Printer Friendly
The Free Library
14,735,889 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Pneumococcal surface protein A of invasive Streptococcus pneumoniae isolates from Colombian children. (Research).


Pneumococcal pneumococcal /pneu·mo·coc·cal/ (-kok´al) pertaining to or caused by pneumococci.  surface protein A (PspA) elicits protection in mice against fatal bacteremia bacteremia: see septicemia.
bacteremia

Presence of bacteria in the blood. Short-term bacteremia follows dental or surgical procedures, especially if local infection or very high-risk surgery releases bacteria from isolated sites.
 and sepsis caused by genetically diverse pneumococci and protects against carriage and lung infection. We determined the PspA families of invasive isolates of Streptococcus pneumoniae recovered from Colombian children < 5 years of age. That 97.5% of Colombian isolates belong to PspA families 1 and 2 supports the hypothesis that a human PspA vaccine covering a few PspA families could be broadly effective.

**********

Streptococcus pneumoniae is a major respiratory pathogen that also causes meningitis, otitis media, and bacteremia (1). In adults, capsular cap·su·lar  
adj.
Of, relating to, or resembling a capsule.

Adj. 1. capsular - resembling a capsule; "the capsular ligament is a sac surrounding the articular cavity of a freely movable joint and attached to the bones"
 polysaccharides of S. pneumoniae can elicit protective antibodies against pneumococcal infection (2). However, in children < 2 years of age polysaccharide polysaccharide: see carbohydrate.
polysaccharide

Any of a large class of long-chain sugars composed of monosaccharides. Because the chains may be unbranched or branched and the monosaccharides may be of one, two, or occasionally more kinds,
 vaccines do not effectively elicit a protective response (3,4), and children can have repeated infections with strains of the same or different capsular serotype serotype /se·ro·type/ (ser´o-tip) the type of a microorganism determined by its constituent antigens; a taxonomic subdivision based thereon.

se·ro·type
n.
See serovar.

v.
 (5). Therefore, protein-polysaccharide conjugates and pneumococcal proteins, including pneumolysin, neuraminidase neuraminidase /neu·ra·min·i·dase/ (-ah-min´i-das) an enzyme of the surface coat of myxoviruses that destroys the neuraminic acid of the cell surface during attachment, thereby preventing hemagglutination. , pneumococcal surface adhesin A, and pneumococcal surface protein A (PspA), have been considered as alternative means to induce protective immunity in infants and children. The increased frequency of isolation of multidrug-resistant strains of S. pneumoniae accentuates the need for an effective vaccine (6).

PspA, a surface protein and virulence factor found on all isolates of S. pneumoniae (7), is highly immunogenic im·mu·no·gen·ic
adj.
Producing an immune response.



immunogenic

producing immunity; evoking an immune response.
 (6-8). PspAs share many cross-reactive epitopes, and immunization immunization: see immunity; vaccination.  with a single PspA is cross-protective in mice against fatal infection with strains of the mouse virulent capsular types (6,9,10). Mucosal immunization with PspA can also elicit immunity to carriage (11,12).

Information about the basic protein structural domains of PspA came from the DNA sequences of the pspA/Rx1 and the pspA/EF5668 genes (13,14). The five domains include 1) a signal peptide, 2) an alpha-helical charged domain (amino acids 1-288), 3) a proline-rich region (amino acids 289-370), 4) a choline-binding domain consisting of 9 to 10 twenty-amino-acid repeats (amino acid 371-571), and 5) a C-terminal 17-amino-acid tail (amino acids 572-589). These amino-acid positions are based on the pspA/Rx1 sequence (14).

A portion of pspA/Rx1 (amino acids 192-260) has been identified that elicits cross-protective antibody responses (15). Many PspA molecules have been examined to aid in the development of PspA as a protein-based vaccine (16). From the alignment of PspA sequences of 24 strains, the sequence differences in a centrally located clade-defining region were used to group PspA proteins into six clades (16). Within the clade-defining region, sequences in the same clade clade Cladus, subtype Genetics A branch of biological taxa or species that share features inherited from a common ancestor; a single phylogenetic group or line. See Inheritance, Species.  share at least 80% amino-acid identity. The clade-defining region is roughly the same as that shown to elicit cross-protective responses (15,16). The six clades have also been grouped into three families. Sequences share at least 50% sequence identity in each family (16).

During the 1990s, the Colombian Pneumococcal Study Group investigated the capsular type distribution and antimicrobial susceptibility of invasive isolates from children < 5 years of age (17). The data obtained may guide selection of polysaccharides to include in vaccines for use in Latin America. In Colombia and other Latin American countries, the prevalence of strains of capsular serotypes 1 and 5 is higher than in North America (18,19). The study demonstrated that vaccine formulations based only on North American data might not be as effective in Latin America because of the differing distributions of capsular types. Surveillance of isolates has continued to monitor any shifts in the antigenic types of pneumococci (20).

Our study was intended to expand our knowledge of vaccine coverage for a potential protein-based vaccine in Colombian isolates. We determined the frequency of family 1 and family 2 PspAs among S. pneumoniae isolates from Colombia that express one of the seven most common capsular types. Our results will be coordinated with those from laboratories in other Latin American countries to learn the diversity of PspA over the entire region. At present, however, only the Colombian isolates have been investigated completely.

Materials and Methods

Forty S. pneumoniae invasive isolates, representing each year from 1994 through 1998, were selected from the seven most common capsular types in Colombia. All isolates were confirmed to be S. pneumoniae by standard procedures (alpha-hemolysis, Gram stain, optochin test, and bile solubility) (21). Antimicrobial susceptibility patterns were not considered in the selection of isolates.

Pneumococci were cultured for 6 hr in 10 mL Todd-Hewitt broth (Difco, Detroit, MI) supplemented with 1% yeast extract, 1% glucose, and 22 [micro]g/mL glutamic acid. After centrifugation Centrifugation

A mechanical method of separating immiscible liquids or solids from liquids by the application of centrifugal force. This force can be very great, and separations which proceed slowly by gravity can be speeded up enormously in centrifugal
, the cells were resuspended in 0.1 mL TE (10 mM Tris HCL HCl

hydrochloric acid.
, 1mM EDTA EDTA: see chelating agents. , pH 8.0), and lysozyme lysozyme: see immunity.
Lysozyme

An enyme that was first identified and named by Alexander Fleming, who recognized its bacteriolytic properties.
 (10 [micro]L at 50 mg/mL) was added. The cells were incubated for 30 min at 37 [degrees] C, and 0.5 mL GES GES GTN (Global Transportation Network) Exercise System
GES General Estimates System (NHTSA)
GES Ghana Education Service
GES Government Economic Service (UK) 
 (5 M guanidine guanidine /gua·ni·dine/ (gwah´ni-den) the compound NHdbondC(NH2)2, a strong base found in the urine as a result of protein metabolism and used in the laboratory as a protein denaturant.  thiocyanate thiocyanate /thio·cy·a·nate/ (-si´ah-nat) a salt analogous in composition to a cyanate, but containing sulfur instead of oxygen. , 0.1 M EDTA, pH 8.0, and 0.5% sarkosyl) was added. After incubation at room temperature for 10 min, 0.25 mL (7.5 M) ammonium acetate was added, and the cells were mixed and placed on ice for 10 min. Chloroform/isoamyl alcohol (24:1) was added and mixed, the phases were separated by centrifugation, and 0.7 mL of aqueous phase was recovered. The DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 was precipitated with ethanol and resuspended in 50-100 [micro]L of TE (22).

Polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is  (PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
) was carried out on genomic DNA. The oligonucleotide primers for family 1 were LSM LSM Linux Software Map
LSM Louisiana State Museum
LSM Linux Security Module
LSM Living Stream Ministry
LSM Laser Scanning Microscopy
LSM Legato Storage Manager
LSM Land-Surface Model
LSM Lutheran Student Movement
LSM Logical Storage Manager
12, 5'CCGGATCCAGCGTCGCTATCTTAGGGGCTGGTT3' (23) and SKH SKH Stichting Keuringsbureau Hout (Dutch)
SKH Session Key Header
63, 5'TTTCTGGCTCAT(C and T)AACTGCTTTC3' (at position 12 C and T in a 1:1 ratio) and for family 2 were LSM12, 5'CCGGATCCAGCGTCGCTATCTTAGGGGCTGGTT3' and SKH52, 5'TGGGGGTGGAGTTTCTTCTTCATCT3'. The following PCR conditions were used: an initial 95 [degrees] C (3 min), 30 cycles of 95 [degrees] C (1 min), 62 [degrees] C (1 min) and 72 [degrees] C (3 min), followed by 72 [degrees] C (10 min) (15) in a PTC (PTC, Needham, MA, www.ptc.com) Long a world leader in mechanical computer-aided design, manufacturing and engineering software, PTC, through acquisitions and reorganization, has transformed itself into a leading provider of Internet-based B2B solutions for discrete manufacturers.  150 Thermocycler (MJ Research, Watertown, MA). PCR products were initially run at an annealing annealing (ənēl`ĭng), process in which glass, metals, and other materials are treated to render them less brittle and more workable.  temperature of 62 [degrees] C. Any isolates yielding no product at 62 [degrees] C were repeated at annealing temperatures of 65 [degrees] C or 58 [degrees] C and then 55 [degrees] C to account for potential sequence divergence in the primer region. The amplified PCR products were approximately 1,000 bp for family 1 and 1,200 bp for family 2. The PCR product was run on an agarose agarose

more highly purified form of agar with similar uses to agar and widely used in the separation of nucleic acid fragments.
 gel at 80 volts for 1.5 hr, and the gel was stained with 0.5 [micro]g/mL ethidium bromide. Molecular weight standard for gel electrophoresis was the 1.0-kb ladder DNA (Promega, Madison, WI). Strains BG9739 (clade 1) and AC122 (clade 3) were used as controls for family 1 and 2 tests, respectively (16). The PspA family of these strains has been confirmed by DNA sequence of their pspA genes (16).

A pool of immune sera for typing PspA families came from two rabbits, one immunized with rPspA/L82016 (clade 1) and the other with rPspA/Rxl (clade 2). The antisera for typing PspA family 2 came from a pool of serum from two rabbits immunized with either PspA/V-024 (clade 3) or PspA/ V-032 (clade 4). Recombinant PspA/Rx1 was added to this pool to reduce cross-reactivity with family 1 (clade 1 and 2) PspAs.

PspAs were recombinant products from Escherichia coli strains bearing plasmids with cloned pspA genes. The region of PspA in the cloned fragment includes the entire alpha-helical region of the protein and in some cases some of the proline-rich region, which is C-terminal to the alpha-helical region. The gene fragments were cloned into pET-20b vector from Novagen (Madison, WI) between the NcoI and the XhoI cloning sites. This procedure results in an additional 10 amino acids on the C-terminus of the recombinant protein, which includes a polyhistidine for purification. Recombinant proteins were produced in E. coli strain BL21 (DE3) from Novagen and purified by nickel-affinity chromatography, as recommended by the manufacturer. Rabbits were immunized subcutaneously with 10 [micro]g of protein with complete Freund's adjuvant, followed by a second 10-[micro]g injection 1 month later with incomplete Freund's adjuvant and a final 10-[micro]g booster after another month. Rabbits were bled 2 weeks after the last booster.

Pneumococcal isolates were cultured for 6 hr in 10 mL Todd-Hewitt broth (Difco) supplemented as described. After centrifugation, cells were resuspended in 3 mL sterile phosphate-buffered saline (PBS PBS
 in full Public Broadcasting Service

Private, nonprofit U.S. corporation of public television stations. PBS provides its member stations, which are supported by public funds and private contributions rather than by commercials, with educational, cultural,
), and 500 [micro]L lysis buffer (0.1% sodium deoxycholate, 0.01% sodium dodecyl sulfate Sodium dodecyl sulfate (or sulphate) (SDS or NaDS) (C12H25NaO4S),is an anionic surfactant that is used in household products such as toothpastes, shampoos, shaving foams and bubble baths for its thickening effect and its ability to , and 0.15M sodium citrate in 100 [micro]L deionized water) was added. The mixture was incubated at room temperature for 30 min.

Protein in lysates was measured by using bicinchoninic acid as described by Smith et al. (24) with some modifications. The lysate ly·sate
n.
The cellular debris and fluid produced by lysis.
 samples were diluted 1:3.5 in sterile PBS. Then, 10 [micro]L of each sample was loaded into a microplate well (U bottom, Becton-Dickinson, Cockeysville, MD) and 200 [micro]L of a 50:1 mixture of reagent A (bicinchoninic acid [BCA-SIGMA B9643, Sigma, St. Louis, MO]) and reagent B (copper [II] sulfate sulfate, chemical compound containing the sulfate (SO4) radical. Sulfates are salts or esters of sulfuric acid, H2SO4, formed by replacing one or both of the hydrogens with a metal (e.g., sodium) or a radical (e.g., ammonium or ethyl).  pentahydrate 4% [SIGMA C2284, Sigma]) was added. The microplate was incubated for 30 min and absorbance absorbance /ab·sor·bance/ (-sor´bans)
1. in analytical chemistry, a measure of the light that a solution does not transmit compared to a pure solution. Symbol .

2.
 at 562 nm (BIO-RAD ELISA ELISA (e-li´sah) Enzyme-Linked Immuno-Sorbent Assay; any enzyme immunoassay using an enzyme-labeled immunoreactant and an immunosorbent.

ELISA
n.
 reader model 3550, Hercules, CA) was compared with a protein bovine serum albumin (BSA 1. BSA - Business Software Alliance.
2. BSA - Bidouilleurs Sans Argent.
) standard curve (1 mg/mL).

After the protein concentration of each lysate was adjusted to 60 [micro]g/mL, 1 [micro]L of lysate and 1 [micro]L each from dilutions 1:5 (12 [micro]g/mL), 1:25 (2.4 [micro]g/mL), and [is less than or equal to] 1:125 (0.48 [micro]g/ mL) were spotted onto two nitrocellulose nitrocellulose, nitric acid ester of cellulose (a glucose polymer). It is usually formed by the action of a mixture of nitric and sulfuric acids on purified cotton or wood pulp.  membranes (Millipore, Bedford, MA) for dot-blot analysis. Each membrane was immersed in 1% BSA/PBST blocking buffer (0.05% Tween tween  
n.
A child between middle childhood and adolesence, usually between 8 and 12 years old.



[Blend of teen1 and between.]
 20, I mM EDTA pH 8.5, 1% BSA in sterile PBS, incubated at room temperature for 1 hr, and washed three times with sterile PBS. Membranes were then immersed in a dilution of anti-PspA rabbit polyclonal antibodies (1:5,000 in blocking buffer) and incubated at room temperature for 1 hr. Rabbit antisera for families 1 and 2 were processed on separate dot blots. The membranes were then washed three times with sterile PBS and incubated with a biotinylated goat anti-rabbit antibody diluted 1:3,000. The final incubation was with streptavidin-conjugated alkaline phosphatase diluted 1:3,000 and incubated for 1 hr, followed by another washing step. Alkaline phosphatase staining was developed with NBT (NetBIOS over TCP/IP) Support for the NetBIOS protocol in Windows when running in a TCP/IP network. NBT supports legacy applications that use the NetBIOS protocol as well as NetBIOS name resolution, which converts NetBIOS names into IP addresses.  solution (2 mg nitroblue tetrazolium nitroblue tetrazolium

a yellow dye converted to a blue color on reduction.


nitroblue tetrazolium test
used to measure the phagocytic activity of polymorphonuclear leukocytes by the amount of color change in the dye.
, 10 mg BCIP BCIP Brainbench Certified Internet Professional
BCIP 5-Bromo-4-Chloro-Indolyl-Phosphatase (used for western blot processing)
BCIP Battle Command Integration Program
BCIP Battle Command Improvement Program
BCIP Business Continuity Insurance Process
 [5-bromo-4-chloro-3-indolyl phosphate, p-toluidine salt], 200 [micro]L dimethyl sulfoxide in 20 mL Tris HCl, pH 8.8) with constant shaking until control dots appeared purple. Assignment of the serologic se·rol·o·gy  
n. pl. se·rol·o·gies
1. The science that deals with the properties and reactions of serums, especially blood serum.

2.
 dot-blot results was based on the highest titer of each lysate that reacted with the dilution of the anti-family 1 and anti-family 2 antiserum antiserum /an·ti·se·rum/ (an´ti-se?rum) a serum containing antibody(ies), obtained from an animal immunized either by injection of antigen or by infection with microorganisms containing antigen. . BG9739 (clade 1) and EF10197 (clade 2) were used as reference strains for serologic family 1 typing. AC122 (clade 3), BG11703 (clade 4) and ATCC ATCC American Type Culture Collection, see there 6303 (clade 5) were used as reference strains for typing family 2 (16).

Results

PCR products ranged from 960 to 1,000 bp for family 1, and 1,200 to 1,400 bp for family 2 (Figure). Although all lysates of family 1 strains reacted with the family 1 antiserum at 1:5,000 dilution, the antiserum cross-reacted weakly with family 2 lysates, which could generally be detected at a [less than or equal to] 1:25 dilution but not at higher dilutions. The family 2 antiserum reacted only with the PspAs of family 2 strains, regardless of the dilution. Nevertheless, the combination of the two techniques could reliably detect the PspA family of all strains. The PspA PCR and the PspA serologic dot-blot techniques correlated in 100% of cases.

Of the 40 isolates studied, 25 (62.5%) were family 1 PspA (Table). Family 1 PspAs were found among isolates with capsular types 14, 6B, 23F, 5, 19F, 1, 8, and 35. All invasive isolates capsular type 6B, 5, and 19F were family 1. Fourteen (35%) isolates were family 2, including strains of capsular types 14, 23F, 9, 3, 8, and 35. The relative distribution of family 1 isolates to family 2 isolates did not fluctuate substantially over the 4-year period. Isolate Co-29, which was capsular type 1, was the only one (2.5%) of the 40 that was neither family 1 or family 2. The remaining four isolates of capsular type 1 were family 1.

Conclusion

A vaccine composed of PspA is hypothesized to protect against invasive disease and also eliminate the carriage state. Yamamoto et al. (25) reported that intranasal in·tra·na·sal
adj.
Within the nose.
 administration of PspA in mice together with a nontoxic adjuvant adjuvant /ad·ju·vant/ (aj?dbobr-vant) (a-joo´vant)
1. assisting or aiding.

2. a substance that aids another, such as an auxiliary remedy.

3.
 (mCT S61F) is an effective mucosal vaccine against pneumococcal infection. In another study, active immunization with PspA reduced the signs of purulent pu·ru·lent
adj.
Containing, discharging, or causing the production of pus.


Purulent
Consisting of or containing pus

Mentioned in: Lacrimal Duct Obstruction


purulent

containing or forming pus.
 otitis media in rats, although the challenge strain contained a PspA that differed from the immunogen (26). More recently, immune sera from human volunteers immunized with PspA protected against fatal pneumococcal infection in mice (27).

All the Colombian isolates were invasive, and all but one belonged to PspA families 1 or 2. This finding is relevant to efforts to develop PspA into a human vaccine component. The distribution of the Colombian isolates between PspA families 1 and 2 did not differ substantially from that observed for isolates from North America and Europe (16). Therefore, a vaccine formulation including these two families might cover isolates from both North and South America with equal effectiveness. Latin America has a varied distribution of capsular serotypes (17-19), which lessens the potential for effectiveness of the heptavalent Hep`tav´a`lent

a. 1. (Chem.) Having seven units of attractive force or affinity; - said of heptad elements or radicals.
 conjugate vaccine recently approved in the United States (28).

We have obtained information about pulsed-field gel electrophoresis and penicillin-binding protein patterns and capsular types of Colombian strains with diminished susceptibility to penicillin (20,29,30). Characterizing PspA families of these penicillin-resistant strains and examining representatives of different multiresistant international clones will be of interest for future studies.
Table. Streptococcus pneumoniae PspA families 1 and 2 from 40
Colombian isolates

Isolates (Code INS (a))         Date               Source

Co-1(2)                       17/12/93             Blood
Co-2 (125)                    12/12/94              CSF
Co-3 (146)                    25/01/95             Blood
Co-4 (309)                    17/01/96              PLF
Co-5 (E-212)                  16/06/98              CSF
Co-6 (95)                     17/06/93              CSF
Co-7 (20)                     19/06/94             Blood
Co-8 (149)                    04/02/95              CSF
Co-9 (322)                    10/02/96              CSF
Co-10 (E-10)                  03/05/96             Blood
Co-11(14)                     20/04/94              PLF
Co-12 (23)                    22/06/94              CSF
Co-13 (152)                   15/02/95              CSF
Co-14 (E-8)                   03/05/96              CSF
Co-15 (E-99)                  19/03/97              CSF
Co-16 (7)                     25/03/94              PLF
Co-17 (106)                   10/11/94             Blood
Co-18 (177)                   06/04/95             Blood
Co-19 (316)                   24/01/96             Blood
Co-20 E-220)                  24/07/98              CSF
Co-21(10)                     25/04/94              CSF
Co-22 (179)                   08/04/95              CSF
Co-23 (318)                   27/01/96             Blood
Co-24 (E-124)                 04/07/97              CSF
Co-25 (E-159)                 23/10/97              CSF
Co-26 (5)                     19/03/94             Blood
Co-27 (99)                    04/11/93              CSF
Co-28 (165)                   01/03/95             Blood
Co-29 (315)                   26/01/96              PLF
Co-30 (E-107)                 16/04/97             Blood
Co-31(51)                     04/09/94              PLF
Co-32 (E-24)                  14/06/96              CSF
Co-33 (119)                   25/11/94             Blood
Co-34 (E-140)                 02/09/97              CSF
Co-35 (216)                   06/06/95             Blood
Co-36 (E-135)                 13/08/97              CSF
Co-37 (E-66)                  07/11/96              CSF
Co-38 (300)                   18/12/95             Blood
Co-39 (E-25)                  14/06/96              CSF
Co-40 (320)                   06/02/96              CSF

Isolates (Code INS (a))     Capsular type      PCR & dot blot

Co-1(2)                          14               Family 1
Co-2 (125)                       14               Family 2
Co-3 (146)                       14               Family 2
Co-4 (309)                       14               Family 1
Co-5 (E-212)                     14               Family 2
Co-6 (95)                        6B               Family 1
Co-7 (20)                        6B               Family 1
Co-8 (149)                       6B               Family 1
Co-9 (322)                       6B               Family 1
Co-10 (E-10)                     6B               Family 1
Co-11(14)                        23F              Family 2
Co-12 (23)                       23F              Family 2
Co-13 (152)                      23F              Family 1
Co-14 (E-8)                      23F              Family 1
Co-15 (E-99)                     23F              Family 2
Co-16 (7)                         5               Family 1
Co-17 (106)                       5               Family 1
Co-18 (177)                       5               Family 1
Co-19 (316)                       5               Family 1
Co-20 E-220)                      5               Family 1
Co-21(10)                        19F              Family 1
Co-22 (179)                      19F              Family 1
Co-23 (318)                      19F              Family 1
Co-24 (E-124)                    19F              Family 1
Co-25 (E-159)                    19F              Family 1
Co-26 (5)                         1               Family 1
Co-27 (99)                        1               Family 1
Co-28 (165)                       1               Family 1
Co-29 (315)                       1              [0.sup.b]
Co-30 (E-107)                     1               Family 1
Co-31(51)                        9V               Family 2
Co-32 (E-24)                     9N               Family 2
Co-33 (119)                       3               Family 2
Co-34 (E-140)                     3               Family 2
Co-35 (216)                       8               Family 2
Co-36 (E-135)                     8               Family 1
Co-37 (E-66)                      4               Family 2
Co-38 (300)                      35B              Family 1
Co-39 (E-25)                     35B              Family 2
Co-40 (320)                      35F              Family 2

(a) INS = Instituto Nacional de Salud; PCR = polymerase chain
reaction; CSF = cerebrospinal fluid; PLF = pleural fluid.

(b) Co-29 did not amplify or react with either family.
Figure. Polymerase chain reaction for PspA families 1 and 2: lanes 1
and 2 were controls for families 1 and 2, respectively. Lanes 3 to 7
and 9 (Co-24, Co-25, Co-26, Co-27, Co-28, Co-29, Co-30 isolates) were
family 1. Lane 8 (Co-29) did not amplify with either family. The
molecular weight was 1-kb ladder DNA (Promega).


Acknowledgments

We thank J. King, A. Swift, S. Chambers, and M. Golden for teaching us the techniques required for this study and H. Roch for careful reading of the manuscript.

This work was partially funded through the Gorgas Memorial Institute and from the U. S. Agency for International Development through the Harvard Institute for International Development. Additional financial support was provided by the Pan American Health Organization The Pan American Health Organization (PAHO) is an international public health agency with 100 years of experience in working to improve health and living standards of the countries of the Americas. It serves as the specialized organization for health of the Inter-American System.  and the Canadian International Development Agency The Canadian International Development Agency (CIDA) is a Canadian government agency which administers foreign aid programs in developing countries. CIDA operates in partnership with other Canadian organizations in the public and private sectors as well as other .

References

(1.) Hoges RG, MacLeod CM. Epidemic pneumococcal pneumoniae. I. Description of the epidemic. Am J Hyg 1946;44:183-92.

(2.) Klein JO, Teele DW, Sloyer JL, Ploussard JH, Howie V, Makela PH, et al. Use of pneumococcal vaccine for prevention of recurrent episodes of otitis media. In: Robbins JB, Sadoff JC, editors. Bacterial vaccines. New York: Thime-Stratton Press; 1982. p. 305-10.

(3.) Cowan MJ, Ammann AJ, Wara DW, Howie VM, Schultz L, Doyle N, et al. Pneumococcal polysaccharide immunization in infants and children. Pediatrics 1978;62:721-7.

(4.) Sniadack DH, Schwartz B, Lipman H. Potential interventions for the prevention of childhood pneumoniae: geographic and temporal differences in serotype and serogroup distribution of sterile site pneumococcal isolates from children-implications for vaccine strategies. Pediatr Infect Dis J 1995;14:503-10.

(5.) Gray BM, Dillion HC, Briles DE. Epidemiological studies of Streptococcus pneumoniae in infants: development of antibody to phosphocholine. J Clin Microbiol 1983;18:1102-7.

(6.) Briles DE, Creech T, Swiartlo E, Dillard JP, Smith P, Benton KA, et al. Pneumococcal diversity: considerations for new vaccine strategies with emphasis on pneumococcal surface protein A (PspA). Clin Microbiol Rev 1998;11:645-57.

(7.) McDaniel LS, Yother J, Vijayakumar M, McGarry L, Guild WR, Briles DE. Use of insertional inactivation to facilate studies of biological properties of pneumococcal surface protein A (PspA). J Exp Med 1987;165:381-94.

(8.) Crain MJ, Waltman II WD, Turner JS, Yother J, Talkington DF, McDaniel LS, et al. Pneumococcal surface protein A (PspA) is serologically highly variable and is expressed by all clinically important capsular serotypes of Streptococcus pneumoniae. Infect Immun 1990;58:3293-9.

(9.) McDaniel LS, Scott G, Kearney JF, Briles DE. Monoclonal antibodies against protease-sensitive pneumococcal antigens can protect mice from fatal infection with Streptococcus pneumoniae. J Exp Med 1984;160:386-97.

(10.) McDaniel LS, Sheffield JS, Delucchi P, Briles DE. PspA, a surface protein of Streptococcus pneumoniae, is capable of eliciting protection against pneumococci of more than one capsular serotype. Infect Immun 1991;59:222-8.

(11.) Briles DE, Ades E, Paton JC, Sampson JS, Carlone JM, Huebner RC, et al. Intranasal immunization of mice with a mixture of the pneumococcal proteins PsaA and PspA is highly protective against nasopharyngeal nasopharyngeal

pertaining to the nasal and pharyngeal cavities.


nasopharyngeal meatus
see nasopharyngeal meatus.

nasopharyngeal spasm
see reverse sneeze.
 carriage of Streptococcus pneumoniae. Infect Immun 2000;68:796-800.

(12.) Wu H-Y, Nahm M, Guo Y, Russell M, Briles DE. Intranasal immunization of mice with PspA (pneumococcal surface protein A) can prevent intranasal carriage and infection, and sepsis with Streptococcus pneumoniae. J Infect Dis 1997;175:893-6.

(13.) McDaniel LS, McDaniel DO, Hollingshead SK, Briles DE. Comparison of the PspA sequence from Streptococcus pneumoniae EF5668 to the previously identified PspA sequence from strain Rx1 and ability of PspA from EF5668 to elicit protection against pneumococci of different capsular types. Infect Immun 1998;66:4748-54.

(14.) Yother J, Briles DE. Structural properties and evolutionary relationships of PspA, a surface protein of Streptococcus pneumoniae, as revealed by sequence analysis. J Bacteriol 1992;174:601-9.

(15.) McDaniel LS, Ralph BA, McDaniel DO, Briles DE. Localization Customizing software and documentation for a particular country. It includes the translation of menus and messages into the native spoken language as well as changes in the user interface to accommodate different alphabets and culture. See internationalization and l10n.  of protection-eliciting epitopes on PspA of Streptococcus pneumoniae between amino acid residues 192 and 260. Microb Pathog 1994;17:323-37.

(16.) Hollingshead SK, Becker R, Briles DE. Diversity of PspA: mosaic genes and evidence for past recombination recombination, process of "shuffling" of genes by which new combinations can be generated. In recombination through sexual reproduction, the offspring's complete set of genes differs from that of either parent, being rather a combination of genes from both parents.  in Streptococcus pneumoniae. Infect Immun 2000;68:5889-900.

(17.) Di Fabio J-L, Homma A, De Quadros C. Pan American Health Organization epidemiological surveillance network for Streptococcus pneumoniae. Microb Drug Resist 1997;3:131-3.

(18.) Castaneda E, Leal LEAL. Loyal; that which belongs to the law.  AL, Castillo O, de la Hoz de la Hoz is a common surname in the Spanish language meaning of the sickle.
  • Aitor Karanka de la Hoz (born 1973), Spanish/Basque footballer
  • Mike de la Hoz (born 1938), Cuban baseball player
  • Nicolas De la Hoz (born 1960), Colombian artist
 F, Vela vela

plural of velum.
 MC, Arango M, et al. Distribution of capsular types and antimicrobial susceptibility of invasive isolates of Streptococcus pneumoniae in Colombian children. Pneumococcal Study Group in Colombia. Microb Drug Resist 1997;3:147-52.

(19.) Kertesz D, Di Fabio JL, Brandileone MC, Castaneda E, Echaniz G, Heitman I, et al. Invasive Streptococcus pneumoniae infection in Latin-America children: result of the Pan-American Health Organization Pan-American Health Organization, inter-American health organization. It was established in 1902 as the International Sanitary Bureau; the present name was adopted in 1958. Its members include all the Latin American nations, Canada, and the United States.  surveillance study. Clin Infect Dis 1998;26:1355-61.

(20.) Vela MC, Fonseca N, Di Fabio JL, Castaneda E. Presence of international multiresistant clones of Streptococcus pneumoniae in Colombia. Microb Drug Resist. In press 2001.

(21.) Facklam RR, Washington JA II. Streptococcus streptococcus (strĕp'təkŏk`əs), any of a group of gram-positive bacteria, genus Streptococcus, some of which cause disease.  and related catalase-negative Gram positive cocci cocci /coc·ci/ (kok´si) plural of coccus.

cocci

[L.] plural of coccus.
. In: Balows A, Hausler WJ Jr, Hermann KL, Isenberg HD, Shadomy HJ, editors. Manual of clinical microbiology. 5th ed. Washington: American Society for Microbiology The American Society for Microbiology (ASM) is a scientific organization, based in the United States although with over 43,000 members throughout the world. It is the largest single life science professional organization and its members include those whose interests encompass basic ; 1991:238-57.

(22.) Pitcher DG, Saunders NA, Owen RJ. Rapid extraction of bacterial genomic DNA with guanidium thyocyanate. Lett Appl Microbiol 1989;8:151-6.

(23.) Swiatlo E, Brooks-Walter A, Briles DE, McDaniel LS. Oligonucleotides identify conserved and variable regions of pspA and pspA-like sequences of Streptococcus pneumoniae. Gene 1997;188:279-84.

(24.) Smith PK, Krohn RI, Hermanson GT, Mallia AK, Gartner FH, Provenzano MD, et al. Measurement of protein using bicinchonicic acid. Anal Biochem 1985;150:76-85.

(25.) Yamamoto M, Briles DE, Yamamoto S, Ohmura M, Kiyono H, McGhee JR. A nontoxic adjuvant for mucosal immunity to pneumococcal surface protein A. J Immunol 1998;161:4115-21.

(26.) White P, Hermansson A, Svanborg C, Briles DE, Prellner K. Effects of active immunization with a pneumococcal surface protein (PspA) and of locally applied antibodies in experimental otitis media. ORL ORL Oto-Rhino Laryngologie (France)
ORL Orlando Executive Airport (Airport Code)
ORL Optical Return Loss
ORL Journal for Oto-Rhino-Laryngology and its related specialties
 J Otorhinolaryngol Relat Spec 1999;4:206-11.

(27.) Briles DE, Hollingshead SK, King JE, Swift A, Braun P, Ferguson LM, et al. Immunization of human volunteers with recombinant PspA elicits antibodies that passively protect mice. ORL J Otorhinolaryngol Relat Spec 1999;4:206-11.

(28.) Black S, Shinefield H, Fireman B, Lewis E, Ray P, Hansen JR, et al. Efficacy, safety and immunogenicity immunogenicity /im·mu·no·ge·nic·i·ty/ (-je-nis´it-e) the property enabling a substance to provoke an immune response, or the degree to which a substance possesses this property.  of heptavalent pneumococcal conjugate vaccine Pneumococcal conjugate vaccine is a vaccine used to protect infants and young children against disease caused by the bacterium Streptococcus pneumoniae (pneumococcus).  in children. Northern California Kaiser permanent vaccine study center group. Pediatr Infect Dis J 2000;22:187-95.

(29.) Castaneda E, Penuela I, Vela MC, the Colombian Pneumococcal Study Group, Tomasz A. Penicillin-resistant Streptococcus pneumoniae in Colombia: presence of international epidemic clones. Microb Drug Resist 1998;4:233-9.

(30.) Tomasz A, Corso A, Severina EP, Echaniz-Aviles G, Brandileone MC, Camou T, et al. Molecular epidemiologic characterization of penicillin-resistant Streptococcus pneumoniae invasive pediatric pediatric /pe·di·at·ric/ (pe?de-at´rik) pertaining to the health of children.

pe·di·at·ric
adj.
Of or relating to pediatrics.
 isolates recovered in six Latin-American countries: an overview. PAHO/Rockefeller University Workshop. Microb Drug Resist 1998;4:195-207.

Maria Claudia Vela Coral, * Nacxiry Fonseca, * Elizabeth Castaneda, * Jose Luis Di Fabio, ([dagger]) Susan K. Hollingshead, ([double dagger]) and David E. Briles ([double dagger])

* Instituto Nacional de Salud, Bogota, Colombia; ([dagger]) Pan American Health Organization, Washington, DC, USA; and ([double dagger]) University of Alabama The University of Alabama (also known as Alabama, UA or colloquially as 'Bama) is a public coeducational university located in Tuscaloosa, Alabama, USA. Founded in 1831, UA is the flagship campus of the University of Alabama System. , Birmingham, Alabama, USA

Ms. Vela is a scientific investigator in the Microbiology Group at Instituto Nacional de Salud in Bogota, Colombia. Her research interests focus on resistant and multidrug-resistant Streptococcus pneumoniae recovered from children < 5 years of age.

Address for correspondence: Maria Claudia Vela Coral, Grupo Microbiologia, Instituto Nacional de Salud, Avenida Calle 26 No. 50-60, Zona 6 CAN Bogota, Colombia; fax: 571-222 0194/3055; e-mail: mvela@hemagogus.ins.gov.co
COPYRIGHT 2001 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2001, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Author:Briles, David E.
Publication:Emerging Infectious Diseases
Article Type:Statistical Data Included
Geographic Code:3COLO
Date:Sep 1, 2001
Words:4034
Previous Article:Intraoperative redosing of cefazolin and risk for surgical site infection in cardiac surgery. (Research).(Statistical Data Included)
Next Article:Epidemiology of and surveillance for postpartum infections. (Research).(Statistical Data Included)
Topics:



Related Articles
High Prevalence of Penicillin-Nonsusceptible Streptococcus pneumoniae at a Community Hospital in Oklahoma.
Bacterial Vaccines and Serotype Replacement: Lessons from Haemophilus influenzae and Prospects for Streptococcus pneumoniae.
Adhesins as Targets for Vaccine Development.
Nasopharyngeal carriage of Streptococcus pneumoniae in healthy children: implications for the use of heptavalent pneumococcal conjugate vaccine....
Facial cellulitis in childhood: a changing spectrum.
Antimicrobial resistance in Streptococcus pneumoniae, Taiwan. (Synopsis).
Poor potential coverage for 7-valent pneumococcal conjugate vaccine, Malawi. (Dispatches).
Vaccines for women age 50 and older.(International Conference On Women And Infectious Diseases)
Erythromycin-nonsusceptible Streptococcus pneumoniae in children, 1999-2001.(DISPATCHES)
The prevalence of colonization with drug-resistant pneumococci among adult workers in children's daycare.

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles