Printer Friendly
The Free Library
14,537,391 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Pneumonia and new methicillin-resistant Staphylococcus aureus clone.


Necrotizing pneumonia caused by Staphylococcus aureus strains carrying the Panton-Valentin leukocidin gene is a newly described disease entity. We report a new fatal case of necrotizing pneumonia. An S. aureus strain with an agr1 allele and of a new sequence type 377 was recovered, representing a new, emerging, community-acquired methicillin-resistant clone.

**********

Necrotizing pneumonia associated with Panton-Valentine leukocidin (PVL) is a recent described clinical entity. It mainly occurs in children and young adults (median age 15 years), is fatal in 75% of cases, and is associated with a median survival time of 4 days (1). Necrotizing pneumonia is often preceded by a viral-like illness with signs of rhinopharyngitis rhinopharyngitis /rhi·no·phar·yn·gi·tis/ (ri?no-far?in-ji´tis) nasopharyngitis.

rhinopharyngitis

inflammation of the nasopharynx.
. Viruses such as the influenza A virus have been isolated concomitantly with the PVL-positive S. aureus (1). Clinically, necrotizing pneumonia is mainly characterized by a rapidly extensive pneumonia often associated with pleural effusion and progressing towards the acute respiratory distress syndrome acute respiratory distress syndrome
n.
See adult respiratory distress syndrome.
. Major associated signs include hemoptysis Hemoptysis Definition

Hemoptysis is the coughing up of blood or bloody sputum from the lungs or airway. It may be either self-limiting or recurrent. Massive hemoptysis is defined as 200-600 mL of blood coughed up within a period of 24 hours or less.
 and leukopenia leukopenia /leu·ko·pe·nia/ (-pe´ne-ah) reduction of the number of leukocytes in the blood below about 5000 per cubic mm.leukope´nic

basophilic leukopenia  basophilopenia.
 (<2 x [10.sup.9]/L) (1). The severity of neerotizing pneumonia could be due to the products of the PVL genes, which are present in all S. aureus strains associated with this disease. The precise pathophysiology of the disease is unknown, but PVL causes tissue necrosis and leukocyte destruction. This toxin has been linked to primary skin and soft-tissue infections such as furuncles and abscesses (1).

Necrotizing pneumonia is mainly associated with PVLpositive methicillin-susceptible Staphylococcus aureus strains. Only 1 of the 16 cases reported by Gillet et al. (1) and 6 of the 40 cases of necrotizing pneumonia reported in the literature were associated with methicillin-resistant strains (MRSA MRSA Methicillin-resistant Staphylococcus aureus. See MARSA. ). These PVL-positive MRSA correspond to clones that have emerged worldwide and cause community-acquired (CA) infections in patients with no risk factors. These CA-MRSA clones have a continent-specific distribution or worldwide distribution described by Vandenesch et al. (2). CA-MRSA clones that have spread worldwide share SCCmec type IV, the smallest cassette containing the mecA gene coding for methicillin resistance. The major European clone has a sequence type (ST) 80, as determined by multilocus sequence typing Multilocus sequence typing (MLST) is a technique in molecular biology for the typing of multiple loci. The procedure characterizes isolates of bacterial species using the DNA sequences of internal fragments of multiple (usually seven) housekeeping genes. , and an agr (for accessory gene regulator) allele of type 3. agr is a global regulator controlling the expression of virulence factors in S. aureus, and has 4 alleles (3). PVL-positive CA-MRSA isolated in Australia have an agr type 3 allele and are of ST30 or ST93. The PVL-positive CA-MRSA isolated in the United States are ST1 and agr allele type 3, but some are ST8 or ST59 and agr allele type 1 (2). Here we report a fatal case of necrotizing pneumonia involving a 59-year-old woman infected by a new clone of PVL-positive CA-MRSA.

Case Report

A 59-year-old woman with an unremarkable medical history was admitted to Limoges University Hospital (France) in December 2003 for acute respiratory failure. She had a 3-day history of flulike syndrome with fever, chills, cough, and myalgia and had been prescribed nonsteroidal antiinflammatory therapy. On admission, she had dyspnea, nonproductive cough, and rales in both lungs. Her arterial pressure was 60/30 mm Hg. Skin rash and diarrhea were absent. A chest radiograph showed diffuse alveolar infiltration of both lungs, without pleural effusion. Laboratory studies showed leukopenia (leukocytes = 1.66 x [10.sup.9]/L), mild thrombocytopenia (115,000 platelets/[mm.sup.3]), hypoxemia hypoxemia /hy·pox·emia/ (hi?pok-sem´e-ah) deficient oxygenation of the blood.

hy·pox·e·mi·a
n.
Insufficient oxygenation of arterial blood.
 (Pa[O.sub.2]/Fi[O.sub.2] = 61), and lactic acidosis (pH = 7.29, lactates = 4.45 mmol/L). Empirical antibacterial chemotherapy combining ceftriaxone, ciprofloxacin, and gentamicin was started on admission, and mechanical ventilation was immediately necessary. Repeated tracheal aspiration was highly productive and showed hemoptysis and sustained intraalveolar plasma leakage. Despite fluid resuscitation, continuous catecholamine catecholamine (kăt'əkôl`əmēn), any of several compounds occurring naturally in the body that serve as hormones or as neutrotransmitters in the sympathetic nervous system.  perfusion, drotrecogin alfa (activated) administration (Xigris, Eli Lilly and Company Eli Lilly and Company (NYSE: LLY) is a global pharmaceutical company and one of the world's largest corporations. Eli Lilly's global headquarters is located in Indianapolis, Indiana, in the United States. , Indianapolis, IN, USA), and aggressive care, her hemodynamic he·mo·dy·nam·ics  
n. (used with a sing. verb)
The study of the forces involved in the circulation of blood.



he
 status deteriorated rapidly, leading to multiple organ failure and death <24 hours after admission.

Necropsy showed hemorrhagic foci in both lungs. Histopathologic studies showed total destruction of the respiratory epithelium covering the bronchi bronchi /bron·chi/ (brong´ki) plural of bronchus.
Bronchi
Two main branches of the trachea that go into the lungs. This then further divides into the bronchioles and alveoli.
 and bronchioli, together with abundant gram-positive cocci cocci /coc·ci/ (kok´si) plural of coccus.

cocci

[L.] plural of coccus.
, absence of viable polymorphonuclear polymorphonuclear /poly·mor·pho·nu·cle·ar/ (-noo´kle-er) having a nucleus so deeply lobed or so divided as to appear to be multiple.

pol·y·mor·pho·nu·cle·ar
adj.
Having a lobed nucleus.
 cells, and extensive necrosis of the alveolar septa septa /sep·ta/ (sep´tah) [L.] plural of septum.
Septum (plural, septa)
The dividing partition in the nose that separates the two nostrils. It is composed of bone and cartilage.
. These lesions were characteristics of necrotizing pneumonia.

S. aureus was isolated 3 times, by culture of blood (LIM-48), lung necropsy tissue (LIM-49), and tracheal aspirate as·pi·rate
v.
To take in or remove by aspiration.

n.
A substance removed by aspiration.


Aspirate
The removal by suction of a fluid from a body cavity using a needle.
 (LIM-50). The 3 isolates had the same antimicrobial drug resistance profile (resistant to oxacillin oxacillin /ox·a·cil·lin/ (ok?sah-sil´in) a semisynthetic penicillinase-resistant penicillin used as the sodium salt in infections due to penicillin-resistant, gram-positive organisms. , kanamycin kanamycin /kan·a·my·cin/ (kan?ah-mi´sin) an aminoglycoside antibiotic derived from Streptomyces kanamyceticus, effective against aerobic gram-negative bacilli and some gram-positive bacteria, including mycobacteria; used as the , tobramycin tobramycin /to·bra·my·cin/ (to?brah-mi´sin) an aminoglycoside antibiotic derived from a complex produced by Streptomyces tenebrarius, , and gentamicin) and the same pattern by pulsed-field gel electrophoresis after DNA digestion by SmaI (data not shown).

Influenza A virus was detected by polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is  and immunofluorescence on the tracheal aspirate, but culture on cell lines was negative. The influenza A virus has been shown to be capable of destroying the respiratory epithelium from the trachea to the bronchioli (1), allowing the PVL-positive CA-MRSA to adhere to the basement membrane (4). PVL may diffuse locally, attracting polymorphonuclear leukocytes by its chemotactic che·mo·tac·tic
adj.
Of or relating to chemotaxis.
 activity and lysing them by its leukotoxicity.

Because the clinical manifestations corresponded to those of necrotizing pneumonia, isolate LIM-49 was referred (lung necropsy culture) to the French National Centre for Staphylococci. The isolate was screened for staphylococcal toxin genes, agr alleles, and the mecA gene as described elsewhere (Table) (3,5,6). The strain had an agr type 1 allele and the lukS-PV/lukF-PV genes encoding PVL (Figure), but harbored no toxin genes (sea through see, tsst, eta, and etb genes encoding staphylococcal enterotoxins A though E, toxic shock syndrome toxic shock syndrome (TSS). acute, sometimes fatal, disease characterized by high fever, nausea, diarrhea, lethargy, blotchy rash, and sudden drop in blood pressure. It is caused by Staphylococcus aureus, an exotoxin-producing bacteria (see toxin).  toxin, and exfoliative ex·fo·li·a·tive
adj.
Marked by exfoliation, desquamation, or profuse scaling.
 toxins A and B, respectively). The mecA gene was detected, together with SCCmee type V as described by Ito et al. (7). The spa type was 355 and the sequence type was ST377 (Figure). The single nucleotide difference between ST152 and ST377, which is not distinguished by using the usual primers determined by Enright et al. (8), was established as ST377 by using in-house primers (forward 5'-ggA CgA Agg TCA TgA TgT ATT TTT-3' (nt 327-350), reverse 5'-CTT CTA CgC gCT CTC TTT TTA Ag-3' (nt 564-586), according to the GenBank ID11211186 of the gmk gene) to amplify appropriate fragment. To our knowledge, this is the first description of such a necrotizing necrotizing /nec·ro·tiz·ing/ (nek´ro-tiz?ing) causing necrosis.
Necrotizing
Causing the death of a specific area of tissue. Human bites frequently cause necrotizing infections.
 pneumonia-associated CA-MRSA clone. Three other ST377 strains were referred to the National Reference Centre for staphylococci in 2003. Two were isolated from patients in Europe (Netherlands and Switzerland), and 1 from an Australia patient (strain provided by G. Nimmo). The patient from the Netherlands had been treated for an abscess from which PVL-MRSA was cultured, and the Swiss patient had furunculosis furunculosis /fu·run·cu·lo·sis/ (fu-rung?ku-lo´sis)
1. the persistent sequential occurrence of furuncles over a period of weeks or months.

2. the simultaneous occurrence of a number of furuncles.
. The 3 isolates harbored the SCCmec type V cassette, an agr1 allele, the same toxin gene profile, and macrorestriction pattern, spa type, as our isolate (Figure).

Conclusions

We report the identification of a new, emerging, highly virulent PVL-positive CA-MRSA clone that harbors the SCCmec type V cassette. This tends to confirm the continuing emergence of new CA-MRSA clones. The new clone seems to have spread rapidly in Europe, because it has been detected in patients in the Netherlands, Switzerland, and now in France. Since necrotizing pneumonia is rapidly fatal, as in the patient described here, cases of PVL-positive CA-MRSA infection must be recognized rapidly, especially in case of methicillin resistance. The therapeutic value of intravenous immunoglobulin containing anti-PVL antibodies has been reported by Gauduchon et al. (9) but must be confirmed.

References

(1.) Gillet Y, Issartel B, Vanhems P, Fournet JC, Lina G, Bes M, et al. Association between Staphylococcus aureus trains carrying gene for Panton-Valentine leukocidin and highly lethal necrotising pneumonia in young immunocompetent im·mu·no·com·pe·tent
adj.
Having the normal bodily capacity to develop an immune response following exposure to an antigen.



im
 patients. Lancet. 2002;359:753-9.

(2.) Vandenesch F, Naimi T, Enright MC, Lina G, Nimmo GR, Hefferman H, et al. Community-acquired methicillin-resistant Staphylococcus aureus methicillin-resistant Staphylococcus aureus Methicillin-aminoglycoside resistant Staphylococcus aureus, MRSA An organism with multiple antibiotic resistances–eg, aminoglycosides, chloramphenicol, clindamycin, erythromycin, rifampin, tetracycline,  carrying Panton-Valentine leukocidin genes: worldwide emergence. Emerg Infect Dis. 2003;9:978-84.

(3.) Jarraud S, Mougel C., Thioulouse J, Lina G, Meugnier H, Forey F, et al. Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (alleles), and human disease. Infect Immun. 2002;70:631-41.

(4.) de Bentzmann S, Tristan A, Etienne J, Brousse N, Vandenesch F, Lina G. Staphylococcus aureus isolates associated with necrotizing pneumonia bind to basement membrane type I and IV collagens and laminin. J Infect Dis. 2004; 190:1506-15.

(5.) Lina G, Boutite F, Tristan A, Bes M, Etienne J, Vandenesch F. Bacterial competition for human nasal cavity colonization: role of staphylococcal agr alleles. Appl Environ Microbiol. 2003;69:18-23.

(6.) Murakami K, Minamide W, Wada K, Nakamura E, Teraoka H, Watanabe S. Identification of methicillin-resistant strains of staphylococci by polymerase chain reaction. J Clin Microbiol. 1991;29: 2240-4.

(7.) Ito T, Ma XX, Takeuchi F, Okuma K, Yuzawa H, Hiramatsu K. Novel cassette chromosome mec driven by a novel cassette chromosome recombinase re·com·bi·nase
n.
An enzyme that catalyzes genetic recombination.



recombinase

a function of the recA protein in Escherichia coli
, ccrC. Antimicrob Agents Chemother. 2004;48: 2637-51.

(8.) Enright MC, Day NP, Davies CE, Peacock S J, Spratt BG. Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus. J Clin Microbiol. 2000;38:1008-15.

(9.) Gauduchon V, Cozon G, Vandenesch F, Genestier AL, Eyssade N, Peyrol S, et al. Neutralization of Staphylococcus aureus Panton Valentine leukocidin by intravenous immunoglobulin in vitro. J Infect Dis. 2004;189:346-53.

Address for correspondence: Fabien Garnier, Laboratoire de Bacteriologie-Virologie-Hygiene, EA 3175, Chu Dupuytren, 2 avenue Martin Luther King, 87042 Limoges CEDEX France; fax: 33-555-05-6722; email: fabien.garnier@unilim.fr

The opinions expressed by authors contributing to this journal do not necessarily reflect the opinions of the Centers for Disease Control and Prevention Centers for Disease Control and Prevention (CDC), agency of the U.S. Public Health Service since 1973, with headquarters in Atlanta; it was established in 1946 as the Communicable Disease Center.  or the institutions with which the authors are affiliated.

Dr Garnier is a medical microbiologist at the Limoges Teaching Hospital, France. His research interests include molecular bacterial identification and bacterial resistance.

Fabien Garnier, * Anne Tristan, ([dagger]) Bruno Francois, ([double dagger]) Jerome Etienne, ([dagger]) Manuella Delage-Corre, ([section]) Christian Martin, * Nadia Liassine, ([paragraph]) Wim Wannet, # Francois Denis, * and Marie-Cecile Ploy *

* Laboratoire de Bacteriologie-Virologie-Hygiene, Limoges, France; ([dagger]) Centre National de Reference des Staphylocoques, Lyon, France; ([double dagger]) Service de Reanimation Re`an`i`ma´tion   

n. 1. The act or operation of reanimating, or the state of being reanimated; reinvigoration; revival.
 Polyvalente, Limoges, France; ([section]) Service d'Anatomie Pathologique, Limoges, France; ([paragraph]) Bioanalytique-Riotton, Geneva Geneva, canton and city, Switzerland
Geneva (jənē`və), Fr. Genève, canton (1990 pop. 373,019), 109 sq mi (282 sq km), SW Switzerland, surrounding the southwest tip of the Lake of Geneva.
, Switzerland; and # National Institute of Public Health and the Environment, Bilthoven, the Netherlands
Table. Primers used to screen for staphylococcal toxin genes, agr
alleles, and mecA gene

Gene              Primer   Oligonucleotide sequence (5'-3')   Reference

mecA              mecA-1        AAAATCGATGGTAAAGGTTGGC           (6)
                  mecA-2        AGTTCTGCAGTACCGGATTTGC
agr1              agr1-1         ATGCACATGGTGCACATGC             (5)
                  agr1-2       GTCACAAGTACTATAAGCTGCGAT
agr2              agr2-1         ATGCACATGGTGCACATGC             (5)
                  agr2-2      TATTACTAATTGAAAAGTGCCATAGC
agr3              agr2-1         ATGCACATGGTGCACATGC             (5)
                  agr2-2   GTAATGTAATAGCTTGTATAATAATACCCAG
agr4              agr4-1         ATGCACATGGTGCACATGC             (5)
                  agr4-2         CGATAATGCCGTAATACCCG
sea               sea-1       GAAAAAAGTCTGAATTGCAGGGAACA         (3)
                  sea-2      CAAATAAATCGTAATTAACCGAAGGTTC
seb               seb-1      ATTCTAATTAAGGACACTAAGTTAGGGA        (3)
                  seb-2         ATCCCGTTTCATAAGGCGAGT
sec               sec-1       GTAAAGTTACAGGTGGCAAAACTTG          (3)
                  sec-2       CATATCATACCAAAAAGTATTGCCGT
sed               sed-1     GAATTAAGTAGTACCGCGCTAAATAATATG       (3)
                  sed-2         GCTGTATTTTTCCTCCGAGAGT
see               see-1      CAAAGAAATGCTTTAAGCAATCTTAGGC        (3)
                  see-2          CACCTTACCGCCAAAGCTG
tsst              tsst-1    TTCACTATTTGTAAAAGTGTCAGACCCACT       (3)
                  tsst-2    TACTAATGAATTTTTTTATCGTAAGCCCTT
eta               eta-1        ACTGTAGGAGCTAGTGCATTTGT           (3)
                  eta-2     TGGATACTTTTGTCTATCTTTTTCATCAAC
etb               etb-1      CAGATAAAGAGCTTTATACACACATTAC        (3)
                  etb-2    AGTGAACTTATCTTTCTATTGAAAAACACTC
LukS-PV/lukF-PV   pvl-1    ATCATTAGGTAAAATGTCTGGACATGATCCA       (3)
                  Npvl-2     GCATCAASTGTATTGGATAGCAAAAGC
COPYRIGHT 2006 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2006, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:DISPATCHES
Author:Ploy, Marie-Cecile
Publication:Emerging Infectious Diseases
Date:Mar 1, 2006
Words:1741
Previous Article:Acute hemorrhagic conjunctivitis and coxsackievirus A24v, Rio de Janeiro, Brazil, 2004.(DISPATCHES)
Next Article:Canine Leptospirosis, United States, 2002-2004.
Topics:



Related Articles
Molecular Epidemiology of Methicillin-Resistant Staphylococcus aureus.
Drug-resistant staph causes more pneumonia.(Emerging Pathogens)(Brief Article)
Methicillin-resistant Staphylococcus aureus in Taiwan.(DISPATCHES)
Methicillin-resistant Staphylococcus aureus pneumonia in children: a call for increased vigilance.(Editorial)
Community-acquired MRSA: a notable adversary.(Methicillin-resistant staphylococcus aureus)
Widespread emergence of methicillin resistance in community-acquired Staphylococcus aureus infections in Denver.(Original Article)
Methicillin-resistant staphylococci in companion animals.(DISPATCHES)
Severe community-acquired pneumonia due to Staphylococcus aureus, 2003-04 influenza season.(RESEARCH)(infectious diseases research)(includes...
Shift in Staphylococcus aureus clone linked to an infected tattoo.(DISPATCHES)
Staphylococcal cassette chromosome mec in MRSA, Taiwan.(DISPATCHES)

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles