Printer Friendly
The Free Library
14,505,210 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Perinatal bisphenol a exposure increases estrogen sensitivity of the mammary gland in diverse mouse strains.


BACKGROUND: Studies of low-dose effects of xenoestrogens have yielded conflicting results that may be attributed to differences in estrogen sensitivity between the rodent rodent, member of the mammalian order Rodentia, characterized by front teeth adapted for gnawing and cheek teeth adapted for chewing. The Rodentia is by far the largest mammalian order; nearly half of all mammal species are rodents.  strains examined. Perinatal perinatal /peri·na·tal/ (-na´t'l) relating to the period shortly before and after birth; from the twentieth to twenty-ninth week of gestation to one to four weeks after birth.

per·i·na·tal
adj.
 exposure of CD-1 mice to low doses of the xenoestrogen bisphenol A Bisphenol A is a chemical compound containing two phenol functional groups. It belongs to the phenol class of aromatic organic compounds. It is widely prepared and sold and various important polymers/plastics are made from it.  (BPA BPA British Paediatric Association. ) alters peripubertal mammary gland mammary gland, organ of the female mammal that produces and secretes milk for the nourishment of the young. A mammal may have from 1 to 11 pairs of mammary glands, depending on the species. Generally, those mammals that bear larger litters have more glands.  development. Future studies to assess the role of estrogen receptors as mediators of BPA action require estrogen receptor knock-out mice that were generated on a C57Bl6 background. The sensitivity of the C57Bl6 strain to estradiol estradiol /es·tra·di·ol/ (es?trah-di´ol) (es-tra´de-ol) the most potent estrogen in humans; pharmacologically, it is often used in the form of its esters (e.g., e. cypionate, e.  and BPA is unknown.

OBJECTIVES: In the present study we examined whether the mammary glands of CD-1 and C57Bl6 mice exhibited similar responses to 17[beta]-estradiol ([E.sub.2]) and whether perinatal exposure to BPA equally enhanced sensitivity of the mammary glands to [E.sub.2] at puberty puberty (py`bərtē), period during which the onset of sexual maturity occurs. .

METHODS: Immature mice were ovariectomized and treated for 10 days with one of eight doses of [E.sub.2]. Morphological mammary gland parameters were examined to identify doses producing half-maximal effects. Mice were exposed perinatally to 0 or 250 ng BPA/kg body weight (bw)/day from gestational day 8 until postnatal postnatal /post·na·tal/ (-na´t'l) occurring after birth, with reference to the newborn.

post·na·tal
adj.
Of or occurring after birth, especially in the period immediately after birth.
 day (PND (Personal Navigation Device) A portable GPS-based navigation system that can be used when walking, hiking or in any vehicle. See GPS. ) 2. On PND25, female offspring Noun 1. female offspring - a child who is female
female person, female - a person who belongs to the sex that can have babies

child, kid - a human offspring (son or daughter) of any age; "they had three children"; "they were able to send their kids to
 were ovariectomized and given an estrogen challenge of 0, 0.5, or 1 [micro]g [E.sub.2]/kg bw/day for 10 days. Morphometric parameters of the mammary gland were compared between strains.

RESULTS: Both strains exhibited similar responses to [E.sub.2]. Perinatal BPA exposure altered responses to [E.sub.2] at puberty for several parameters in both strains, although the effect in CD-1 was slightly more pronounced.

CONCLUSION: Both mouse strains provide adequate models for the study of perinatal exposure to xenoestrogens.

KEY WORDS: BPA, C57Bl6, CD-1, estradiol, estrogen bioassay Bioassay

A method for the quantitation of the effects on a biological system by its exposure to a substance, as well as the quantitation of the concentration of a substance by some observable effect on a biological system.
, mammary gland bioassay, mouse strains, nonmonotonic response, uterotropic assay. Environ Health Perspect 115:592-598 (2007). doi:10.1289/ehp.9640 available via http://dx.doi.org/ [Online 17 January 2007]

**********

Environmental exposure to hormonally active chemicals has coincided with an increase in the incidence in breast cancer (Davis et al. 1993), testicular cancer testicular cancer

Malignant tumour of the testis, or testicle. Although relatively rare, testicular cancer is the most common malignancy for men between the ages of 20 and 34. It typically affects men between 15 and 39 years old.
 (Skakkebaek et al. 1998), and other endocrine-related diseases (Sharpe and Skakkebaek 1993). These outcomes are thought to result from extemporaneous ex·tem·po·ra·ne·ous  
adj.
1. Carried out or performed with little or no preparation; impromptu: an extemporaneous piano recital.

2.
 exposure to synthetic estrogens Estrogens
Hormones produced by the ovaries, the female sex glands.

Mentioned in: Acne, Polycystic Ovary Syndrome

estrogens (es´trōjenz),
n.
 during fetal development (Sharpe and Skakkebaek 1993) and have motivated the worldwide formation of government-sponsored committees to evaluate evidence for this hypothesis. For instance, in the United States United States, officially United States of America, republic (2005 est. pop. 295,734,000), 3,539,227 sq mi (9,166,598 sq km), North America. The United States is the world's third largest country in population and the fourth largest country in area. , the U.S. Environmental Protection Agency Environmental Protection Agency (EPA), independent agency of the U.S. government, with headquarters in Washington, D.C. It was established in 1970 to reduce and control air and water pollution, noise pollution, and radiation and to ensure the safe handling and  (EPA EPA eicosapentaenoic acid.

EPA
abbr.
eicosapentaenoic acid


EPA,
n.pr See acid, eicosapentaenoic.

EPA,
n.
) developed a screening program to test chemicals that may contaminate con·tam·i·nate
v.
1. To make impure or unclean by contact or mixture.

2. To expose to or permeate with radioactivity.



con·tam·i·nant n.
 water and food to assess potential endocrine disruptor Endocrine disruptors are exogenous substances that act like hormones in the endocrine system and disrupt the physiologic function of endogenous hormones. Studies have linked endocrine disruptors to adverse biological effects in animals, giving rise to concerns that low-level  activity (Endocrine Disruptor Screening and Testing Advisory Committee 1998).

At the request of the U.S. EPA, the National Toxicology Program National Toxicology Program Environment A program that conducts toxicologic tests on substances frequently found at the EPA's National Priorities List sites, which have the greatest potential for human exposure  (NTP (Network Time Protocol) A TCP/IP protocol used to synchronize the real time clock in computers, network devices and other electronic equipment that is time sensitive. It is also used to maintain the correct time in NTP-based wall and desk clocks. ) convened a meeting to consider whether environmentally relevant doses of endocrine disruptors caused biological effects. In 2001, the NTP Low-Dose Peer Review Panel published a final report (NTP 2001), which stated that there was "credible evidence for low-dose effects" and suggested that different experimental animal strains may account for reports of both positive and negative effects for the same parameters. In this regard, Spearow et al. (1999) observed that rodent strains selected for high fecundity fecundity /fe·cun·di·ty/ (fe-kun´dit-e)
1. in demography, the physiological ability to reproduce, as opposed to fertility.

2. ability to produce offspring rapidly and in large numbers.
 and rapid growth rates Growth Rates

The compounded annualized rate of growth of a company's revenues, earnings, dividends, or other figures.

Notes:
Remember, historically high growth rates don't always mean a high rate of growth looking into the future.
, such as CD-1 mice, are more estrogen resistant than the less fecund fe·cund
adj.
Capable of producing offspring; fertile.
 C57Bl6.

An additional controversy identified by the NTP was the shape of the dose-response curve dose-response curve A graphic representation of the effects that varous doses of an agent–eg, ionizing radiation or a chemotherapeutic agent, have on a given parameter–eg, cell viability, mutation frequency, DNA damage, tumor growth or metastasis or , which was reported as nonmonotonic for some effects of prenatal xenoestrogen exposure. For example, prenatal methoxychlor methoxychlor

one of the group of chlorinated hydrocarbon insecticides which cause typical signs of that poisoning.
 exposure altered the response of the adult uterus to 17[beta]-estradiol ([E.sub.2]); low doses increased uterine uterine /uter·ine/ (u´ter-in) pertaining to the uterus.

u·ter·ine
adj.
Of, relating to, or in the region of the uterus.
 weight, and higher doses reduced it (Alworth et al. 2002). This type of nonmonotonic response was also observed for other end points with other estrogenic chemicals (Rubin et al. 2001; Vandenberg et al. 2006; vom Saal et al. 1997), arguing that low-dose effects cannot be deduced from effects observed at high doses.

Our research focuses on the effects of perinatal exposure to environmentally relevant levels of the xenoestrogen bisphenol A (BPA). In the the present study we examined strain sensitivity and the shape of the estrogen dose-response curve in the context of our ongoing work in the mouse mammary gland. In addition, we explored the effects of perinatal BPA exposure on subsequent estrogen sensitivity at puberty.

BPA, a compound used in the manufacture of polycarbonate A category of plastic materials used to make a myriad of products, including CDs and CD-ROMs.  plastics and epoxy resins epoxy resins, group of synthetic resins used to make plastics and adhesives. These materials are noted for their versatility, but their relatively high cost has limited their use. , leaches from food and beverage F&B is a common abbreviation in the United States and Commonwealth countries, including Hong Kong. F&B is typically the widely accepted abbreviation for "Food and Beverage," which is the sector/industry that specializes in the conceptualization, the making of, and delivery of foods.  containers (Biles et al. 1997; Brotons et al. 1994) and dental sealants and composites (Olea et al. 1996) under normal conditions
This article is about the philosophical argument; for normal conditions in the sense of standards see the corresponding articles, e.g. Standard conditions for temperature and pressure.
 of use (Markey et al. 2001b, 2003b). BPA levels have been measured in human urine Urine is liquid waste product of the body secreted by the kidneys by a process of filtration from blood and excreted through the urethra. This waste is eventually expelled from the body in a process known as urination.  (Calafat et al. 2005), serum (Takeuchi and Tsutsumi 2002), and maternal and fetal plasma, amniotic fluid amniotic fluid
n.
The fluid within the amnion that surrounds the fetus and protects it from injury.


Amniotic fluid
The liquid that surrounds the baby within the amniotic sac.
, and placental placental

pertaining to or emanating from placenta.


placental barrier
the placental separation of maternal and fetal blood which varies in its structure and permeability between the species.
 tissue at birth (Ikezuki et al. 2002; Schonfelder et al. 2002). We chose to administer perinatally 0 or 250 ng BPA/kg body weight (bw)/day to mice. Based on data reported by Arakawa et al. (2004), we estimated that this level of BPA should fall within the range of reported human exposures.

In the mammary gland, perinatal exposure to BPA alters ductal invasion of the stroma stroma /stro·ma/ (stro´mah) pl. stro´mata   [Gr.] the matrix or supporting tissue of an organ.stro´malstromat´ic

stro·ma
n. pl. stro·ma·ta
1.
 at puberty and increases lateral branching and the number of terminal ends during adulthood (Markey et al. 2001a; Munoz de Toro Toro may refer to:
  • Denominación de Origen Toro, the Spanish wine region
  • Toró, the nickname of Rafael Ferreira Francisco, Brazilian football (soccer) player
 et al. 2005). Although the mechanisms by which BPA induces developmental abnormalities in the mammary gland are unknown, it is plausible that estrogen receptors (ER), which are expressed in the fetal mammary gland, may mediate BPA-induced effects.

In the present study, we compared the response of the mammary glands to [E.sub.2] in outbred out·breed  
tr.v. out·bred , out·breed·ing, out·breeds
To subject to outbreeding.

Adj. 1. outbred - bred of parents not closely related; having parents of different classes or tribes
 CD-1 mice (the strain we have used previously) with inbred in·bred
adj.
1. Produced by inbreeding.

2. Fixed in the character or disposition as if inherited; deep-seated.



inbred

said of offspring produced by inbreeding.
 C57Bl6 mice, which have been used in numerous studies involving development of the mammary gland. Different levels of biological complexity within the mammary gland (i.e., tissue organization and gene expression) were examined. We also examined the effects of perinatal BPA exposure on the response to [E.sub.2] at puberty in both strains.

Materials and Methods

Animals. CD-1 (Crl: CD-1; Charles River Charles River

River, eastern Massachusetts, U.S. The longest river wholly in the state, it flows into Boston Bay after a course of about 80 mi (130 km). Navigable for about 7 mi (11 km), its estuary separates the cities of Boston and Cambridge.
 Laboratories, Wilmington, MA) and C57Bl6 (C57BL/6J; Jackson Laboratories, Bar Harbor, Maine Bar Harbor, Maine, may refer to:
  • Bar Harbor (town), Maine
  • Bar Harbor (CDP), Maine, a census-designated place within the town of Bar Harbor
) mice were housed in the Tufts-New England Medical facility under temperature and light controlled (14-hr light and 10-hr dark) conditions. Food (Rodent Diet 2018; Harlan Teklad, Madison, WI), cages, and bedding tested negligible for estrogenicity by the E-SCREEN assay (Soto et al. 1992); water was supplied in glass bottles. All experimental procedures were approved by the Tufts University-New England Medical Center Animal Research Committee. All animals were treated humanely and with regard for alleviation of pain in accordance with the Guide for Care and Use of Laboratory Animals (Institute of Laboratory Animal Resources 1996).

To study the response to various doses of [E.sub.2], female mice (n = 5/dose for each strain) were ovariectomized on postnatal day (PND) 25 under isoflurane anesthesia, and Alzet osmotic osmotic,
adj pertaining to osmosis.

osmotic pressure,
n See pressure, osmotic.



osmotic

emanating from or pertaining to the pressure of osmosis.
 pumps (Alza Corp., Palo Alto Palo Alto, city, California
Palo Alto (păl`ō ăl`tō), city (1990 pop. 55,900), Santa Clara co., W Calif.; inc. 1894. Although primarily residential, Palo Alto has aerospace, electronics, and advanced research industries.
, CA) were implanted subcutaneously sub·cu·ta·ne·ous  
adj.
Located or placed just beneath the skin: subcutaneous tissue; a subcutaneous implant.



sub
 as previously described (Vandenberg et al. 2006). The pumps were filled with solutions delivering 0, 0.25, 0.5, 1, 2.5, 5, 10, or 50 [micro]g [E.sub.2]/kg bw/day (Steraloids Inc., Newport, RI) dissolved in 50% dimethylsulfoxide di·meth·yl·sulf·ox·ide
n.
DMSO.
 (DMSO DMSO dimethyl sulfoxide.

DMSO
n.
Dimethyl sulfoxide; a colorless hygroscopic liquid obtained from lignin, used as a penetrant to convey medications into the tissues.


DMSO,
n.
; vehicle control; Sigma-Aldrich, St. Louis, MO) for the length of treatment. The mice were killed on PND35, and their mammary glands and uteri were collected. For positive controls, we used the range of [E.sub.2] doses previously reported in a mouse mammary gland assay by Skarda (2002) and a mouse uterotrophic assay (Padilla-Banks et al. 2001) based on the wet weight of the uterus (a standard for estrogen exposure).

To study the effects of perinatal exposure to BPA on responses to [E.sub.2], male and female mice of each strain were paired. The morning on which a vaginal plug was observed was designated day 1 of pregnancy. On the evening of day 8 of pregnancy, dams were weighed and implanted subcutaneously with Alzet osmotic pumps releasing either vehicle (50% DMSO) or 250 ng BPA/kg bw/day (Sigma-Aldrich) dissolved in vehicle. For convenience, we refer to these groups as 0BPA and 250BPA, respectively. The pumps delivered BPA or vehicle until PND2. The offspring were culled to eight pups per dam on PND1. On PND25, three pups from each litter were ovariectomized, and pumps administering vehicle (50% DMSO) or 0.5 or 1 [micro]g [E.sub.2]/kg bw/day were implanted subcutaneously. These females were weighed and killed on PND35 (CD-1: n = 9-11/treatment group; C57Bl6: n = 6-7/treatment group).

Tissue collection. The fourth inguinal inguinal /in·gui·nal/ (in´gwi-n'l) pertaining to the groin.

in·gui·nal
adj.
1. Of or located in the groin.

2.
 mammary glands were dissected dis·sect·ed  
adj.
1. Botany Divided into many deep, narrow segments: dissected leaves.

2. Geology Cut by irregular valleys and hills.

Adj. 1.
 out; one mammary gland was immediately immersed im·merse  
tr.v. im·mersed, im·mers·ing, im·mers·es
1. To cover completely in a liquid; submerge.

2. To baptize by submerging in water.

3.
 in RNAlater (Ambion Inc., Austin, TX) and stored at -80[degrees]C for RNA RNA: see nucleic acid.
RNA
 in full ribonucleic acid

One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic
 isolation. The second mammary gland was whole mounted as described previously (Markey et al. 2001a). Uteri were dissected, blotted on filter paper, and weighed.

Morphometric analysis of mammary glands. Slides were coded and analysis was performed in a blind fashion. Mammary gland images were captured with a Zeiss dissection dissection /dis·sec·tion/ (di-sek´shun)
1. the act of dissecting.

2. a part or whole of an organism prepared by dissecting.
 scope and AxioCam digital camera (Carl Zeiss
For the company with the same name, see Zeiss.


Carl Zeiss (September 11, 1816 – December 3, 1888) was an optician commonly known for the company he founded, Zeiss.
 Inc., Germany). Morphometric analysis was performed as described previously (Vandenberg et al. 2006). The parameters examined include number and area of terminal end buds (TEBs), area subtended by the ductal tree, and ductal extension measured as the distance from the midpoint mid·point  
n.
1. Mathematics The point of a line segment or curvilinear arc that divides it into two parts of the same length.

2. A position midway between two extremes.
 of the lymph node lymph node

Small, rounded mass of lymphoid tissue contained in connective tissue. They occur all along lymphatic vessels, with clusters in certain areas (e.g., neck, groin, armpits).
 to the leading edge of the ductal tree. In cases where the leading edge of the ductal tree did not grow beyond the center of the lymph node, ductal extension was given a negative value.

RNA isolation and real-time quantitative RT-PCR RT-PCR

reverse transcriptase-polymerase chain reaction. See PCR1.
. Mammary gland RNA was isolated and quantitative real time reverse transcription-polymerase chain reaction (RT-PCR) was performed as described previously (Munoz de Toro et al. 2005). The primers used were Msx2, forward: ggaagaccagatggaccaga, and reverse: tctgtatcaagtggccctgtc; amphiregulin, forward: aaggaggcttcgacaagaaa, and reverse: atccgaaagctccacttcct; and ribosomal protein A ribosomal protein is any of the proteins that, in conjunction with rRNA, make up the ribosomal subunits involved in the cellular process of translation. A large part of the knowledge about these organic molecules has come from the study of E. coli ribosomes.  L19 (a housekeeping gene), forward: atcgccaatgccaactcc, and reverse: tcatccttctcatccaggtca.

Analysis of dose-response curves. For each parameter, the following were calculated: a) the lowest observable effect level (LOEL LOEL Lowest Observed Effect Level
LOEL Lowest Observable Effect Level (EPA) 
) dose (the lowest dose causing a statistically significant effect); b) the peak response [the dose(s) at which the response reaches a plateau or the highest response is achieved]; c) the half-maximal dose (the amount of [E.sub.2] inducing half the maximal response); and d) the fold change (the peak response divided by the response of the ovariectomized control).

Curve-fitting analysis was performed for each parameter to determine whether the response to estradiol best conformed to a sigmoidal sig·moid   also sig·moi·dal
adj.
1. Having the shape of the letter S.

2. Of or relating to the sigmoid colon.



[Greek s
 (monotonic monotonic - In domain theory, a function f : D -> C is monotonic (or monotone) if

for all x,y in D, x <= y => f(x) <= f(y).

("<=" is written in LaTeX as \sqsubseteq).
) curve, or to a polynomial polynomial, mathematical expression which is a finite sum, each term being a constant times a product of one or more variables raised to powers. With only one variable the general form of a polynomial is a0xn+a  (inverted-U-shaped) curve. To determine which responses could be considered statistically nonmonotonic, we assessed whether the peak response of a given parameter occurred at one of the intermediate doses and whether the peak response could be statistically distinguished from the response at the highest dose. When both criteria were met, the parameter of interest was defined as having a nonmonotonic response to [E.sub.2].

Statistical analysis. Statistical significance was determined using SPSS A statistical package from SPSS, Inc., Chicago (www.spss.com) that runs on PCs, most mainframes and minis and is used extensively in marketing research. It provides over 50 statistical processes, including regression analysis, correlation and analysis of variance.  software (SPSS, Chicago, IL). To determine statistical differences between the responses at each dose or the effects of BPA, we used nonparametric Mann-Whitney U-tests as well as parametric t-tests when data were normally distributed. To compare the responses of CD-1 and C57Bl6 mice, we used two-way analysis of variance (ANOVA anova

see analysis of variance.

ANOVA Analysis of variance, see there
). Post hoc post hoc  
adv. & adj.
In or of the form of an argument in which one event is asserted to be the cause of a later event simply by virtue of having happened earlier:
 tests (Bonferroni or planned t-tests) were used to make comparisons between groups. For all statistical tests, results were considered significant at p < 0.05. Values in figures are mean [+ or -] SE.

Results

Effect of [E.sub.2] on uterine weight. Uterine wet weight represents the classical end point for assessing estrogenicity. As expected, the uterus demonstrated a monotonic dose-response curve to [E.sub.2] in both mouse strains at the doses tested (Table 1, Figure 1A). We observed significant differences between strains at [E.sub.2] doses [greater than or equal to] 0.5 [micro]g/kg bw/day. However, because CD-1 females are significantly larger than their C57B16 counterparts (25.5 [+ or -] 0.2 g and 16.3 [+ or -] 0.2 g, respectively; p < 0.001), significant differences between strains were not apparent when uterine weight was normalized to body weight (not shown). When normalized to the ovariectomized controls, the fold change in uterine weight was also comparable in both strains (Figure 1E).

Morphometric parameters of the mammary gland: response to [E.sub.2]. In CD-1 females, [E.sub.2] treatment increased the number and area of TEBs (Table 1, Figure 1B) and increased ductal extension (Figure 1C). Each of these parameters revealed an inverted-U-shaped, nonmonotonic response (Table 1). Graphic representation of the ductal area also showed an obvious inverted-U-shaped response to [E.sub.2] (Figure 1D).

In C57Bl6 females, we found that the effect of [E.sub.2] on the number of TEBs, area of TEBs, ductal area, and ductal extension generated an inverted-U-shaped dose response (Figure 1, Table 1). For every parameter, the doses showing peak responses were similar to those obtained in CD-1 females (Table 1). The LOEL for the number and area of TEBs occurred at a lower dose than in CD-1 females. However, for ductal area and ductal extension, the LOEL was found at a higher dose.

When CD-1 and C57Bl6 responses were compared, we detected no significant differences at any [E.sub.2] dose for number or area of TEBs. However, significant differences were detected in parameters related to the overall growth of the epithelium (i.e., ductal extension and ductal area; Figure 1C-D). Because they were detected even in ovariectomized females (without [E.sub.2] treatment), these differences appeared to be largely due to the divergent body size of these two strains. In fact, when normalized to body weight, strain differences only remained for ductal area; disparities between strains disappeared for the other parameters (not shown). Finally, 2-way ANOVAs did not indicate a significant interaction variable between [E.sub.2] dose and mouse strain for any mammary gland parameter, indicating that the shape of the dose-response curves cannot be statistically distinguished for CD-1 and C57Bl6 strains.

The number of TEBs per ductal area (TEBs/area) and the area of all TEBs per ductal area (TEB TEB Test & Evaluation Board
TEB Third Eye Blind (band name)
TEB Thread Environment Block
TEB Turkiye Ekonomi Bankasi
TEB Triethylborane
TEB Technical Evaluation Board
TEB Traffic Engineering Bureau (Pakistan) 
 area/area) were calculated to determine the TEB density. We found significant differences between these strains at 1, 10, and 50 [micro]g [E.sub.2]/kg bw/day regarding both TEB density parameters (data not shown). At all three doses, the response observed in C57Bl6 females was more pronounced than that in CD-1 females. Because these parameters are ratios of the number or area of TEBs (no significant differences shown between strains) and ductal area (significant differences shown between strains, which correlate with animal size), the overall response to [E.sub.2] may be more striking in the C57Bl6 strain because of their smaller size and/or slower development.

To explore this concept further, we normalized the number and area of TEBs, ductal area, and ductal extension to ovariectomized controls. The mammary glands of ovariectomized C57Bl6 mice displayed almost complete developmental arrest, whereas those of their CD-1 counterparts maintained a few TEB structures. Accordingly, [E.sub.2] treatment increased the number of TEBs by 80-fold in C57Bl6 and only 10-fold in CD-1 mice (Figure 1F, Table 1), while the maximal TEB number was similar (Figure 1B). The increase in ductal extension was comparable in both strains (Figure 1G, Table 1), whereas the increase in ductal area was 1.4-fold in CD-1 and 3.3-fold in C57Bl6 mice (Figure 1H).

Mammary gland gene expression: response to [E.sub.2]. The expression of Msx2 and amphiregulin mRNAs, two estrogen-regulated genes (Mallepell et al. 2006; Phippard et al. 1996), increased monotonically with increasing doses of [E.sub.2] in both CD-1 and C57B16 mice (Figure 2 and Table 1).

Selection of doses for pubertal [E.sub.2] challenge. To investigate the effects of perinatal BPA exposure on the response to [E.sub.2] at puberty, we used the dose-response curves of the morphometric points described above to identify two doses higher than the LOEL but lower than the half-maximal response for each strain. The half-maximal doses ranged from 0.40 to 2.0 [micro]g [E.sub.2]/kg bw/day in CD-1 and 0.6 to 1.05 [micro]g [E.sub.2]/kg bw/day in C57Bl6 mice (Table 1). From these calculations, we chose to administer an [E.sub.2] challenge of 0, 0.5, or 1 [micro]g/kg bw/day.

Morphometric analysis of the mammary gland: response to BPA. In CD-1 females, the number of TEBs increased with higher doses of [E.sub.2], as expected from the dose-response data. However, after administration of 0.5 [micro]g [E.sub.2]/kg bw/day, the number of TEBs in 250BPA CD-1 mice increased significantly over that observed in 0BPA mice (Figure 3A). Other TEB parameters, such as the total area covered by TEBs (Table 2), TEBs/area (Table 2), and TEB area/ductal area (Figure 3B), were also significantly enhanced by this treatment. Additionally, the TEB area/area measured in the 250BPA group treated with 1 [micro]g [E.sub.2]/kg bw/day was significantly lower (p < 0.015) than that measured in the 0BPA treated with the same dose of [E.sub.2] (Figure 3B). When we measured ductal length, there was a significant increase in 250BPA challenged with 1 [micro]g [E.sub.2]/kg bw/day compared with 0BPA mice (Figure 3C). Additionally, increasing doses of [E.sub.2] administered to CD-1 mice induced overall growth of the ductal epithelium, measured as increased ductal area. However, perinatal exposure to BPA had no effect on this parameter (Table 2).

In C57Bl6 mice, the number of TEBs increased with higher doses of [E.sub.2], as expected from the dose-response data. In 250BPA females, the mean number of TEBs induced by 0.5 [micro]g [E.sub.2]/kg bw/day was increased compared with 0BPA animals (Figure 3D), similar to the response seen in the CD-1 strain; however, these differences were not statistically significant, likely due to variability in the data. Additionally, treatment with 1 [micro]g [E.sub.2]/kg bw/day induced significantly fewer TEBs in 250BPA compared with 0BPA females (Figure 3D). The total TEB area induced by administration of 1 [micro]g [E.sub.2]/kg bw/day was lower in the 250BPA mice compared with 0BPA animals (Table 2), although this decrease was not statistically significant. As in CD-1 mice, TEB parameters such as TEBs/area (Table 2) and TEB area/area (Figure 3E) were significantly lower in the 250BPA mice treated with 1 [micro]g [E.sub.2]/kg bw/day compared with 0BPA in C57Bl6 mice.

Parameters associated with overall ductal growth (ductal area and extension) were also measured in the C57Bl6 mammary gland. As expected, higher doses of [E.sub.2] induced larger areas (Table 2) and greater ductal extensions (Figure 3F) than in ovariectomized controls. As observed in CD-1 mice, perinatal exposure to BPA did not alter ductal area; BPA also did not alter ductal extension in C57Bl6, contrasting with growth patterns observed in CD-1 mice.

Uterine weight: response to BPA. As expected, treatment with increasing doses of [E.sub.2] resulted in increased uterine wet weight. In both strains, perinatal treatment with 250 ng BPA/kg bw/day did not alter this parameter (Table 2).

Discussion

In the present study we examined two important issues regarding estrogen action--strain sensitivity and dose-response curve shape--always in the context of the effects of perinatal BPA exposure. Previously, we reported that perinatal exposure to environmentally relevant levels of BPA results in altered postnatal development of the mammary gland (Markey et al. 2001a, 2003a; Munoz de Toro et al. 2005). One of the most striking observations was that the sensitivity of the mammary gland to [E.sub.2] increased in perinatally BPA-exposed CD-1 females that were ovariectomized before puberty (Munoz de Toro et al. 2005). The present study revealed that both outbred CD-1 and inbred C57Bl6 strains respond quite similarly to [E.sub.2] and BPA in many parameters. The C57Bl6 strain is of particular interest because it is widely used to study mammary gland development and in the generation of genetically modified genetically modified
Adjective

(of an organism) having DNA which has been altered for the purpose of improvement or correction of defects

genetically modified genetic adj [food etc] →
 mice.

There are concerns regarding the use of laboratory strains selected for large litter size (i.e., CD-1 mice) stemming from the possible correlation with resistance to endocrine disruptors including xenoestrogens. It has been suggested that testing chemicals in these strains may underestimate the endocrine disruptor potential of the agent being examined (Spearow et al. 1999). Specifically, CD-1 males were shown to be [E.sub.2]-resistant when compared with C57Bl6 mice regarding effects on testes testes
 or testicles

Male reproductive organs (see reproductive system). Humans have two oval-shaped testes 1.5–2 in. (4–5 cm) long that produce sperm and androgens (mainly testosterone), contained in a sac (scrotum) behind the penis.
 weight and spermatogenesis (Spearow et al. 1999). Strain susceptibility was also observed in rats, often specific to the chemical being studied. For example, Sprague-Dawley rats were resistant to BPA compared with the Fischer 344 rats regarding proliferation of vaginal epithelium. However, both strains responded equally to [E.sub.2]. Thus, the differences between Sprague-Dawley and Fischer 344 rats suggest that there may be strain-specific differences that affect the metabolism of a particular estrogenic chemical or class of chemicals (Long et al. 2000).

The shape of the dose-response curve should also be considered when assessing strain sensitivity. When a given parameter exhibits a monotonic dose-response curve, all effective doses should result in a qualitatively similar effect. To the contrary, if the dose-response curve is nonmonotonic or has an inverted-U shape, opposite effects might be observed at different doses. It has been proposed that nonmonotonic dose-response curves are generated by the integration of two or more monotonic dose-response curves that are occurring through different pathways and affecting a common end point with opposing effects (Conolly and Lutz 2004). For those end points, one cannot test a single high dose of a given chemical to assess whether or not it produces a biological effect (vom Saal and Hughes 2005; Welshons et al. 2003). In the present study, morphometric parameters of the mammary glands of both CD-1 and C57Bl6 mice displayed inverted-U-shaped dose-response curves to [E.sub.2]. Although most parameters in CD-1 mice met the criteria for statistical nonmonotonicity, variability in responses prevented the C57Bl6 from meeting this standard. One striking difference between these strains was the state of quiescence quiescence (kwēes´ens),
n a state of inactivity, quietness, or dormancy. In cell biology, it refers to that period when a cell is not dividing. E.g.
 of the mammary gland of C57Bl6 ovariectomized mice compared with their CD-1 counterparts. There were practically no TEBs in the former, whereas a few TEBs were present in the CD-1 females 10 days after ovariectomy ovariectomy /ovar·i·ec·to·my/ (o-var?e-ek´tah-me) oophorectomy.

o·var·i·ec·to·my
n.
The surgical removal of one ovary or both ovaries. Also called oophorectomy.
. It is possible that these results are indicative of different rates of development or onset of puberty in females of these two strains. Although there is no evidence in the literature to support this conclusion, no studies have examined age of puberty in these two strains under the same conditions (food supplied, light cycle, temperature, etc.) In the present study, females were ovariectomized before puberty, and thus this information could not be collected.

In contrast to the morphometric parameters, the induction of estrogen-target genes in the mammary gland was monotonic in both strains. The magnitude of the response was comparable in the two strains, and the sensitivities of these responses were lower than those of several morphological end points.

[E.sub.2] sensitivity of the uterus. Diel et al. (2004) found that the uterus and vagina of several rat strains responded similarly to three different doses of estrogen in a 3-day assay (Diel et al. 2004). In the present study, we arrived at a similar conclusion using a set of seven different [E.sub.2] doses and a 10-day assay in mice. Both mouse strains displayed a monotonic dose-response curve regarding uterine weight at the doses tested, and their response was comparable when uterine weight was normalized to body weight. Similar dose-response curves were reported in a 3-day (Padilla-Banks et al. 2001) and a 10-day mouse assay (Skarda 2002).

Overall, this study revealed little or no difference in the sensitivity to [E.sub.2] between CD-1 and C57Bl6 mice regarding the uterotrophic response and a variety of morphometric and gene-expression end points in the mammary gland. This is in contrast to the marked differences observed between these strains in testis testis (tĕs`tĭs) or testicle (tĕs`tĭkəl), one of a pair of glands that produce the male reproductive cells, or sperm.  end points (Spearow et al. 1999). The mechanisms underlying the latter differences have yet to be determined. However, steroid metabolism by the liver is subject to hormonal imprinting Hormonal imprinting (HI) is a phenomenon which takes place at the first encounter between a hormone and its developing receptor in the critical periods of life (in unicellulars during the whole life) and determines the later signal transduction capacity of the cell.  (Gustafsson et al. 1977), which may explain differences in response between males and females of the same strain.

Effect of perinatal exposure to BPA on the pubertal response to [E.sub.2]. Perinatal BPA exposure did not alter the uterine response to [E.sub.2] administered from PND25 to PND35 in either mouse strain. In contrast, the response of the mammary gland to [E.sub.2] was significantly altered by perinatal BPA exposure. A pattern emerged for TEB-related parameters, which increased in response to 0.5 [micro]g [E.sub.2]/kg bw/day relative to controls, suggesting a shift to the left of the dose-response curve. Increased responses at 0.5 [micro]g [E.sub.2]/kg bw/day were significant in CD-1 mice but did not reach significance in C57Bl6. The increase in number of TEBs induced by 1 [micro]g [E.sub.2]/kg bw/day was significantly reduced in the BPA-pretreated C57Bl6 mice. These results suggest a difference between the two strains in the level of the response to [E.sub.2] after perinatal BPA exposure, such that increased sensitivity to [E.sub.2] was manifested at a lower dose in CD-1 than in C57Bl6 mice. Alternatively, the sensitivity of the two strains may be similar, but the higher variability in the C57Bl6 TEB-related parameters may have precluded reaching statistical significance for end points that were significantly altered in the CD-1 strain. However, in both strains perinatal exposure to BPA significantly altered the response to [E.sub.2] later in life.

Estrogen exposure represents a main risk factor for breast carcinogenesis car·ci·no·gen·e·sis
n.
The production of cancer.



carcinogenesis

production of cancer.


biological carcinogenesis
viruses and some parasites are capable of initiating neoplasia.
. Increased sensitivity to [E.sub.2] may have similar effects. Consistent with this concept, previous studies of CD-1 mice exposed perinatally to BPA revealed an increased number of TEBs at puberty and terminal ends in adulthood (Markey et al. 2001a; Munoz de Toro et al. 2005). These two structures are thought to be the sites where neoplasias arise. Also, there is an overexpression of progesterone receptors in BPA-exposed animals, which in turn induces excessive lateral branching of the mammary gland ducts (Munoz de Toro et al. 2005), resulting in an increased ductal density of the gland. In humans, increased mammographic density is also a risk factor for breast cancer (McCormack and dos Santos Silva 2006). In the present study we extend these findings to C57Bl6 mice, suggesting that the enhanced sensitivity to [E.sub.2] resulting from perinatal BPA exposure may represent a general phenomenon in mice rather than a strain idiosyncrasy idiosyncrasy /id·io·syn·cra·sy/ (-sing´krah-se)
1. a habit peculiar to an individual.

2. an abnormal susceptibility to an agent (e.g., a drug) peculiar to an individual.
.

Nonmonotonic dose-response curves. In vitro in vitro /in vi·tro/ (in ve´tro) [L.] within a glass; observable in a test tube; in an artificial environment.

in vi·tro
adj.
In an artificial environment outside a living organism.
 studies that used human breast epithelial cells Epithelial cells
Cells that form a thin surface coating on the outside of a body structure.

Mentioned in: Corneal Transplantation
 and other estrogen-target cell lines showed nonmonotonic dose-response curves in response to increasing [E.sub.2] doses (Amara and Dannies 1983; Soto and Sonnenschein 1985). This type of curve suggests that estrogens can evoke different effects, such as induction (Soto and Sonnenschein 1987) or inhibition of cell proliferation (Szelei et al. 2000), depending on the dose tested. The combined effect of these variable responses is reflected in the overall cell number (Soto and Sonnenschein 2001). In the mammary gland, estrogens promote proliferation--manifested as ductal growth (Nandi 1958)--and induce apoptosis--manifested as lumen formation (Munoz de Toro et al. 2005).

Conclusions

Nonmonotonic dose-response curves are observed in cultured cells and in animal models, and are oftentimes observed for endocrine end points. These patterns highlight the unreliability of assuming that the effect of exposure to low doses of a hormone, endocrine disruptor, or other toxicant toxicant /tox·i·cant/ (tok´si-kant)
1. poisonous.

2. poison.


tox·i·cant
n.
1. A poison or poisonous agent.

2. An intoxicant.

adj.
 can be extrapolated from the response to high doses of the compound (Conolly and Lutz 2004; vom Saal and Hughes 2005).

Contrary to the clear differences in the testicular testicular /tes·tic·u·lar/ (tes-tik´u-lar) pertaining to a testis.

tes·tic·u·lar
adj.
Of or relating to a testicle or testis.



testicular

pertaining to the testis.
 response to postnatal administration of [E.sub.2] between CD-1 and C57Bl6 mice (Spearow et al. 1999), the differences observed in the uterus and mammary gland of these different mouse strains are subtle. In addition, the mammary glands of both strains are sensitive to perinatal exposure to low doses of BPA, in that the postnatal response to [E.sub.2] is significantly modified. This observation suggests that both strains provide adequate models for the study of perinatal exposure to xenoestrogens. Even though the outbred CD-1 strain has been selected for large litter size and reproductive efficiency, these results show that this strain provides an excellent model for the study of estrogen action in the uterus and mammary gland. Additionally, mice of the C57Bl6 strain may be used advantageously in the study of endocrine disruption when an inbred strain Linear animals or inbred strains are animals of a particular species which are nearly identical to each other in genotype due to long inbreeding. Mating of brother-sister pairs for 20 generations will result in lines that are roughly 98% genetically identical, usually  is required. Confirmation of the suitability of the C57Bl6 strain for this work is important because many genetically modified animals have been developed on this background.

REFERENCES

Alworth LC, Howdeshell KL, Ruhlen RL, Day JK, Lubahn DB, Huang TH-M, et al. 2002. Uterine responsiveness to estradiol and DNA methylation DNA methylation  

The modification of a strand of DNA after it is replicated, in which a methyl (CH3) group is added to any cytosine molecule that stands directly before a guanine molecule in the same chain.
 are altered by fetal exposure to diethylstilbestrol diethylstilbestrol: see DES.  and methoxychlor in CD-1 mice: effects of low versus high doses. Toxicol Appl Pharmacol 183:10-22.

Amara JF, Dannies PS. 1983. 17 [beta]-Estradiol has a biphasic bi·pha·sic  
adj.
Having two distinct phases: a biphasic waveform; a biphasic response to a stimulus. 
 effect on GH cell growth. Endocrinology 112:1141-1143.

Arakawa C, Fujimaki K, Yoshinaga J, Imai H, Serizawa S, Shiraishi H. 2004. Daily urinary excretion of bisphenol A. Environ Health Prev Med 9:22-26.

Biles JE, McNeal TP, Begley TH, Hollifield HC. 1997. Determination of bisphenol-A in reusable polycarbonate food-contact plastics and migration to food simulating liquids. J Agric Food Chem 45:3541-3544.

Brotons JA, Olea-Serrano MF, Villalobos M, Olea N. 1994. Xenoestrogens released from lacquer lacquer, solution of film-forming materials, natural or synthetic, usually applied as an ornamental or protective coating. Quick-drying synthetic lacquers are used to coat automobiles, furniture, textiles, paper, and metalware.  coating in food cans. Environ Health Perspect 103:608-612.

Calafat AM, Kuklenyik Z, Reidy JA, Caudill SP, Ekong J, Needham LL. 2005. Urinary concentrations of bisphenol A and 4-nonylphenol in a human reference population. Environ Health Perspect 113:391-395.

Conolly RB, Lutz WK. 2004. Nonmonotonic dose-response relationships: mechanistic mech·a·nis·tic
adj.
1. Mechanically determined.

2. Of or relating to the philosophy of mechanism, especially one that tends to explain phenomena only by reference to physical or biological causes.
 basis, kinetic modeling, and implications for risk assessment. Toxicol Sci 77:151-157.

Davis DL, Bradlow HL, Wolff M, Woodruff T, Hoel DG, Anton-Culver H. 1993. Medical hypothesis: xenoestrogens as preventable causes of breast cancer. Environ Health Perspect 101:372-377.

Diel P, Schmidt S, Vollmer G, Janning P, Upmeier A, Michna H, et al. 2004. Comparative responses of three rat strains (DA/Han, Sprague-Dawley and Wistar) to treatment with environmental estrogens. Arch Toxicol 78:183-193.

Endocrine Disruptor Screening and Testing Advisory Committee. 1998. Endocrine Disruptor Screening and Testing Advisory Committee Final Report. 2006. Available: http://www.epa.gov/scipoly/oscpendo/edspoverview/finalrpt.htm [accessed 28 November 2006].

Gustafsson JA, Eneroth P, Pousette A, Skett P, Sonnenschein C, Stenberg A, et al. 1977. Programming and differentiation of rat liver enzymes. J Steroid Biochem 8:429-443.

Ikezuki Y, Tsutsumi O, Takai Y, Kamei Y, Taketani Y. 2002. Determination of bisphenol A concentrations in human biological fluids reveals significant early prenatal exposure. Hum Reprod 17:2839-2841.

Institute of Laboratory Animal Resources. 1996. Guide to Care and Use of Laboratory Animals. Washington, DC:National Academy Press.

Long X, Steinmetz R, Ben-Jonathan N, Caperell-Grant A, Young PC, Nephew KP, et al. 2000. Strain differences in vaginal responses to the xenoestrogen bisphenol A. Environ Health Perspect 108:243-247.

Mallepell S, Krust A, Chambon P, Brisken C. 2006. Paracrine paracrine /para·crine/ (par´ah-krin)
1. denoting a type of hormone function in which hormone synthesized in and released from endocrine cells binds to its receptor in nearby cells and affects their function.

2.
 signaling through the epithelial epithelial /ep·i·the·li·al/ (-the´le-al) pertaining to or composed of epithelium.
epithelial (ep´ithē´lē
 estrogen receptor [alpha] is required for proliferation and morphogenesis morphogenesis /mor·pho·gen·e·sis/ (mor?fo-jen´e-sis) the evolution and development of form, as the development of the shape of a particular organ or part of the body, or the development undergone by individuals who attain the type to  in the mammary gland. Proc Natl Acad Sci USA 103:2196-2201.

Markey CM, Coombs Coombs can refer to:
  • Coombs test, a test for the presence of antibodies or antigens
  • Coombs reagent, the reagent used in the Coombs test
  • Coombs' method, a type of voting designed by the psychologist Clyde Coombs
 MA, Sonnenschein C, Soto AM. 2003a. Mammalian development in a changing environment: exposure to endocrine disruptors reveals the developmental plasticity of steroid-hormone target organs. Evol Dev 5:1-9.

Markey CM, Luque EH, Munoz de Toro MM, Sonnenschein C, Soto AM. 2001a. In utero in utero (in u´ter-o) [L.] within the uterus.

in u·ter·o
adj.
In the uterus.



in utero adv.
 exposure to bisphenol A alters the development and tissue organization of the mouse mammary gland. Biol Reprod 65:1215-1223.

Markey CM, Michaelson CL, Sonnenschein C, Soto AM. 2001b. Alkylphenols and bisphenol A as environmental estrogens. In: The Handbook of Environmental Chemistry Vol 3. Part L, Endocrine Disruptors--Part I (Metzler M, ed). Berlin/Heidelberg:Springer-Verlag, 129-153.

Markey CM, Rubin BS, Soto AM, Sonnenschein C. 2003b. Endocrine disruptors from Wingspread to environmental developmental biology Developmental biology

A large field of investigation that includes the study of all changes associated with an organism as it progresses through the life cycle. The life cycles of all multicellular organisms exhibit many similarities.
. J Steroid Biochem Molec Biol 83:235-244.

McCormack VA, dos Santos Silva I. 2006. Breast density and parenchymal pa·ren·chy·ma  
n.
1. Anatomy The tissue characteristic of an organ, as distinguished from associated connective or supporting tissues.

2.
 patterns as markers of breast cancer risk: a meta-analysis. Cancer Epidemiol Biomarkers 15:1159-1169.

Munoz de Toro MM, Markey CM, Wadia PR, Luque EH, Rubin BS, Sonnenschein C, et al. 2005. Perinatal exposure to bisphenol A alters peripubertal mammary gland development in mice. Endocrinology 146:4138-4147.

Nandi S. 1958. Endocrine control of mammary gland development and function in the C3H/He Crgl mouse. J Natl Cancer Inst 21:1039-1063.

NTP. 2001. National Toxicology toxicology, study of poisons, or toxins, from the standpoint of detection, isolation, identification, and determination of their effects on the human body. Toxicology may be considered the branch of pharmacology devoted to the study of the poisonous effects of drugs.  Program's Report of the Endocrine Disruptors Low-Dose Peer Review. Research Triangle Park Research Triangle Park, research, business, medical, and educational complex situated in central North Carolina. It has an area of 6,900 acres (2,795 hectares) and is 8 × 2 mi (13 × 3 km) in size. Named for the triangle formed by Duke Univ. , NC:National Toxicology Program. Available: http://ntp.niehs.nih.gov/ntp/htdocs/liason/LowDosePeerFinalRpt.pdf [accessed 5 March 2006].

Olea N, Pulgar R, Perez P, Olea-Serrano F, Rivas A, Novillo-Fertrell A, et al. 1996. Estrogenicity of resin-based composites and sealants used in dentistry dentistry, treatment and care of the teeth and associated oral structures. Dentistry is mainly concerned with tooth decay, disease of the supporting structures, such as the gums, and faulty positioning of the teeth. . Environ Health Perspect 104:298-305.

Padilla-Banks E, Jefferson WN, Newbold RR. 2001. The immature mouse is a suitable model for detection of estrogenicity in the uterotropic bioassay. Environ Health Perspect 109:821-826.

Phippard DJ, Weber-Hall SJ, Sharpe PT, Naylor MS, Jayatalake H, Maas R, et al. 1996. Regulation of Msx-1, Msx-2, Bmp-2 and Bmp-4 during foetal foe·tal  
adj. Chiefly British
Variant of fetal.

Adj. 1. foetal - of or relating to a fetus; "fetal development"
fetal
 and postnatal mammary gland development. Development 122:2729-2737.

Rubin BS, Murray MK, Damassa DA, King JC, Soto AM. 2001. Perinatal exposure to low doses of bisphenol A affects body weight, patterns of estrous es·trous
adj.
Relating to or being in estrus.



estrous

pertaining to or emanating from estrus.


estrous cycle
 cyclicity, and plasma LH levels. Environ Health Perspect 109:675-680.

Schonfelder G, Wittfoht W, Hopp H, Talsness CE, Paul M, Chahoud I. 2002. Parent bisphenol A accumulation in the human maternal-fetal-placental unit. Environ Health Perspect 110:A703-A707.

Sharpe RM, Skakkebaek NE. 1993. Are oestrogens involved in falling sperm count sperm count Urology A measure of the concentration of sperm in semen Normal ±100 million/mL. See Post-vasectomy sperm count, Semen analysis.  and disorders of the male reproductive tract? Lancet 341:1392-1395.

Skakkebaek NE, Meyts ER, Jorgensen N, Carlsen E, Petersen PM, Giwercman A, et al. 1998. Germ cell germ cell
n.
An ovum or a sperm cell or one of their developmental precursors. Also called sex cell.


Germ cell
One of the cells that ordinarily develop into eggs or sperm (also sperm and eggs).
 cancer and disorders of spermatogenesis: an environmental connection? APMIS APMIS Acta Pathologica, Microbiologica et Immunologica Scandinavica
APMIS Automated Project Management Information System
APMIS Automated Project Management System
 106:3-12.

Skarda J. 2002. Sensitivity and specificity of bioassay of estrogenicity on mammary gland and uterus of female mice. Physiol Res 51:407-412.

Soto AM, Lin T-M T-M Time & Materials , Justicia H, Silvia RM, Sonnenschein C. 1992. An "in culture" bioassay to assess the estrogenicity of xenobiotics. In: Chemically-Induced Alterations in Sexual Development: The Wildlife/human Connection (Colborn T, Clement C, eds). Princeton, NJ:Princeton Scientific Publishing, 295-309.

Soto AM, Sonnenschein C. 1985. The role of estrogens on the proliferation of human breast tumor cells (MCF-7). J Steroid Biochem 23:87-94.

Soto AM, Sonnenschein C. 1987. Cell proliferation of estrogen-sensitive cells: the case for negative control. Endocr Rev 8:44-52.

Soto AM, Sonnenschein C. 2001. The two faces of Janus: sex steroids as mediators of both cell proliferation and cell death. J Natl Cancer Inst 93:1673-1675.

Spearow JL, Doemeny P, Sara R, Leffler R, Barkley M. 1999. Genetic variation in susceptibility to endocrine disruption by estrogen in mice. Science 285:1259-1261.

Szelei J, Soto AM, Geck P, Desronvil M, Prechtl NV, Weill BC, et al. 2000. Identification of human estrogen-inducible transcripts that potentially mediate the apoptotic response in breast cancer. J Steroid Biochem Mol Biol 72:89-102.

Takeuchi T, Tsutsumi O. 2002. Serum bisphenol A concentrations showed gender differences, possibly linked to androgen androgen (ăn`drəjən): see testosterone.
androgen

Any of a group of hormones that mainly influence the development of the male reproductive system.
 levels. Biochem Biophys Res Commun 291:76-78.

Vandenberg LN, Wadia PR, Schaeberle CM, Rubin BS, Sonnenschein C, Soto AM. 2006. The mammary gland response to estradiol: monotonic at the cellular level, nonmonotonic at the tissue-level of organization? J Steroid Biochem Mol Biol 101:263-274.

vom Saal FS, Hughes C. 2005. An extensive new literature concerning low-dose effects of bisphenol A shows the need for a new risk assessment. Environ Health Perspect 113:926-933.

vom Saal FS, Timms BG, Montano MM, Palanza P, Thayer KA, Nagel SC, et al. 1997. Prostate enlargement in mice due to fetal exposure to low doses of estradiol or diethylstilbestrol and opposite effects at high doses. Proc Natl Acad Sci USA 94:2056-2061.

Welshons WV, Thayer KA, Judy BM, Taylor JA, Curran EM, vom Saal FS. 2003. Large effects from small exposures. I. Mechanisms for endocrine-disrupting chemicals with estrogenic activity. Environ Health Perspect 111:994-1006.

Perinaaz R. Wadia, Laura N. Vandenberg, Cheryl M. Schaeberle, Beverly S. Rubin, Carlos Sonnenschein, and Ana M. Soto

Department of Anatomy and Cellular Biology cellular biology
n.
The study of the molecular or chemical interactions of biological phenomena.
, Tufts University School of Medicine The Tufts University School of Medicine is one of the eight schools that comprise Tufts University. Located on the university's health sciences campus in the Chinatown district of Boston, Massachusetts, the medical school has clinical affiliations with thousands of doctors and , Boston, Massachusetts “Boston” redirects here. For other uses, see Boston (disambiguation).
Boston is the capital and most populous city of Massachusetts.[3] The largest city in New England, Boston is considered the unofficial economic and cultural center of the entire New
, USA

Address correspondence to A.M. Soto, Department of Anatomy and Cellular Biology, Tufts University School of Medicine, 136 Harrison Ave., Boston, MA 02111 USA. Telephone: (617) 636-6954. Fax: (617) 636 3971. E-mail: ana.soto@tufts.edu

We thank M. Maffini for her insightful reading of this manuscript, D. Damassa for assistance with the statistical analysis, and C. Brisken for suggesting the use of amphiregulin in the gene expression studies.

This work was supported by grant ES08314 from the National Institute of Environmental Health Sciences The National Institute of Environmental Health Sciences (NIEHS) is one of 27 Institutes and Centers of the National Institutes of Health (NIH),which is a component of the Department of Health and Human Services (DHHS). The Director of the NIEHS is Dr. David A. Schwartz. .

The authors declare they have no competing financial interests.

Received 22 August 2006; accepted 17 January 2007.
Table 1. Dose-response curves for uterine wet weight and mammary gland
morphological parameters in both mouse strains.

                         CD-1 Mice
                               Half-max  Dose of     Fold
Parameter                LOEL  dose      max effect  change  Curve shape

Ductal extension         0.5   0.42       2.5-10      3.2    Inverted-U
No. of TEBs              2.5   1.8        5           9.8    Inverted-U
TEB area                 2.5   1.6        5          11.6    Inverted-U
Ductal area              0.5   0.4        1-50        1.4    Inverted-U
No. of TEBs/ductal area  2.5   2          5-10        7.0    -- (a)
TEB area/ductal area     2.5   1.6        2.5-10      8.6    -- (a)
Uterine weight           0.25  4.25      10-50        4.7    Monotonic
Uterine weight/bw        0.25  4.1       10-50        7.8    Monotonic
Msx2                     2.5   2.5        5-50        4.7    Monotonic
Amphiregulin             1     3.6        5-50       64.8    Monotonic

                         C57Bl6 mice
                               Half-max  Dose of     Fold
Parameter                LOEL  dose      max effect  change  Curve shape

Ductal extension         2.5   0.6       1-50        -3.34   Inverted-U
No. of TEBs              0.5   1.05      2.5-50      80.25   Inverted-U
TEB area                 1     1         2.5-50      97.44   Inverted-U
Ductal area              2.5   0.78      1-50         3.3    Inverted-U
No. of TEBs/ductal area  0.5   0.85      5-50        62.25   -- (a)
TEB area/ductal area     0.5   0.8       5-50        75.96   -- (a)
Uterine weight           1.0   3.55      5-50         5.95   Monotonic
Uterine weight/bw        1.0   3.4       5-50         6.09   Monotonic
Msx2                     0.5   1.5       5-50        10.6    Monotonic
Amphiregulin             2.5   4         5-50        81.81   Monotonic

max, maximal. The LOEL, half-maximal dose, dose of maximal effect, fold
change, and curve shape were calculated.
(a) The curve shape for these parameters is "derived" data, from a
quotient between two direct measurements, each one of them being
affected by [E.sub.2]; therefore, the shape of the derived curve is
irrelevant.

Table 2. Mammary gland morphological parameters of CD-1 and C57Bl6 mice
exposed perinatally to BPA (0BPA and 250BPA) and postnatally to 0, 0.5,
or 1 [micro]g [E.sub.2]/kg bw/day.

                        [E.sub.2] ([micro]g/kg bw/day), BPA
Treatment               0, 0BPA                      0, 250BPA

CD-1 mice
  Ductal extension       2.62 [+ or -] 0.63 (a)       2.80 [+ or -]
                                                      0.76 (a)
  # TEBs                 1.4 [+ or -] 0.58 (a)        2.1 [+ or -]
                                                      0.78 (a)
  TEB area               0.048 [+ or -] 0.020 (a)     0.078 [+ or -]
                                                      0.029 (a)
  Ductal area           79.1 [+ or -] 8.7 (a)        82.26 [+ or -]
                                                      7.0 (a)
  # TEBs/ductal area     0.015 [+ or -] 0.006 (a)     0.023 [+ or -]
                                                      0.008 (a)
  TEB area/ductal area   0.0005 [+ or -] 0.0002 (a)   0.0009 [+ or -]
                                                      0.0003 (a)
  Uterine weight        15.32 [+ or -] 1.58 (a)      14.97 [+ or -]
                                                      0.73 (a)
C57Bl6 mice
  Ductal extension      -3.00 [+ or -] 0.34 (a)      -2.39 [+ or -]
                                                      0.93 (a)
  # TEBs                 0.0 [+ or -] 0.0 (a)         0.0 [+ or -]
                                                      0.0 (a)
  TEB area               0.00 [+ or -] 0.00 (a)       0.00 [+ or -]
                                                      0.00 (a)
  Ductal area            6.40 [+ or -] 0.80 (a)      10.10 [+ or -]
                                                      2.64 (a)
  # TEBs/ductal area     0.00 [+ or -] 0.00 (a)       0.00 [+ or -]
                                                      0.00 (a)
  TEB area/ductal area   0.00 [+ or -] 0.00 (a)       0.00 [+ or -]
                                                      0.00 (a)
  Uterine weight         5.1 [+ or -] 0.26 (a)        8.05 [+ or -]
                                                      2.6 (a,b)

                        [E.sub.2] ([micro]g/kg bw/day), BPA
Treatment               0.5, 0BPA                     0.5, 250BPA

CD-1 mice
  Ductal extension        4.41 [+ or -] 0.74 (a,b)      4.69 [+ or -]
                                                        0.58 (a,b)
  # TEBs                  5.5 [+ or -] 1.2 (b)         10.0 [+ or -]
                                                        0.65 (c)
  TEB area                0.219 [+ or -] 0.054 (b)      0.428 [+ or -]
                                                        0.040 (d)
  Ductal area           126.1 [+ or -] 9.2 (b)        118.6 [+ or -]
                                                        8.2 (b)
  # TEBs/ductal area      0.042 [+ or -] 0.009 (a)      0.085 [+ or -]
                                                        0.006 (b)
  TEB area/ductal area    0.0017 [+ or -] 0.0004 (a)    0.0036 [+ or -]
                                                        0.0003 (b,c)
  Uterine weight         20.59 [+ or -] 1.02 (b)       19.46 [+ or -]
                                                        0.91 (b)
C57Bl6 mice
  Ductal extension        0.99 [+ or -] 0.34 (b)        1.68 [+ or -]
                                                        0.59 (b)
  # TEBs                  3.1 [+ or -] 0.6 (b)          7.7 [+ or -]
                                                        4.0 (a,b,c)
  TEB area               14.57 [+ or -] 2.72 (a)       36.83 [+ or -]
                                                       16.21 (a)
  Ductal area            29.13 [+ or -] 1.33 (b)       36.03 [+ or -]
                                                        4.49 (b,c)
  # TEBs/ductal area      0.11 [+ or -] 0.019 (b)       0.18 [+ or -]
                                                        0.072 (a,b,c)
  TEB area/ductal area    0.44 [+ or -] 0.080 (b)       0.91 [+ or -]
                                                        0.31 (a,b,c)
  Uterine weight          9.31 [+ or -] 0.71 (b)       11.00 [+ or -]
                                                        1.58 (b,c)

                        [E.sub.2] ([micro]g/kg bw/day), BPA
Treatment               1, 0BPA                       1, 250BPA

CD-1 mice
  Ductal extension        4.54 [+ or -] 0.53 (a)        6.00 [+ or -]
                                                        0.46 (b)
  # TEBs                 11.9 [+ or -] 1.3 (c)         10.1 [+ or -]
                                                        0.50 (c)
  TEB area                0.546 [+ or -] 0.049 (c)      0.440 [+ or -]
                                                        0.034 (c,d)
  Ductal area           124.58 [+ or -] 8.65 (b)      139.8 [+ or -]
                                                        6.8 (b)
  # TEBs/ductal area      0.096 [+ or -] 0.009 (b)      0.075 [+ or -]
                                                        0.005 (b)
  TEB area/ductal area    0.0045 [+ or -] 0.0004 (b)    0.0032 [+ or -]
                                                        0.0002 (c)
  Uterine weight         25.47 [+ or -] 1.46 (b,c)     28.32 [+ or -]
                                                        1.33 (c)
C57Bl6 mice
  Ductal extension        2.13 [+ or -] 0.25 (b)        2.05 [+ or -]
                                                        0.36 (b)
  # TEBs                 10.1 [+ or -] 1.1 (c)          6.0 [+ or -]
                                                        0.8 (a,b)
  TEB area               54.14 [+ or -] 8.23 (b)       30.50 [+ or -]
                                                        5.98 (a,b)
  Ductal area            40.58 [+ or -] 3.41 (c)       44.69 [+ or -]
                                                        2.06 (c)
  # TEBs/ductal area      0.25 [+ or -] 0.018 (c)       0.13 [+ or -]
                                                        0.015 (a,b)
  TEB area/ductal area    1.34 [+ or -] 0.16 (c)        0.67 [+ or -]
                                                        0.12 (a,b)
  Uterine weight         12.20 [+ or -] 0.76 (c)       13.0 [+ or -]
                                                        1.53 (c)

Letters that are not in common indicate significant differences (p <
0.05).
COPYRIGHT 2007 National Institute of Environmental Health Sciences
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2007, Gale Group. All rights reserved.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Research
Author:Wadia, Perinaaz R.; Vandenberg, Laura N.; Schaeberle, Cheryl M.; Rubin, Beverly S.; Sonnenschein, Ca
Publication:Environmental Health Perspectives
Date:Apr 1, 2007
Words:7163
Previous Article:Pulmonary biomarkers based on alterations in protein expression after exposure to arsenic.(Research)
Next Article:Genetic polymorphisms influencing arsenic metabolism: evidence from Argentina.(Research)



Related Articles
Town hall session takes up BLM forest plan.(Environment)(Officials discuss the pros and cons of increased logging on public land)
Hormesis and its place in nonmonotonic dose-response relationships: some scientific reality checks.(Review)
Mammary gland development as a sensitive end point after acute prenatal exposure to an atrazine metabolite mixture in female Long-Evans...
In utero exposure to environmental tobacco smoke potentiates adult responses to allergen in BALB/c mice.(Research)
Children's health centers: Past, Present, and Future.(NIEHS News)
Ragweed subpollen particles reach deep into lungs.(Allergies)
Exploring Developmental Origins of obesity.(CHEMICAL EXPOSURES)
Lead, paraquat, and methylmercury disrupt neuronal stem cells by a common mechanism.(Molecular Biology)
Of Mice and Women.(BEYOND THE BENCH)
Perfluoroalkyl acids: what is the evidence telling us?(Focus)

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles