myelin basic protein Myelin basic protein (MBP) is a protein believed to be important in the process of myelination of nerves in the central nervous system (CNS).

MBP was initially sequenced in 1979 after isolation from myelin membranes [1]
 and RC3/neurogranin in a TH-like manner in animals (Zoeller et al. 2000). Thus, despite the anti-thyroid effect of PCBs on serum TH, they seem to act like TH at the cellular level.

On the basis of these findings and became no one has critically tested the hypothesis that PCBs can influence developmental events in the human brain, we asked two questions: a) Do PCBs have a TH agonistic/antagonistic effect on human neural development? and b) Which mechanisms are involved? For these purposes we established the model of normal human neural progenitor (NHNP) cells (Brannen and Sugaya 2000), which allow us to study the effect of these environmental chemicals on neural differentiation. Most studies on the effects of PCBs use Aroclor, which consists of many different PCB congeners. Rather than deal with a heterogeneous group, we chose two different specific PCB congeners: PCB-118, a compound with weak dioxin-like activity, and PCB-126, a congener with strong dioxin-like properties (van den Berg Van den Berg is the surname of:
  • Rudolf van den Berg (born 1949), Dutch director
  • Albert van den Berg (born 1976), South African rugby player
  • Jan Hendrik van den Berg (born 1914), Dutch psychologist
  • Janwillem van den Berg (1920-1985), Dutch speech scientist
 et al. 1998). We applied the single congener approach to identify specific PCB involvement in the disturbance of neural differentiation.

Materials and Methods

Chemicals. Triiodothyronine ([T.sub.3]; Sigma-Aldrich, Munchen, Germany) was diluted in ethanol at a concentration of 300 mM. Ortho-substituted PCB-118 (2,3',4,4',5-pentachlorobiphenyl), coplanar PCB- 126 (3,3',4,4",5-pentachlorobiphenyl (both from Okometric GmbH, Bayreuth, Germany), all-trans-retinoic acid (RA; Sigma-Aldrich) and the TH antagonist NH-3 (Nguyen et al. 2002) were diluted in DMSO DMSO dimethyl sulfoxide.

DMSO
n.
Dimethyl sulfoxide; a colorless hygroscopic liquid obtained from lignin, used as a penetrant to convey medications into the tissues.


DMSO,
n.
 (Sigma-Aldrich) at stock concentrations of 1.53, 1.59, 10, and 10 mM, respectively. Benzo(a)pyrene (BAP BAP - 1. An early system used on the IBM 701.

[Listed in CACM 2(5):16 (May 1959)].
; Sigma-Aldrich) was diluted in tetrahydrofuran tetrahydrofuran: see furfural.  (10 mM).

Cell culture and treatment. NHNP cells were purchased from Cambrex BioScience (Verviers, Belgium) and cultured as neurospheres in NPMM (Neural Progenitor Maintenance Medium; Cambrex BioScience) at 37[degrees]C with 5% C[O.sub.2]. Medium was changed every 2-3 days. Upon significant growth (0.7-ram diameter), spheres were chopped with a McIlwaine tissue chopper as previously described (Svendsen et al. 1998); the resultant cubes formed new spheres within hours and were named according to increasing passage after each chopping event (passages 1-7).

For treatment of neurospheres, chemicals were diluted in NPMM to the following final concentrations: 30 nM [T.sub.3]; 0.01 [micro]M, 0.1 [micro]M and 1 [micro]M PCB-118 and PCB-126; 10 [micro]M BAP; 1 [micro]M each RA and NH-3; and 0.065% DMSO. We treated 3-10 spheres with a diameter of approximately 0.4 mm each for 7 days before plating for differentiation. Spheres were treated with each chemical alone or with a cotreatment containing PCB-118 and either NH-3 or RA for 1 week. Differentiation of NHNP cells was initiated by growth factor withdrawal and plating onto poly-D-lysine coated chamber slides (BD Biosciences, Erembodegem, Belgium). Neurospheres were plated in a defined medium consisting of Dulbecco modified Eagle medium (DMEM DMEM Dulbecco's Modified Eagle's Medium (for cell culture growth)
DMEM Design Manufacture and Engineering Management Department
)/F12 (3:1) supplemented with N2 (Invitrogen GmbH, Karlsruhe, Germany). After differentiating for 2 days, cells were fixed in 4% paraformaldehyde paraformaldehyde: see formaldehyde.  for 30 min and stored in phosphate-buffered saline (PBS PBS
 in full Public Broadcasting Service

Private, nonprofit U.S. corporation of public television stations. PBS provides its member stations, which are supported by public funds and private contributions rather than by commercials, with educational, cultural,
) at 4[degrees]C until immunostaining was performed.

Immunocytochemistry im·mu·no·cy·to·chem·is·try
n.
The study of cell constituents by immunologic methods, such as the use of fluorescent antibodies.



immunocytochemistry
. Fixed slides were washed two times for 5 min each in PBS. Slides were incubated with the following primary antibodies: a) double staining beta(III)tubulin tubulin /tu·bu·lin/ (too´bu-lin) the constituent protein of microtubules.

tu·bu·lin
n.
A globular protein that is the structural constituent of microtubules.
 1:100 and glial fibrillary acidic protein Glial fibrillary acidic protein (GFAP) is an intermediate filament (IF) protein that is found in glial cells such as astrocytes. First described in 1971[1], GFAP is a type III IF protein that maps, in humans, to 17q21.  (GFAP GFAP glial fibrillary acidic protein. ) 1:1,000 (both from Sigma-Aldrich) in PBS containing 0.3% Triton X-100, or b) mouse antioligodendrocyte marker O4 1:15 (Chemicon, Temecula, CA, USA) in PBS with 10% goat serum for 1 hr at 37[degrees]C followed by three 10-min washes with PBS. We used fluorescein isothiocyanate (FITC FITC

fluorescein isothiocyanate; used as a fluorescent label for proteins, especially antibodies.
)- and/or Rhodamine rhodamine /rho·da·mine/ (ro´dah-men) any of a group of red fluorescent dyes used to label proteins in various immunofluorescence techniques.  Red-coupled secondary antibodies (1:100 each; Jackson ImmunoResearch, Dianova GmbH, Hamburg, Germany) for detection by incubating slides for 30 min at 37[degrees]C, followed by three 10-min washes with PBS. In the third wash, we added 0.1 [micro]g/mL Hoechst for nuclear staining. After brief drying, slides were mounted with Vectashield Mounting Medium (Vector Laboratories, Burlingame, CA, USA), covered with cover glass, and sealed with nail polish.

Slides were examined using a fluorescent microscope (Olympus, Hamburg, Germany), and photographs were taken with a ColorView XS digital camera (Olympus). We determined the number of O4-positive oligodendrocytes for each individual sphere by manual counting.

Statistical analysis. The counts were approximately lognormally distributed. Therefore, we used the geometric mean and the standard deviation of the geometric mean. The t-test was performed after logarithmic logarithmic

pertaining to logarithm.


logarithmic relationship
when the logs of two variables plotted against each other create a straight line.
 transformation of the values, and each treatment was compared to its respective control. The inhibition values were not logarithmically log·a·rithm  
n. Mathematics
The power to which a base, such as 10, must be raised to produce a given number. If nx = a, the logarithm of a, with n as the base, is x; symbolically, logn a = x.
 transformed.

RNA RNA: see nucleic acid.
RNA
 in full ribonucleic acid

One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic
 preparation and reverse transcription polymerase chain reaction “RT-PCR” redirects here. For real-time polymerase chain reaction, also called quantitative real time polymerase chain reaction or kinetic polymerase chain reaction, see real-time polymerase chain reaction. . Total RNA was prepared from 10-15 pooled untreated and undifferentiated spheres (passages 0-2) using the Absolutely RNA Microprep Kit (Stratagene, La Jolla, CA, USA). Reverse transcription polymerase chain reaction (RT-PCR RT-PCR

reverse transcriptase-polymerase chain reaction. See PCR1.
) was performed as previously described (Dohr et al. 1995). Sequences and annealing annealing (ənēl`ĭng), process in which glass, metals, and other materials are treated to render them less brittle and more workable.  temperatures of the PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
 primers are listed in Table 1. Fragments were separated on a 3% agarose agarose

more highly purified form of agar with similar uses to agar and widely used in the separation of nucleic acid fragments.
 gel containing ethidium bromide and visualized under ultraviolet light. We used a 100-bp marker (peqlab, Erlangen, Germany) to estimate the appropriate sizes of the PCR fragments.

Results

Cultivation and molecular characterization of NHNP cells. Neurospheres were successfully kept in suspension culture over several months. When they exceeded 0.7 mm in diameter, they were passaged by chopping into 0.3-mm cubes. This passaging was performed up to seven times during the lifespan of the NHNP cells. Plating of spheres onto poly-D-lysine-coated chamber slides under withdrawal of growth factors resulted in quick radial outgrowth and differentiation of the cells (Figure 1). After immunostaining, the differentiated cells were identifed as neurons, astrocytes, and oligodendrocytes (Figure 2). Furthermore, neurons seem to form a neuronal network.

[FIGURES 1-2 OMITTED]

To determine molecular characterization of NHNP cells we performed RT-PCRs of cell type-specific genes throughout the first three passages. We could identify typical gene products for the three different cell lineages in undifferentiated neurospheres: neuron specific enolase enolase /eno·lase/ (e´no-las) an enzyme that catalyzes the dehydration of 2-phosphoglycerate to form phospho, a step in the pathway of glucose metabolism.  (NSE NSE - Network Software Environment: a proprietary CASE framework from Sun Microsystems. ) for neurons, GFAP for astrocytes (Figure 3), and proteolipid protein with its splicing splicing /splic·ing/ (spli´sing)
1. the attachment of individual DNA molecules to each other, as in the production of chimeric genes.

2. RNA s.
 variant dm20 (data not shown) for oligodendrocytes. Finding these cell-specific markers in undifferentiated cells implies that specific cell fate is determined before plating and differentiation of cells.

[FIGURE 3 OMITTED]

To ascertain if NHNP cells are suitable for neurotoxicologic studies, we characterized them for their expression of genes playing a role in xenobiotic xen·o·bi·ot·ic
adj.
Foreign to the body or to living organisms. Used of chemical compounds.

n.
A xenobiotic chemical.



xenobiotic

any substance, harmful or not, that is foreign to the animal's biological system.
 metabolism. The results obtained from undifferentiated neurospheres are shown in Figure 3. NHNP cells express the aryl hydrocarbon receptor The Aryl hydrocarbon receptor (AhR) is member of the family of basic-helix-loop-helix transcription factors. AhR is a cytosolic transcription factor that is normally inactive, bound to several co-chaperones.  (AhR) and the AhR repressor repressor: see nucleic acid.  (AhRR), which represent central proteins in the regulation of AhR battery genes. Concerning phase 1 enzymes, we could detect gene products for cytochrome P450 (CYP CYP

In currencies, this is the abbreviation for the Cyprus Pound.

Notes:
The currency market, also known as the Foreign Exchange market, is the largest financial market in the world, with a daily average volume of over US $1 trillion.
)1A1, CYP1B1, and CYP2D6, whereas CYP2A6, CYP2B CYP2B Cytochrome P450 2B 6, CYP2C9, CYP2C19, and CYP3A4 were not expressed. With regard to phase 2 enzymes, NHNP cells do express glutathione S-transferase (GST GST
abbr.
Greenwich sidereal time


GST (in Australia, New Zealand, and Canada) Goods and Services Tax
)M1 and GSTT GSTT Generation Skipping Transfer Tax
GSTT Geological Society of Trinidad & Tobago
1, but are abundant for UDP-glucuronosyltransferase (UGT UGT
abbr.
urgent (telegram)
)1A6. Hence, NHNP cells have the ability to metabolize me·tab·o·lize
v.
1. To subject to metabolism.

2. To produce by metabolism.

3. To undergo change by metabolism.



metabolize

to subject to or be transformed by metabolism.
 xenobiotics.

Our objective was to investigate endocrine disruption of TH homeostasis in NHNP cells; thus we studied the expression of genes coding for thyroid hormone receptors (TR), retinoid retinoid /ret·i·noid/ (ret´i-noid)
1. resembling the retina.

2. retinal, retinol, or any structurally similar natural derivative or synthetic compound, with or without vitamin A activity.
 acid (RAR RAR Retinoic Acid Receptor
RAR Resource Adapter Archive (J2EE)
RAR Royal Australian Regiment
RAR Risk Assessment Report
RAR Roshal Archive (WinRAR compressed file format; file extension) 
), and retinoid X receptors (RXR RXR Retinoid X Receptor
RXR Resource Exchange Register
), which are crucial molecules in hormone signal transduction. Undifferentiated NHNP cells express TR[[alpha].sub.1], [[beta].sub.1], and [[beta].sub.2], as well as RAR[alpha] and [beta] and RXR[alpha], [beta], and [gamma]. Therefore they represent a suitable cell model for investigating thyroid hormone disruption.

Effects of [T.sub.3] and PCBs on NHNP cells. Our initial goal was to investigate the mechanisms leading to disturbance of human brain development in a human in vitro model. Because disruption of thyroid hormone signaling is suspected to be involved in impairment of intellectual development by PCBs (reviewed by Zoeller and Crofton 2000) and because the timing of oligodendrocyte development seems to be dependent on TH (reviewed by Konig and Moura 2002), we investigated the occurrence of oligodendrocytes during differentiation of NHNP cells. Therefore, undifferentiated neurospheres were treated with 30 nM [T.sub.3] for 1 week. After 2 additional days of differentiation, we found a significant increase in the number of oligodendrocytes formed compared to the medium controls (Figure 4). Treating neurospheres with PCB-118 for 1 week also led to an increase in oligodendrocyte formation, whereas PCB-126 had no effect. It is noteworthy that the solvent DMSO shows some intrinsic effect in this system (Figure 4). Thus, PCB- 118 seems to have a TH-like effect in NHNP cells.

[FIGURE 4 OMITTED]

Antagonism of [T.sub.3] effects with RA and NH-3. To determine whether the TH-like effect of PCB-118 is mediated by TH receptors, we cotreated NHNP cells with 30 nM [T.sub.3], 1[micro]M PCB-118, 1 [micro]M RA, and 1 [micro]M NH-3, or in combination. After 1 week, we counted the number of oligodendrocytes in the neurospheres. Both RA and NH-3 treatment prohibited the formation of oligodendrocytes by [T.sub.3] and PCB-118 while having no intrinsic activity themselves (Figure 5). These results support the conclusion that PCB-118 acts by interfering with the TR complex.

[FIGURE 5 OMITTED]

Discussion

It is now generally accepted that developmental exposure to drugs or chemicals can have adverse effects on the structure or function of the nervous system. Identification of such substances resulted mainly from epidemiologic data and animal studies. It is important to develop in vitro approaches because, in some cases, severe species differences can exist (Harry et al. 1998; Tilson 1996). In this article, we characterize an in vitro human neural model. To demonstrate the toxicologic usefulness of this model, we have shown the effects of two different PCB congeners on neural development. Although the ability of PCB congeners to induce cytochrome P450 enzymes has been intensively studied in rats (Parkinson et al. 1983), AhR-dependent toxic equivalency factors were revised at an expert meeting organized by the World Health Organization (van den Berg et al. 1998). In this report, van den Berg et al. (1998) described PCB-118 as a compound with weak dioxin-like activity and PCB-126 as a congener with strong dioxin-like properties. The present findings demonstrate that an individual PCB congener known to widely contaminate human populations can alter the course of neural differentiation in primary NHNP cells. This effect was restricted to PCB-118, which has weak dioxin-like activity, and was not observed following treatment with PCB-126, a dioxin-like congener, despite the fact that these cells express the dioxin receptor (AhR). Moreover, the effect of PCB exposure on oligodendrocyte differentiation was similar to the effect of [T.sub.3] and could be blocked by the [T.sub.3] antagonist NH-3. Therefore, these findings suggest that nondioxin-like PCB congeners such as PCB-118 may directly interfere with TH signaling in the developing human brain, altering the course of neural differentiation and potentially accounting for the observation that exposure to PCBs is linked to cognitive deficits in the human population.

We are the first to establish a human primary cell model for investigating endocrine disruption in neural development. NHNP cells, which have the ability to differentiate into the three major cell types of the human brain--neurons, astrocytes, and oligodendrocytes (Figure 2)--formed the basis of this model. The number of oligodendrocytes was relatively low, with approximately 30% of the differentiated cells being neurons and approximately 70% appearing as astrocytes (data not shown). Other laboratories have reported a distinct distribution pattern of neurons and glia cells in human neurospheres (Buc-Caron 1995; Caldwell et al. 2001; Kanemura et al. 2002; Messina et al. 2003; Piper et al. 2001). These differences may be due to culture conditions, ages of the embryos/fetuses, or the brain areas from which the cells were prepared. Nevertheless, the low abundance of oligodendrocytes in NPHH cells provides a very sensitive system to identify agents that induce their differentiation.

Two important features of our in vitro model support their use in studies of chemical exposure on neurodevelopment: their xenobiotic metabolic capacity and their TH signal transduction machinery, mRNA analyses reveal that NHNP cells express a variety of phase 1 and phase 2 enzymes (Figure 3), which indicates that the cell may be capable of xenobiotic metabolism. This is important because the parent PCB congeners may be metabolized before developing toxicity (James 2001). In regard to the expression pattern of phase 1 and phase 2 enzymes, no data are available for the developing human brain. However, in adult brain, the expression of CYPs differs partially from NHNP cells (Nishimura et al. 2003); we did not identify CYP2A6 or CYP3A4 expression in NHNP cells, but adult brain exhibits a relatively high abundance of these enzymes compared with CYP1A CYP1A Cytochrome P450 1A 1 expression. In contrast, neurospheres expressed CYP1A1, CYP1B1, and CYP2D6. These enzymes are also present in adult brain (Nishimura et al. 2003). Furthermore, NHNP cells express phase 2 enzymes; GSTM GSTM Gatespace Telematics (supplier of systems and components for telematics)
GSTM General System Test Module
1 and GSTT1 were present in NHNP cells and were found in human brain tissue as well (Sherratt et al. 1997). To the contrary, human adult brain, but not NHNP cells, expressed UGT1A6 (King et al. 1999). Because of the abundance of phase 1 and phase 2 enzymes, we consider NHNP cells to be a suitable toxicologic model for studying the effects of xenobiotics on the human developing nervous system.

TH and RA are fundamental for brain development (reviewed by Bernal et al. 2003 and by McCaffery et al. 2003). They exert their actions through nuclear hormone receptors (i.e., TR, RAR, and RXR). An important premise for investigating endocrine disruption of the thyroid hormone system by PCB is expression of the involved receptors; TR[[alpha].sub.1], [[beta].sub.1], and [[beta].sub.2], as well as all RAR and RXR isoforms, with exception of RARg, were present in NHNP cells. This is in agreement with the distribution of these receptors in adult rodent brains (Zetterstrom et al. 1999). TR mRNA and protein was also detected in human fetal brain (Bernal and Pekonen 1984; Kilby et al. 2000).

In the present study, we found that the mono-ortho-substituted PCB-118, as well as TH, leads to an increased formation of oligodendrocytes in NHNP cells. The development of oligodendrocytes, which are the myelin myelin /my·elin/ (mi´e-lin) the lipid-rich substance of the cell membrane of Schwann cells that coils to form the myelin sheath surrounding the axon of myelinated nerve fibers.  producing cells in the central nervous system, is dependent on TH, which aids proliferation and survival of oligodendrocyte preprogenitor cells (Barres et al. 1994; Ben Hur et al. 1998; Schoonover et al. 2004). The importance of TH for oligodendrocyte formation was further confirmed in hypothyroid Hypothyroid
Having too little thyroxin stimulation.

Mentioned in: Goiter

hypothyroid adjective Referring to hypothyroidism, see there
 animals exhibiting fewer numbers of oligodendrocytes than control animals (Ahlgren et al. 1997).

PCBs have been observed to have an intrinsic TH-like effect: rat pups exposed to Aroclor 1254 opened their eyes at an earlier time point, an effect that is elicited with an excess of [T.sub.4] (Brosvic et al. 2002; Goldey et al. 1995). In addition, in pregnant animals Aroclor treatment led to an increased expression of TH-dependent genes such as RC3/ neurogranin and myelin basic protein in fetal brains (Zoeller et al. 2000), although PCB can cause a decrease of serum TH levels (Gauger et al. 2004; Meerts et al. 2002; Morse et al. 1993, 1996). Most studies performed on the effects of PCBs used Aroclor, technical mixtures of PCBs containing planar and nonplanar congeners. Because of the heterogeneity of these mixtures, we decided to apply a single congener approach with two different pentachlorbiphenyls that have weak and strong dioxin-like activities, respectively. Our results show for the first time that PCB-118 exerts a TH-like effect on a cellular level in primary human cells by increasing the number of oligodendrocytes (Figure 4).

In our study of the molecular mechanism of PCB effects on oligodendrocytes, we investigated the TH-like effect of PCB-118 and whether it is mediated through the TH receptor complex. Therefore, we performed the experiments in the presence of the specific TR antagonist NH-3. NH-3 binds to the ligand-binding domain of the TRs, with selectivity for TR[[beta] over TR[alpha], leading to a conformational change of the receptor with release of TR corepressors. Unlike TH, NH-3 prohibits the subsequent recruitment of TR coactivators. Specificity of TR[beta] inhibition was shown in vitro and in vivo (Lim et al. 2002; Nguyen et al. 2002). In the presence of NH-3 the formation of oligodendrocytes by TH and PCB-118 was blocked (Figure 5A), which may indicate that the TR[beta] complex is involved in PCB-118-mediated effects on oligodendrocyte differentiation. Because Gauger et al. (2004) showed that a large variety of PCBs, including PCB-118, and their metabolites do not competitively bind to TR, we speculate that the TH-like effect of PCB-118 on neural differentiation is due to facilitation of coactivator binding.

In another approach to investigate whether PCB-118 acts through the TR complex, we cotreated NHNP cells with RA. As shown in Figure 5B, RA anticipated oligodendrocyte formation induced by TH or PCB-118 treatment. RA binds to the RAR receptor, which shares its heterodimerization partner RXR with several other nuclear receptors including TR (reviewed by Rowe 1997). Therefore, we suggest that antagonism of TH or PCB-118 by RA is caused by competition over RXR. A similar antagonism of TH by RA has been described by Davis and Lazar (1992), and it has been hypothesized that participation of RXR in other activation pathways may modify the cellular response to TH (Sarlieve et al. 2004).

Regarding the metabolic capacity of these progenitor cells, we cannot exclude that the observed induction of oligodendrocytes by PCB-118 is a result of PCB metabolites rather than the parent substance, and further experiments are needed. However, the observed effect is congener specific because PCB-126 did not increase oligodendrocytes in NHNP cells. PCB-126 is a coplanar biphenyl biphenyl /bi·phen·yl/ (-fen´il) diphenyl.

polychlorinated biphenyl  (PCB) any of a group of chlorinated derivatives of biphenyl, used as heat-transfer agents and electrical insulators; they are
 that activates the AhR, whereas PCB-118 is mono-ortho substituted and exerts only weak AhR agonist activity (Hestermann et al. 2000). The inability of BAP, a classical AhR agonist, to induce oligodendrocyte formation in NHNP cells (data not shown) supports the suggestion that the AhR is not involved in the disturbance of neural differentiation.

In summary, we developed a primary human in vitro model for investigating endocrine disruption of neural development. We identified the mono-ortho-substituted PCB-118 as a TH disrupter on human neural development because it induced oligodendrocyte formation in NHNP cells. In contrast, PCB-126, a coplanar AhR ligand, showed no hormone-like activity. The effects seen after PCB-118 treatment seem to be mediated through the TR complex because they can be antagonized by the TR antagonist NH-3 and by RA. The precise molecular mechanisms require further elucidation.

We thank U. Kramer for her help with the statistics.

This work was supported by the Bundesministerium for Umwelt (BMU BMU

basic metabolic unit or bone remodeling unit.
 B1), and by a grant from the U.S. National Institutes of Health (DK52798).

The authors declare they have no competing financial interests.

Received 25 November 2004; accepted 18 April 2005.

REFERENCES

Ahlgren SC, Wallace H, Bishop J, Neophytou C, Raff MC. 1997. Effects of thyroid hormone on embryonic oligodendrocyte precursor cell Oligodendrocyte precursor cells in nervous tissue cells precede oligodendrocytes, and may also be able to generate neurons and astrocytes. The principle function of oligodendrocytes is to provide support to axons and to produce the Myelin sheath, which insulates and lowers the  development in vivo and in vitro. Mol Cell Neurosci 9:420-432.

Ayotte P, Muckle G, Jacobson JL, Jacobson SW, Dewailly E. 2003. Assessment of pre- and postnatal postnatal /post·na·tal/ (-na´t'l) occurring after birth, with reference to the newborn.

post·na·tal
adj.
Of or occurring after birth, especially in the period immediately after birth.
 exposure to polychlorinated biphenyls: lessons from the Inuit Cohort Study. Environ Health Perspect 111:1253-1258.

Barres BA, Lazar MA, Raff MC. 1994. A novel role for thyroid hormone, glucocorticoids Glucocorticoids
Any of a group of hormones (like cortisone) that influence many body functions and are widely used in medicine, such as for treatment of rheumatoid arthritis inflammation.
 and retinoic acid in timing oligodendroeyte development. Development 120:1097-1108.

Barter RA, Klaassen CD. 1992. UDP-glucuronosyltransferase inducers reduce thyroid hormone levels in rats by an extrathyroidal mechanism. Toxicol Appl Pharmacol 113:36-42.

Ben Hur T, Rogister B, Murray K, Rougon G, Dubois-Dalcq M. 1998. Growth and fate of PSA-NCAM+ precursors of the postnatal brain. J Neurosci 18:5777-5788.

Berger DF, Lombardo JP, Jeffers PM, Hunt AE, Bush B, Casey A, et al. 2001. Hyperactivity and impulsiveness in rats fed diets supplemented with either Aroclor 1248 or PCB-contaminated St. Lawrence River fish. Behav Brain Res 126:1-11.

Bernal d, Guadano-Ferraz A, Morte B. 2003. Perspectives in the study of thyroid hormone action on brain development and function. Thyroid 13:1005-1012.

Bernal J, Pekonen F. 1984. Ontogenesis ontogenesis /on·to·gen·e·sis/ (on?to-jen´e-sis) ontogeny.

on·to·gen·e·sis
n.
See ontogeny.
 of the nuclear 3,5,3'-triiodothyronine receptor in the human fetal brain. Endocrinology 114:677-679.

Brannen CL, Sugaya K. 2000. In vitro differentiation of multipotent human neural progenitors in serum-free medium. Neuroreport 11:1123-1128.

Brosvic GM, Taylor JN, Dihoff RE. 2002. Influences of early thyroid hormone manipulations: delays in pup motor and exploratory behavior are evident in adult operant operant /op·er·ant/ (op´er-ant) in psychology, any response that is not elicited by specific external stimuli but that recurs at a given rate in a particular set of circumstances.

op·er·ant
adj.
 performance. Physiol Behav 75:697-715.

Brouwer A, Morse DC, Lans MC, Schuur AG, Murk murk also mirk  
n.
Partial or total darkness; gloom.

adj. Archaic
Partially or totally dark; gloomy.



[Middle English mirke, from Old Norse myrkr
 Ad, Klasson-Wehler E, et al. 1998. Interactions of persistent environmental organohalogens with the thyroid hormone system: mechanisms and possible consequences for animal and human health. Toxicol Ind Health 14:59-84.

Buc-Caron MH. 1995. Neuroepithelial neuroepithelial

pertaining to the neuroepithelium.


neuroepithelial body
an APUD respiratory system cell occurring in the bronchiolar mucosa either singly or as small aggregates.
 progenitor cells explanted from human fetal brain proliferate and differentiate in vitro. Neurobiol Dis 2:37-47.

Caldwell MA, He X, Wilkie N, Pollack S, Marshall G, Wafford KA, et al. 2001. Growth factors regulate the survival and fate of cells derived from human neurospheres. Nat Biotechnol 19:475-479.

Chana A, Concejero MA, de Frutos M, Gonzalez MJ, Herradon B. 2002. Computational studies on biphenyl derivatives. Analysis of the conformational mobility, molecular electrostatic potential, and dipole moment of chlorinated chlorinated /chlo·ri·nat·ed/ (klor´i-nat?ed) treated or charged with chlorine.

chlorinated

charged with chlorine.


chlorinated acids
some, e.g.
 biphenyl: searching for the rationalization of the selective toxicity of polychlorinated biphenyls (PCBs). Chem Res Toxicol 15:1514-1526.

Darvill T, Lonky E, Reihman J, Stewart P, Pagano J. 2000. Prenatal exposure to PCBs and infant performance on the Fagan Test of Infant Intelligence. Neurotoxicology 21:1029-1038.

Davis KD, Lazar MA. 1992. Selective antagonism of thyroid hormone action by retinoic acid. J Biol Chem 267:3185-3189.

DeKoning EP, Karmaus W. 2000. PCB exposure in utero and via breast milk. A review. J Expo Anal Environ Epidemiol 10:285-293.

Dohr O, Vogel C, Abel d. 1995. Different response of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)-sensitive genes in human breast cancer MCF-7 and MDA-MB 231 cells. Arch Biochem Biophys 321:405-412.

Dowling AL, Zoeller RT. 2000. Thyroid hormone of maternal origin regulates the expression of RC3/neurogranin mRNA in the fetal rat brain. Brain Res Mol Brain Res 82:126-132.

Gauger KJ, Kato Y, Haraguchi K, Lehmler HJ, Robertson LW, Bansal R, et al. 2004. Polychlorinated biphenyls (PCBs) exert thyroid hormone-like effects in the fetal rat brain but do not bind to thyroid hormone receptors. Environ Health Perspect 112:516-523.

GenBank. 2005. GenBank Overview. Bethesda, MD:National Center for Biotechnology Information The National Center for Biotechnology Information (NCBI) is part of the United States National Library of Medicine (NLM), a branch of the National Institutes of Health. The NCBI is located in Bethesda, Maryland and was founded in 1988. , National Library of Medicine. Available: http://www.ncbi.nlm.nih.gov/ Genbank/GenbankOverview.html [accessed 26 May 2005].

Gittoes NJ, McCabe CJ, Verhaeg J, Sheppard MC, Franklyn JA. 1997. Thyroid hormone and estrogen receptor expression in normal pituitary pituitary /pi·tu·i·tary/ (pi-too´i-tar?e)
1. hypophysial.

2. pituitary gland; see under gland.


anterior pituitary  adenohypophysis.
 and nonfunctioning tumors of the anterior pituitary. J Clin Endocrinol Metab 82:1960-1967.

Goldey ES, Kehn LS, Lau C, Rehnberg GL, Crofton KM. 1995. Developmental exposure to polychlorinated biphenyls (Aroclor 1254) reduces circulating thyroid hormone concentrations and causes hearing deficits in rats. Toxicol Appl Pharmacol 135:77-88.

Haddow JE, Palomaki GE, Allan WC, Williams JR, Knight GJ, Gagnon J, et al. 1999. Maternal thyroid deficiency during pregnancy and subsequent neuropsychological neu·ro·psy·chol·o·gy  
n.
The branch of psychology that deals with the relationship between the nervous system, especially the brain, and cerebral or mental functions such as language, memory, and perception.
 development of the child. N Engl J Med 341:549-555.

Hagmar L. 2003. Polychlorinated biphenyls and thyroid status in humans: a review. Thyroid 13:1021-1028.

Haraguchi K, Kato Y, Kimura R, Masuda Y. 1997. Comparative study on formation of hydroxy hy·drox·y  
adj.
Containing the hydroxyl group.



[From hydroxyl.]


hydroxy  

Containing the hydroxyl group (OH).

Adj. 1.
 and sulfur-containing metabolites from different chlorinated biphenyls with 2,5-substitution in rats. Drug Metab Dispos 25:845-852.

Harry GJ, Billingsley M, Bruinink A, Campbell IL, Classen W, Dorman DC, et al. 1998. In vitro techniques for the assessment of neurotoxicity neurotoxicity /neu·ro·tox·ic·i·ty/ (noor?o-tok-sis´it-e) the quality of exerting a destructive or poisonous effect upon nerve tissue. . Environ Health Perspect 106(suppl 1): 131-158.

Hestermann EV, Stegeman JJ, Hahn ME. 2000. Relative contributions of affinity and intrinsic efficacy to aryl hydrocarbon receptor ligand potency. Toxicol Appl Pharmacol 168:160-172.

Huisman M, Koopman-Esseboom C, Fidler V, Hadders-Algra M, van der Paauw CB, Tuinstra LB, et al. 1995a. Perinatal exposure to polychlorinated biphenyls and dioxins and its effect on neonatal neurological development. Early Hum Dev 41:111-127.

Huisman M, Koopman-Esseboom C, Lanting CI, van der Paauw CG, Tuinstra LG, Fidler V, et al. 1995b. Neurological condition in 18-month-old children perinatally exposed to polychlorinated biphenyls and dioxins. Early Hum Dev 43:165-176.

Ihm CG, Park JK, Kim HJ, Lee TW, Cha DR. 2002. Effects of high glucose on interleukin-6 production in human mesangial cells. J Korean Med Sci 17:208-212.

James JO. 2001. Polychlorinated biphenyls: metabolism and metabolites. In: PCBs-Recent Advances in Environmental Toxicology and Health Effects (Robertson LW, Hansen LG, eds). Lexington, KY:University Press of Kentucky The University Press of Kentucky (UPK) is the scholarly publisher for the Commonwealth of Kentucky, and was organized in 1969 as successor to the University of Kentucky Press. The university had sponsored scholarly publication since 1943. , 35-46.

Kanemura Y, Mori H, Kobayashi S, Islam O, Kodama E, Yamamoto A, et al. 2002. Evaluation of in vitro proliferative activity of human fetal neural stem/progenitor cells using indirect measurements of viable cells based on cellular metabolic activity. J Neurosci Res 69:869-879.

Kilby MD, Gittoes N, McCabe C, Verhaeg J, Franklyn JA. 2000. Expression of thyroid receptor isoforms in the human fetal central nervous system end the effects of intrauterine growth restriction intrauterine growth restriction
n.
See intrauterine growth retardation.


intrauterine growth retardation Fetal growth restriction Neonatology A generic term for any delay in achieving intrauterine developmental
. Clin Endocrinol (Oxf) 53:469-477.

Kim M, Kim S, Yun S, Lee M, Cho B, Park J, et al. 2004. Comparison of seven indicator PCBs and three coplanar PCBs in beef, pork, and chicken fat. Chemosphere chemosphere: see atmosphere.  54:1533-1538.

Kimura Y, Suzuki T, Kaneko C, Darnel darnel

see loliumtemulentum.
 AD, Moriya T, Suzuki S, et al. 2002. Retinoid receptors in the developing human lung. Clin Sci (Land) 103:613-621.

King CD, Rios GR, Assouline JA, Tephly TR. 1999. Expression of UDP-glucuronosyltransferases (UGTs) 2B7 and 1A6 in the human brain and identification of 5-hydroxytryptamine as a substrate. Arch Biochem Biophys 365:156-162.

Ko Y, Koch B, Harth V, Sachinidis A, Thier R, Vetter H, et al. 2000. Rapid analysis of GSTM1, GSTT1 and GSTP GSTP Global System of Trade Preferences
GSTP Global Straight-Through Processing
GSTP Generalised System of Tariff Preferences (United Kingdom)
GSTP Generic Switching Test Plan
GSTP General Support and Technology Programme
1 polymorphisms using real-time polymerase chain reaction In Molecular Biology, real-time polymerase chain reaction, also called quantitative real time polymerase chain reaction (QRT-PCR) or kinetic polymerase chain reaction . Pharmacogenetics Pharmacogenetics Definition

Pharmacogenetics is the study of how the actions of and reactions to drugs vary with the patient's genes.
Description
 10:271-274.

Kolaja KL, Klaassen CD. 1998. Dose-response examination of UDP-glucuronosyltransferase inducers and their ability to increase both TGF-beta expression and thyroid follicular cell apoptosis. Toxicol Sci 46:31-37.

Konig S, Moura Neto V. 2002. Thyroid hormone actions on neural cells. Cell Mol Neurobiol 22:517-544.

Kukekov VG, Laywell ED, Suslov O, Davies K, Scheffler B, Thomas LB, et al. 1999. Multipotent stem/progenitor cells with similar properties arise from two neurogenic neurogenic /neu·ro·gen·ic/ (-jen´ik)
1. forming nervous tissue.

2. originating in the nervous system or from a lesion in the nervous system.
 regions of adult human brain. Exp Neurol 156:333-344.

Lilienthal H, Neuf M, Munoz C, Winneke G. 1990. Behavioral effects of pre- and postnatal exposure to a mixture of low chlorinated PCBs in rats. Fundam Appl Toxicol 15:457-467.

Lim W, Nguyen NH, Yang HY, Scanlan TS, Furlow JD. 2002. A thyroid hormone antagonist that inhibits thyroid hormone action in vivo. J Biol Chem 277:35664-35670.

McCaffery PJ, Adams J, Maden M, Rosa-Molinar E. 2003. Too much of a good thing: retinoic acid as an endogenous regulator of neural differentiation and exogenous teratogen teratogen /ter·a·to·gen/ (ter´ah-to-jen) any agent or factor that induces or increases the incidence of abnormal prenatal development.teratogen´ic

te·rat·o·gen
n.
. Eur J Neurosci 18:457-472.

McKinney JD, Waller CL. 1998. Molecular determinants of hormone mimicry mimicry, in biology, the advantageous resemblance of one species to another, often unrelated, species or to a feature of its own environment. (When the latter results from pigmentation it is classed as protective coloration. : halogenated halogenated

pertaining to a substance to which a halogen is added.


halogenated salicylanilides
see rafoxanide, clioxanide.
 aromatic hydrocarbon environmental agents. J Toxicol Environ Health B Crit Rev 1:27-58.

Meerts IA, Assink Y, Cenijn PH, Van Den Berg JH, Weijers BM, Bergman A, et al. 2002. Placental transfer of a hydroxylated polychlorinated biphenyl and effects on fetal and maternal thyroid hormone homeostasis in the rat. Toxicol Sci 68:361-371.

Messina DJ, Alder L, Tresco PA. 2003. Comparison of pure and mixed populations of human fetal-derived neural progenitors transplanted into intact adult rat brain. Exp Neurol 184:816-829.

Morreale de Escobar G, Obregon MJ, Escobar del Rey F. 2000. Is neuropsychological development related to maternal hypothyroidism or to maternal hypothyroxinemia? J Clin Endocrinor Metab 85:3975-3987.

Morse DC, Green D, Veerman M, van Amerongen CJ, Koeter HB, Smits van

Prooije AE, et al. 1993. Interference of polychlorinated biphenyls in hepatic and brain thyroid hormone metabolism in fetal and neonatal rats. Toxicol Appl Pharmacol 122:27-33.

Morse DC, Wehler EK, Wesseling W, Koeman JH, Brouwer A. 1996. Alterations in rat brain thyroid hormone status following pre- and postnatal exposure to polychlorinated biphenyls (Aroclor 1254). Toxicol Appl Pharmacol 136:269-279.

Nagayama J, Tsuji H, Iida T, Hirakawa H, Matsueda T, Ohki M. 2001. Effects of contamination level of dioxins and related chemicals on thyroid hormone and immune response systems in patients with "Yusho." Chemosphere 43:1005-1010.

Nguyen NH, Apriletti JW, Cunha Lima ST, Webb P, Baxter JD, Scanlan TS. 2002. Rational design and synthesis of a novel thyroid hormone antagonist that blocks coactivator recruitment. J Med Chem 45:3310-3320.

Nishimura M, Yaguti H, Yoshitsugu H, Naito S, Satoh T. 2003. Tissue distribution of mRNA expression of human cytochrome P450 isoforms assessed by high-sensitivity real-time reverse transcription PCR. Yakugaku Zasshi 123:369-375.

Omiecinski CJ, Redlich CA, Costa P. 1990. Induction and developmental expression of cytochrome P450IA1 messenger RNA in rat and human tissues: detection by the polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is . Cancer Res 50:4315-4321.

Osius N, Karmaus W, Kruse H, Witten J. 1999. Exposure to polychlorinated biphenyls and levels of thyroid hormones in children. Environ Health Perspect 107:843-849.

Parkinson A, Safe SH, Robertson LW, Thomas PE, Ryan DE, Reik LM, et al. 1983. Immunochemical im·mu·no·chem·is·try  
n.
The chemistry of immunologic phenomena, as of antigen-antibody reactions.



im
 quantitation of cytochrome P-450 isozymes and epoxide hydrolase in liver microsomes from polychlorinated or polybrominated biphenyl-treated rats. A study of structure-activity relationships. J Biol Chem 258:5967-5976.

Piper DR, Mujtaba T, Keyoung H, Roy NS, Goldman SA, Rao MS, et al. 2001. Identification and characterization of neuronal precursors and their progeny from human fetal tissue. J Neurosci Res 66:356-368.

Pop VJ, Kuijpens JL, van Baar AL, Verkerk G, van Son MM, de Vijlder JJ, et al. 1999. Low maternal free thyroxine concentrations during early pregnancy are associated with impaired psychomotor development in infancy. Clin Endocrinol (Oxf) 50:149-155.

Porterfield SP. 2000. Thyroidal dysfunction and environmental chemicals--potential impact on brain development. Environ Health Perspect 108(suppl 3):433-438.

Porterfield SP, Hendry LB. 1998. Impact of PCBs on thyroid hormone directed brain development. Toxicol Ind Health 14:103-120.

Roegge CS, See BW, Crofton KM, Schantz SL. 2000. Gestational-lactational exposure to Aroclor 1254 impairs radial-arm maze performance in male rats. Toxicol Sci 57:121-130.

Rowe A. 1997. Retinoid X receptors. Int J Biochem Cell Biol 29:275-278.

Sarlieve LL, Rodriguez-Pena A, Langley K. 2004. Expression of thyroid hormone receptor isoforms in the oligodendrocyte lineage. Neurochem Res 29:903-922.

Schantz SL, Widholm JJ, Rice DC. 2003. Effects of PCB exposure on neuropsychological function in children. Environ Health Perspect 111:357-376.

Schell L, DeCaprio A, Gallo M, Hubicki L, The Akwesasne Task Force on the Environment. 2002. Polychlorinated biphenyls and thyroid function in adolescents of the Mohawk Nation at Akwesasne. In: Human Growth from Conception to Maturity (Gilli G, Schell L, Benso L, eds). London:Smith-Gordon, 289-296.

Schoonover CM, Seibel MM, Jolson DM, Stack MJ, Rahman RJ, Jones SA, et al. 2004. Thyroid hormone regulates oligodendrocyte accumulation in developing rat brain white matter tracts. Endocrinology 145:5013-5020.

Sherratt PJ, Pulford DJ, Harrison DJ, Green T, Hayes JD. 1997. Evidence that human class Theta glutathione S-transferase T1-1 can catalyse catalyse or US -lyze
Verb

[-lysing, -lysed] or -lyzing, -lyzed to influence (a chemical reaction) by catalysis

Verb 1.
 the activation of dichloromethane, a liver and lung carcinogen carcinogen: see cancer.
carcinogen

Agent that can cause cancer. Exposure to one or more carcinogens, including certain chemicals, radiation, and certain viruses, can initiate cancer under conditions not completely understood.
 in the mouse. Comparison of the tissue distribution of GST T1-1 with that of classes Alpha, Mu and Pi GST in human. Biochem J 326(Pt 3):837-846.

Silva JM, Dominguez G, Gonzalez-Sancho JM, Garcia JM, Silva J, Garcia-Andrade C, et al. 2002. Expression of thyroid hormone receptor/erbA genes is altered in human breast cancer. Oncogene oncogene

Gene that can cause cancer. It is a sequence of DNA that has been altered or mutated from its original form, the proto-oncogene (see mutation). Proto-oncogenes promote the specialization and division of normal cells.
 21:4307-4316.

Strassburg CP, Oldhafer K, Manns MP, Tukey RH. 1997. Differential expression of the UGT1A locus in human liver, biliary, and gastric tissue: identification of UGT1A7 and UGT1A10 transcripts in extrahepatic ex·tra·he·pat·ic  
adj.
Originating or occurring outside the liver.
 tissue. Mol Pharmacol 52:212-220.

Sutter TR, Tang YM, Hayes CL, We YYP YYP Youth Yellow Pages
YYP York Young Professionals
YYP Yale Younger Poets
YYP Yahoo Yellow Pages
, Jabs EW, Li X, et al. 1994. Complete cDNA sequence of a human dioxin-inducible mRNA identifies a new gene subfamily subfamily /sub·fam·i·ly/ (sub´fam-i-le) a taxonomic division between a family and a tribe.

sub·fam·i·ly
n.
A taxonomic category ranking between a family and a genus.
 of cytochrome P450 that maps to chromosome 2. J Biol Chem 269:13092-13099.

Svendsen CN, ter Borg MG, Armstrong RJ, Rosser AE, Chandran S, Ostenfeld T, et al. 1998. A new method for the rapid and long term growth of human neural precursor cells. J Neurosci Methods 85:141-152.

Tilson HA. 1996. Evolution and current status of neurotoxicity risk assessment. Drug Metab Rev 28:121-139.

van den Berg M, Birnbaum L, Bosveld AT, Brunstrom B, Cook P, Feeley M, et al. 1998. Toxic equivalency factors (TEFs) for PCBs, PCDDs, PCDFs for humans and wildlife. Environ Health Perspect 106:775-792.

Walkowiak J, Wiener JA, Fastabend A, Heinzow B, Kramer U, Schmidt E, et al. 2001. Environmental exposure to polychlorinated biphenyls and quality of the home environment: effects on psychodevelopment in early childhood. Lancet 358:1002-1607.

Widholm JJ, Clarkson GB, Strupp BJ, Crofton KM, Seegal RF, Schantz SL. 2001. Spatial reversal learning in Aroclor 1254-exposed rats: sex-specific deficits in associative ability and inhibitory control. Toxicol Appl Pharmacol 174:188-198.

Yengi LG, Xiang Q, Pan J, Seatina J, Kao J, Ball SE, et al. 2003. Quantitation of cytochrome P450 mRNA levels in human skin. Anal Biochem 316:103-110.

Zetterstrom RH, Lindqvist E, Mata de Urquiza A, Tomac A, Eriksson U, Perlmann T, et al. 1999. Role of retinoids Retinoids
A derivative of synthetic Vitamin A.

Mentioned in: Ichthyosis

retinoids (reˑ·t
 in the CNS See Continuous net settlement.

CNS

See continuous net settlement (CNS).
: differential expression of retinoid binding proteins and receptors and evidence for presence of retinoic acid. Eur J Neurosci 11:407-416.

Zoeller RT, Crofton KM. 2000. Thyroid hormone action in fetal brain development and potential for disruption by environmental chemicals. Neurotoxicology 21:935-945.

Zoeller RT, Dowling AL, Vas AA. 2000. Developmental exposure to polychlorinated biphenyls exerts thyroid hormone-like effects on the expression of RC3/neurogranin and myelin basic protein messenger ribonucleic acids in the developing rat brain. Endocrinology 141:181-189.

Ellen Fritsche, (1) Jason E. Cline, (1) Ngoc-Ha Nguyen, (2) Thomas S. Scanlan, (2) and Josef Abel (1)

(1) Group of Toxicology, Institut fur umweltmedizinische Forschung gGmbH an der Heinrich-Heine Universitat, Dusseldorf, Germany; (2) Departments of Pharmaceutical Chemistry and Cellular and Molecular Pharmacology, University of California-San Francisco, San Francisco, California “San Francisco” redirects here. For other uses, see San Francisco (disambiguation).

The City and County of San Francisco (EN IPA: [sænfrənˈsɪskoʊ] 
, USA

Address correspondence to E. Fritsche, Institut fur umweltmedizinische Forschung, Auf'm Hennekamp 50, 40225 Dusseldorf, Germany. Telephone 49-211-3389203. Fax: 49-211-3190910. E-mail: ellen.fritsche@uni-duesseldorf.de
Table 1. Sequences of oligonucleotides used to perform RT-PCRs
with NHNP cells as shown in Figure 1.

Gene                      Sequences               Size (bp)

[beta]-Actin   FW CCCCAGGCACCAGGGCGTGAT              263
               RW GGTCATCTTCTCGCGGTTGGCCTTGGGGT

NSE            FW CCCACTGATCCTTCCCGATACAT            254
               RW CCGATCTGGTTGACCTTGAGCA

GFAP           FW GATCAACTCACCGCCAACAGC              206
               RW CTCCTCCTCCAGCGACTCAATCT

PLP/dm20       FW CCATGCCTTCCAGTATGTCATC           354 PLP
               RW GTGGTCCAGGTGTTGAAGTAAATGT       249 dm20

CYP1A1         FW TAGACACTGATCTGGCTGCAG              146
               RW GGGAAGGCTCCATCAGCATC

CYP1B1         FW AACGTCATGAGTGCCGTGTGT              360
               RW GGCCGGTACGTTCTCCAAATC

CYP2A6         FW CAGCTGAACACAGAGCAGATGTACA          227
               RW CGCTCCCCGTTGCTGAATA

CYP2B6         FW CATTCTTCCGGGGATATGGTG              83
               RW CCTCATAGTGGTCACAGAGAATCG

CYP2C9         FW GAGGAGTTTTCTGGAAGAGGCAT            130
               RW CAAAATTCCGCAGCGTCAT

CYP2C19        FW GAGGAGTTTTCTGGAAGAGGCC             76
               RW CATTGCTGAAAACGATTCCAAA

CYP2D6         FW CTTTCTGCGCGAGGTGCT                 96
               RW TGGGTCAGGAAAGCCTTTTG

CYP3A4         FW TCTCATCCCAGACTTGGCCA               85
               RW CATGTGAATGGGTTCCATATAGATAGA

UGT1A6         FW TCCTGGCTGAGTATTTGGGCC              562
               RW GTTCGCAAGATTCGATGGTCG

GSTM1          FW GAACTCCCTGAAAAGCTAAAGCT            132
               RW GTTGGGCTCAAATATACGGTGG

GSTT1          FW TTCCTTACTGGTCCTCACATCTC            262
               RW TCCCAGCTCACCGGATCAT

TR[alpha]1     FW CCCTGAAAACCAGCATGTCAG              150
               RW TTCTTCTGGATTGTGCGGC

TR[beta]1      FW AAGTGCCCAGACCTTCCAAA               150
               RW AAAGAAACCCTTGCAGCCTTC

TR[beta]2      FW GGGCTGGAGAATGCATGCGTAGACT          239
               RW ATTCACTGCCCAGGCCTGTTCCATA

RAR-[alpha]    FW ACCCCCTCTACCCCGCATCTACAAG          226
               RW CATGCCCACTTCAAAGCACTTCTGC

RAR-[beta]     FW ATTCCAGTGCTGACCATCGAGTCC           349
               RW CCTGTTTCTGTGTCATCCATTTCC

RAR-[gamma]    FW TACCACTATGGGGTCAGC                 195
               RW CCGGTCATTTCGCACAGCT

RXR-[alpha]    FW TTCGCTAAGCTCTTGCTC                 113
               RW ATAAGGAAGGTGTCAATGGG

RXR-[beta]     FW GAAGCTCAGGCAAACACTAC               111
               RW TGCAGTCTTTGTTGTCCC

RXR-[gamma]    FW GCAGTTCAGAGGACATCAAGCC             352
               RW GCCTCACTCTCAGCTCGCTCTC

AhR            FW TGGTCTCCCCCAGACAGTAG               132
               RW TTCATTGCCAGAAAACCAGA

AhRR           FW CAGTTACCTCCGGGTGAAGA               161
               RW CCAGAGCAAAGCCATTAAGA

                Annealing
               temperature
Gene           ([degrees]C)        Reference

[beta]-Actin        60        Ihm et al. 2002

NSE                 60        Kukekov et al. 1999

GFAP                60        Kukekov et al. 1999

PLP/dm20            59        Kukekov et al. 1999

CYP1A1              60        Omiecinski et al. 1990

CYP1B1              63        Sutter et al. 1994

CYP2A6              60        Yengi et al. 2003

CYP2B6              60        Yengi et al. 2003

CYP2C9              60        Yengi et al. 2003

CYP2C19             60        Yengi et al. 2003

CYP2D6              60        Yengi et al. 2003

CYP3A4              60        Yengi et al. 2003

UGT1A6              59        Strassburg et al. 1997

GSTM1               60        Ko et al. 2000

GSTT1               60        Ko et al.2000

TR[alpha]1          68        Silva et al. 2002

TR[beta]1           68        Silva et al. 2002

TR[beta]2           68        Gittoes et al. 1997

RAR-[alpha]         60        Kimura et al. 2002

RAR-[beta]          62        Kimura et al. 2002

RAR-[gamma]         60        Kimura et al. 2002

RXR-[alpha]         58        Kimura et al. 2002

RXR-[beta]          58        Kimura et al. 2002

RXR-[gamma]         62        Kimura et al. 2002

                              GenBank accession no. (a)/
                                 position in sequence

AhR                 60              BC070080/
                                    1113-1244

AhRR                60              NM 020731/
                                    269-429

Abbreviations: AhR, arylhydrocarbon receptor; AhRR, AhR repressor; CYP,
cytochrome P450; FW, forward primer; GST, glutathione S-transferase;
NSE, neuron specific enolase; PLP, proteolipid protein; RAR, retinoic
acid receptor; RW, reverse primer; RXR, retinoic x receptor; OGT, ODP
glucuronosyltransferase; TR, thyroid hormone receptor.

(a) GenBank (2005).
COPYRIGHT 2005 National Institute of Environmental Health Sciences
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2005, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Research
Author:Abel, Josef
Publication:Environmental Health Perspectives
Date:Jul 1, 2005
Words:6738
Previous Article:Influence of tap water quality and household water use activities on indoor air and internal dose levels of trihalomethanes.(Research)
Next Article:Neurologic symptoms in licensed private pesticide applicators in the Agricultural Health Study.(Research / Environmental Medicine)
Topics:



Related Articles
Cognitive effects of endocrine-disrupting chemicals in animals. (Review).
Thyroid hormone and brain development conference. (NIEHS Extramural Update).
Thyroid toxicology and brain development: should we think differently?(Guest Editorial)
NIEHS-funded research pursues thyroid findings.(NIEHS News)
Thyroid toxicants: assessing reproductive health effects.(Workshop Summary)
When PCBs act like thyroid hormone: mysterious mimicry in the fetal brain.(Science Selections)
Polychlorinated biphenyls (PCBs) exert thyroid hormone-like effects in the fetal rat brain but do not bind to thyroid hormone receptors.
Are maternal thyroid autoantibodies generated by PCBs the missing link to impaired development of the brain?(Perspectives / Correspondence)
Blocking brain development: how PCBs disrupt thyroid hormone.(Environews / Science Selections)
Long-term effects of neonatal exposure to hydroxylated polychlorinated biphenyls in the BALB/cCrgl mouse.(Research)

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles