Printer Friendly
The Free Library
14,757,244 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Panmicrobial oligonucleotide array for diagnosis of infectious diseases.


To facilitate rapid, unbiased, differential diagnosis of infectious diseases, we designed GreeneChipPm, a panmicrobial microarray comprising 29,455 sixty-mer oligonucleotide probes for vertebrate viruses, bacteria, fungi, and parasites. Methods for nucleic acid preparation, random primed PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
 amplification, and labeling were optimized to allow the sensitivity required for application with nucleic acid extracted from clinical materials and cultured isolates. Analysis of nasopharyngeal nasopharyngeal

pertaining to the nasal and pharyngeal cavities.


nasopharyngeal meatus
see nasopharyngeal meatus.

nasopharyngeal spasm
see reverse sneeze.
 aspirates, blood, urine, and tissue from persons with various infectious diseases confirmed the presence of viruses and bacteria identified by other methods, and implicated Plasmodium falciparum in an unexplained fatal case of hemorrhagic Hemorrhagic
A condition resulting in massive, difficult-to-control bleeding.

Mentioned in: Hantavirus Infections


hemorrhagic

pertaining to or characterized by hemorrhage.
 feverlike disease during the Marburg hemorrhagic fever Noun 1. Marburg hemorrhagic fever - a viral disease of green monkeys caused by the Marburg virus; when transmitted to humans it causes serious or fatal illness
green monkey disease, Marburg disease
 outbreak in Angola in 2004-2005.

**********

Rapid differential diagnosis of infectious diseases is increasingly important as novel pathogens emerge in new contexts and treatment strategies are beginning to be tailored to specific infectious agents. Because clinical syndromes are rarely specific for single pathogens, unbiased multiplex assays are essential. Methods for direct molecular detection of microbial microbial

pertaining to or emanating from a microbe.


microbial digestion
the breakdown of organic material, especially feedstuffs, by microbial organisms.
 pathogens in clinical specimens are rapid, sensitive, and may succeed when fastidious requirements for agent replication or the need for high-level biocontainment confound cultivation.

We have adopted a staged strategy for molecular pathogen surveillance and discovery. In the first stage we use MassTag PCR, a PCR platform wherein discrete mass tags rather than fluorescent dyes serve as reporters. This method, which allows simultaneous detection of >20 different pathogens with high sensitivity, has proven useful for differential diagnoses of respiratory disease and viral hemorrhagic fevers (1-3). However, it is not sufficient when larger numbers of known pathogens must be considered, when new but related pathogens are anticipated, or when sequence divergence might impair binding of PCR primers. Thus, to address the challenge of more highly multiplexed differential diagnosis, we established an oligonucleotide microarray platform.

Microarrays have potential to provide a platform for highly multiplexed differential diagnosis of infectious diseases (4,5). The number of potential features per microarray far exceeds those of any other known technology; hundreds of thousands of features can be printed on 70-mm x 20-mm slides. Furthermore, sequence probes of [greater than or equal to] 70 nt are not uncommon. Thus, microbes can be detected when melting temperatures are high enough to allow hybridization hybridization /hy·brid·iza·tion/ (hi?brid-i-za´shun)
1. crossbreeding; the act or process of producing hybrids.

2. molecular hybridization

3.
, despite a lack of precise complementarity com·ple·men·tar·i·ty
n.
1. The correspondence or similarity between nucleotides or strands of nucleotides of DNA and RNA molecules that allows precise pairing.

2.
 between probe and target. Lastly, microbial and host gene targets can be incorporated, which provides an opportunity to detect microbes and assess host responses for signatures consistent with various classes of infectious agents. Despite these advantages, microbial arrays have not been widely used

with clinical materials because of limited sensitivity. The primary service of microbial arrays has been characterization of agents propagated to high titer in vitro (6).

We report establishment of a microarray platform for pathogen surveillance and discovery, the GreeneChip system. Its key features include a comprehensive microbial sequence database for probe design and protocols for sample preparation, amplification, labeling, hybridization, and analysis. The system has been optimized with cultured viral isolates; tested with blood, respiratory, urine, and tissue samples containing bacterial and viral pathogens; and applied in an outbreak investigation when other methods failed to implicate a microorganism microorganism /mi·cro·or·gan·ism/ (-or´gah-nizm) a microscopic organism; those of medical interest include bacteria, fungi, and protozoa.  in a fatal hemorrhagic fever case.

Methods

Pathogen Database

A vertebrate viral sequence database (GreeneVrdB) was established by integrating the database of the International Committee on Taxonomy of Viruses The International Committee on Taxonomy of Viruses (ICTV) is a committee which authorizes and organizes the taxonomic classification of viruses. They have developed a universal taxonomic scheme for viruses and aim to describe all the viruses of living organisms.  (ICTVdB, http://phene.cpmc.columbia.edu), a database that describes viruses at the levels of order, family, genus, and species, and the sequence database of the National Center for Biotechnology Information The National Center for Biotechnology Information (NCBI) is part of the United States National Library of Medicine (NLM), a branch of the National Institutes of Health. The NCBI is located in Bethesda, Maryland and was founded in 1988.  (NCBI NCBI National Center for Biotechnology Information (NIH)
NCBI National Coalition Building Institute
NCBI National Council for the Blind of Ireland (Dublin, Ireland) 
, www.ncbi.nih.gov). Functionally related sequences were clustered by using the protein families (Pfam, http://pfam.janelia.org) database of alignments (7). Most viral protein coding sequences in the NCBI database (84%) were represented in the Pfam database; the remainder were mapped by using pairwise BLAST alignments (8). The rRNA sequences of fungi, bacteria, and parasites obtained from the Ribosomal Database Project (RDP (Remote Desktop Protocol) The presentation services protocol that governs input/output between a Windows terminal client and Windows Terminal Server. It is based on the T.share protocol. See Windows Terminal Server.

(protocol) RDP -

1.
, http://rdp.cme.msu.edu) or the NCBI database were added to create a panmicrobial database (GreenePmdB). The GreenePmdB comprises the 228,638 viral sequences of the GreeneVrdB that represent complete and partial viral genomes, and 41,790 bacterial 16S rRNAs, 4,109 fungal 18S rRNAs, and 2,626 18S parasitic rRNAs. These sequences represent all recognized 1,710 vertebrate virus species and 135 bacterial, 73 fungal, and 63 parasite genera.

GreeneChip Design and Fabrication

Viral probes were designed to represent a minimum of 3 distinct genomic target regions for every family or genus of vertebrate virus in the ICTVdB. When possible, we chose highly conserved regions within a coding sequence for an enzyme such as a polymerase and 2 other regions that corresponded to more variable structural proteins. We thought that RNAs that encode structural proteins may be present at higher levels than those that encode proteins needed only in catalytic amounts and that use of probes representing noncontiguous sites along the genome might allow detection of naturally occurring or intentionally created chimeric chi·mer·ic
adj.
1. Relating to a chimera.

2. Composed of parts of different origin.
 viruses.

Any diagnostic tool based on nucleic acid hybridization Hybridization is the process, discovered by Alexander Rich, of combining complementary, single-stranded nucleic acids into a single molecule. Nucleotides will bind to their complement under normal conditions, so two perfectly complementary strands will bind to each other readily.  is necessarily dependent on the extent to which probes are complementary to their targets. Although sequence databases are increasingly comprehensive, it is unlikely that more than a fraction of the existing microbial sequence space has been explored. Our intent in implementing the GreeneChip was to have the potential to identify known and related agents for which precise sequence information was not available. To assess the extent to which a given probe sequence can hybridize hy·brid·ize  
intr. & tr.v. hy·brid·ized, hy·brid·iz·ing, hy·brid·iz·es
1. To produce or cause to produce hybrids; crossbreed.

2.
 to a non-matching but related sequence, we analyzed synthetic mismatch controls. Whereas up to 15 terminal mismatches had little effect, strings of [greater than or equal] 5 mismatches distributed throughout a sequence, particularly mismatched G/C G/C Gas-to-Cloth Ratio  pairs, resulted in reduced signal; >12 mismatches distributed throughout a sequence resulted in no signal. On the basis of these findings, we pursued a conservative strategy in array design wherein a viral sequence was considered to be covered only if the array included at least 1 complementary probe with [less than or equal to] 5 mismatches.

The process for identifying bacterial, fungal, and parasitic probes was similar, although restricted to 16S and 18S rRNA sequences. Viral (GreeneChipVr) and panmicrobial (GreeneChipPm) array platforms were based on the GreeneVrdB and GreenePmdB, respectively. GreeneChipVr version 1.0 contained 9,477 probes to address all vertebrate viruses in the integrated ICTV/NCBI database (1,710 species, including all reported isolates) in 3 gene regions with [less than or equal to] 5 nucleotide mismatches. GreeneChipPm version 1.0 contained 29,495 probes that included probes comprising GreeneChipVr version 1.0, as well as 11,479 16S rRNA bacterial probes, 1,120 18S rRNA fungal probes, and 848 18S rRNA parasite probes. A total of 300 host immune response probes were added to arrays as a potential index to pathogenesis.

The 60-mer oligonucleotide arrays were synthesized on 70-mm x 20-mm glass slides by using an inkjet deposition system (Agilent Technologies, Palo Alto, CA, USA). A slide can accept up to 244,000 different 60-mer probes or 8 arrays, each comprising [greater than or equal] 15,000 probes. To facilitate alignment during scanning, 1,000 additional landing-light probes (5'-ATC ATC ATC Air Traffic Control
ATC Average Total Cost
ATC Certified Athletic Trainer
ATC At the Center (Hartford, Maine retreat center)
ATC Applied Technology Council
ATC All Things Considered
 GTA GTA Grand Theft Auto (legal)
GTA Grand Theft Auto (video game)
GTA Greater Toronto Area (Canada)
GTA Graduate Teaching Assistant
 GCT (programming, tool) GCT - A test-coverage tool by Brian Marick <marick@testing.com>, based on GNU C. Version 1.4 was ported to Sun-3, Sun-4, RS/6000, 68000, 88000, HP-PA, IBM 3090, Ultrix, Convex, SCO but not Linux, Solaris, or Microsoft Windows.  GGT GGT

?-glutamyl transferase.

GGT Gammaglutamyltransferase, see there
 CAG CAG 1 Chronic atrophic gastritis 2 Coronary angiography, see there  TGT TGT Target
TGT Ticket Granting Ticket (Windows 2000 Kerberos security)
TGT Target Corp (stock symbol)
TGT Turbine Gas Temperature
TGT TDRSS Ground Terminal
TGT Tank Gunnery Trainer
TGT Target Tracker
 ATC CTT CTT Correios (Portuguese Postal Service)
CTT Certified Technical Trainer
CTT Charity Technology Trust
CTT Cholesterol Treatment Trialists' (collaboration)
CTT Common Task Training
 TTT "Thought that too." See digispeak.  TTT TTA TTA Telecommunications Technology Association (Korea)
TTA Teacher Training Agency (UK)
TTA Triangle Transit Authority (Raleigh/Chapel Hill/Durham, North Carolina, USA) 
 TCA TCA

1. trichloroacetic acid.

2. tricarboxylic acid cycle (Krebs cycle).

TCA Tricyclic antidepressant, see there
 TCG (Trusted Computing Group, Beaverton, OR, www.trustedcomputinggroup.org) The successor to the Trusted Computer Platform Alliance (TCPA), announced in 2003 by founding members AMD, HP, IBM, Intel and Microsoft.  TAG CTG CTG Cartridge
CTG Center for Technology in Government (SUNY, Albany, New York)
CTG Center for Technology in Government
CTG Computer Task Group (IT consulting company; Buffalo, NY, USA) 
 GTC GTC

See: Good 'til cancelled order


GTC

See good-till-canceled order (GTC).
 AGT AGT antiglobulin test.  GTA TCC-3') were placed in the corners and in a grid on the array. Fluorescently labeled synthetic oligonucleotides complementary to the control probes were included in all hybridizations.

Viruses and Clinical Samples

Sources of viruses and viral reference strains used in this study are shown in Tables 1 and 2. Blood sample 200501379 (Lake Victoria marburgvirus, reference sample from Angola, 2005) and blood sample Angola-460 from a patient suspected of having viral hemorrhagic fever (VHF (Very High Frequency) The range of electromagnetic frequencies from 30 MHz to 300 MHz. ) were received in containers approved by the International Air Transport Association at either the Centers for Disease Control and Prevention Centers for Disease Control and Prevention (CDC), agency of the U.S. Public Health Service since 1973, with headquarters in Atlanta; it was established in 1946 as the Communicable Disease Center.  in Atlanta, Georgia, USA or the Public Health Agency of Canada The Public Health Agency of Canada (French: Agence de la santé publique du Canada) is an agency of Health Canada a department of the Government of Canada that is responsible for public health, emergency preparedness, and response and infectious and chronic disease control  in Winnipeg, Ontario, Canada, respectively.

Sources of clinical samples are shown in Table 3. Nasopharyngeal aspirates (SO4606 and SO5265) were collected by the Instituto de Salud Carlos III in Madrid, Spain, from children with respiratory disease. We also analyzed a nasopharyngeal aspirate as·pi·rate
v.
To take in or remove by aspiration.

n.
A substance removed by aspiration.


Aspirate
The removal by suction of a fluid from a body cavity using a needle.
 (sample 23), a post-mortem specimen from a patient who died of infection with severe acute respiratory syndrome Severe Acute Respiratory Syndrome (SARS) Definition

Severe acute respiratory syndrome (SARS) is the first emergent and highly transmissible viral disease to appear during the twenty-first century.
 coronavirus (SARS-CoV, sample TM-167), urine specimens from 2 patients with urinary tract infections (samples CUMC-NR7 and CUMC-NR9), a urine specimen from an asymptomatic patient (sample CUMC-LO1), and endometrial endometrial /en·do·me·tri·al/ (en?do-me´tre-il) pertaining to the endometrium.
endometrial,
n relating to the end-ometrium or cavity of the uterus.
 and lung tissues from a patient infected with Mycobacterium tuberculosis (samples CUMC-DL1 and CUMC-DL3).

Sample Preparation and GreeneChip Hybridization

RNA RNA: see nucleic acid.
RNA
 in full ribonucleic acid

One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic
 was isolated from blood of VHF patients by using a 6100 Nucleic Acid PrepStation (Applied Biosystems, Foster City, CA, USA). RNA from virus isolates (culture supernatant) and other clinical samples (blood, nasopharyngeal aspirate, tissue, urine) was isolated by using the Tri-Reagent (Molecular Research Center Inc., Cincinnati, OH, USA). DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 was removed from RNA preparations by treatment with DNase I (DNA-free, Ambion Inc., Austin, TX, USA). First-strand reverse transcription was initiated with a random octamer linked to a specific primer sequence (5'-GTT TCC TCC The Car Connection (web site)
TCC Tidewater Community College
TCC Tallahassee Community College
TCC Temporary Continuation of Coverage
TCC Tucson Convention Center (Tucson, AZ, USA) 
 CAG TAG GTC TCN TCN Tetracycline
TCN transparent content negotiation
TCN Third Country National(s)
TCN Topology Change Notification
TCN Transportation Control Number
TCN Train Communication Network
TCN Transaction Control Number
 NNN NNN Triple Net (method of computing real estate costs among commercial rental properties; lease)
NNN Nippon News Network (Japan)
NNN Newspaper National Network LP
NNN Novy-MacNeal-Nicolle
 NNN N-3') (5). After digestion with RNase H, cDNA was amplified by using a 1:9 mixture of the above primer and a primer targeting the specific primer sequence (5'-CGC CGT CGT Capital Gains Tax
CGT Confédération Générale du Travail (French Labor Union)
CGT Confederación General del Trabajo (Spanish: Federation of Trade Unions) 
 TTC TTC Trying To Conceive
TTC Toronto Transit Commission
TTC Trans Texas Corridor
TTC Toutes Taxes Comprises (French)
TTC Trident Technical College (North Charleston, SC)
TTC Temporary Traffic Control
 CCA (1) (Common Cryptographic Architecture) Cryptography software from IBM for MVS and DOS applications.

(2) (Compatible Communications A
 GTA GGT CTC-3'). Initial PCR amplification cycles were performed at a low annealing annealing (ənēl`ĭng), process in which glass, metals, and other materials are treated to render them less brittle and more workable.  temperature (25[degrees]C); subsequent cycles used a stringent annealing temperature (55[degrees]C) to favor priming through the specific sequence. Products of this first PCR were then labeled in a subsequent PCR with the specific primer sequence linked to a capture sequence for 3DNA dendrimers containing >300 fluorescent reponer molecules (Genisphere Inc., Hatfield, PA, USA), Products of the second PCR were added to sodium dodecyl sulfate--based hybridization buffer (Genisphere Inc.), heated for 10 min at 80[degrees]C, and added to GreeneChip for hybridization for 16 h at 65[degrees]C. After 10-min washes at room temperature with 6 x SSC SSC Secondary School Certificate
SSC Standard Systems Center (USAF)
SSC State Services Commission (New Zealand)
SSC Swedish Space Corporation
SSC Salem State College (Massachusetts) 
 (0.9 mol/L NaCI, 0.09 mol/L sodium citrate, pH 7.0), 0.005% Triton X-100, and 0.1 X SSC, 0.005% Triton X-100, Cy3 3DNA dendrimers were added and incubated at 65[degrees]C for 1 h. Slides were washed as before, air dried, and scanned (DNA Microarray scanner, Agilent Technologies).

GreeneChip Analysis

Log-transformed analysis of microarrays using p values (GreeneLAMP) version 1.0 software was created to assess results of GreeneChip hybridizations. A map built from BLAST data was used to connect probe sequences to the respective entries in the GreenePmdB. Each of those sequences corresponds to an NCBI Taxonomy ID (TaxID). Individual TaxIDs were mapped to nodes in a taxonomic tree built based on ICTV ICTV International Committee on Taxonomy of Viruses
ICTV Independent Community Television Alliance
 virus taxonomy or the NCBI taxonomic classification for other organisms. The program output is a ranked list of candidate TaxIDs.

Probe intensities were corrected for background, [log.sub.2]-transformed, and converted to Z scores (and their corresponding p values). Where available, control-matched experiments from uninfected samples were used, and spots >2 standard deviations from the mean were subtracted. In instances where control-matched samples were not available, the background distribution of signal fluorescence in an array was calculated by using fluorescence associated with 1,000 random 60 mers (null probes). In both scenarios, positive events were selected by applying a false-positive rate of 0.01 (the rate at which null probes are scored as significant) and a minimum p value per probe of 0.1 in cases with a matching control and 0.023 (2 standard deviations) in cases without a matching control. Candidate TaxIDs were ranked by combining the p values for the positive probes for that TaxID by using the QFAST method of Bailey and Gribskov (9). This approach makes the following assumptions: 1) spot intensities are normally distributed; 2) spots represent independent observations (to minimize this effect clustering is used to collapse probes that are 95% identical); and 3) there are relatively few (<100) positive probes for any given TaxID. Probes for each kingdom (bacteria, eukaryotes, fungi, viruses) were analyzed independently to compensate for variations in signal-to-noise levels.

Sequence Recovery from Hybridized Arrays

When a hybridization signal suggests a novel or chimeric agent, or the investigator wants to obtain sequence information, cDNA can be eluted for amplification and sequence analysis. A total of 100 [micro]L of water at 90[degrees]C is added to the array and pipetted up and down 10 times. The eluate eluate /el·u·ate/ (el´u-at) the substance separated out by, or the product of, elution or elutriation.

el·u·ate
n.
The solution of solvent and dissolved matter resulting from elution.
 is recovered, amplified with the specific primer used during the initial amplification, and cloned into a plasmid vector (TOPO TOPO Tri-N-Octylphosphine Oxide
TOPO Topographic/Topography
TOPO Trioctyl-Phosphine Oxide
ToPo Torposten (German Military Gate Post)
TOPO Tunable Optical Parametric Oscillator
 TA, Invitrogen, Carlsbad, CA, USA). After transformation into Escherichia coli, colonies are screened by sequencing. Primers based on the obtained sequence can be designed for confirmation of the agent or for specific (real-time) PCR screening of other specimens.

Quantitative Real-Time PCR for Plasmodium falciparum

A quantitative real-time PCR assay was designed to amplify a 190-bp product from positions 178 to 367 of the 5.8S rRNA sequence eluted from the GreeneChipPm to confirm the presence of plasmodia in the original clinical sample. Reactions were performed in a 25-[micro]L volume by using a commercial SYBR-Green reaction mixture (Applied Biosystems) and performed according to the manufacturer's instructions. The primer sequences were 5'-GGAACGGCTTTGTAACTTGG-3' and 5'-TGTCCTCAGAGCCAATCCTT-3'. The following cycling conditions were used: 50[degrees]C for 2 min and 95[degrees]C for 10 min, followed by 45 cycles at 95[degrees]C for 15 sec and 60[degrees]C for 1 min. To quantitate quan·ti·tate  
tr.v. quan·ti·tat·ed, quan·ti·tat·ing, quan·ti·tates
To determine or measure the quantity of.



[Back-formation from quantitative (analysis).
 organism load in the original clinical sample, the targeted sequence region was cloned from the chip-hybridized, eluted nucleic acid. The cloned sequence was used to generate a 7-point standard curve (starting from 5 x [10.sup.6] copies/assay) for quantitation; each run included negative no-template controls. Thermal cycling was performed in an ABI Abi (ā`bī) [short for Abijah], in the Bible, King Hezekiah's mother.


(Application Binary Interface) A specification for a specific hardware platform combined with the operating system.
 7300 real-time PCR system (Applied Biosystems).

Results

Evaluation of GreeneChip Performance

The performance of the GreeneChip system was initially tested in GreeneChipVr hybridizations that used extracts of cultured cells infected with adenoviruses, alphaviruses, arenaviruses, coronaviruses, enteroviruses Enteroviruses
Viruses which live in the gastrointestinal tract. Coxsackie viruses, viruses that cause hand-foot-mouth disease, are an enterovirus.

Mentioned in: Hand-Foot-and-Mouth Disease
, filoviruses, flaviviruses, herpesviruses Herpesviruses
A family of viruses responsible for cold sores, chicken pox, and genital herpes.

Mentioned in: Skin Resurfacing
, orthomyxoviruses, paramyxoviruses, poxviruses, reoviruses, and rhabdoviruses (49 viruses). All viruses were accurately identified (Tables 1 and 2). To assess sensitivity, viral RNA extracted from infected cell supernatants (adenovirus adenovirus

Any of a group of spheroidal viruses, made up of DNA wrapped in a protein coat, that cause sore throat and fever in humans, hepatitis in dogs, and several diseases in fowl, mice, cattle, pigs, and monkeys.
, West Nile virus West Nile virus, microorganism and the infection resulting from it, which typically produces no symptoms or a flulike condition. The virus is a flavivirus and is related to a number of viruses that cause encephalitis. , Saint Louis encephalitis virus Saint Louis encephalitis virus
n.
An arbovirus that causes Saint Louis encephalitis and is transmitted by a mosquito.
, respiratory syncytial virus respiratory syncytial virus (sĭnsĭsh`əl): see cold, common. , enterovirus enterovirus /en·tero·vi·rus/ (en´ter-o-vi?rus) any virus of the genus Enterovirus. enterovi´ral
Enterovirus /En·tero·vi·rus/ (en´ter-o-vi?rus 
, SARS-CoV, and influenza virus) was quantitated by real-time PCR, serially diluted, and subjected to analysis with template concentrations ranging from 10 to 1,000,000 copies/assay. The threshold for detection of adenovirus (used as a DNA virus example) was 10,000 RNA copies; the threshold for detection of the RNA viruses tested was 1,900 RNA copies (Table 4).

Array performance was then tested by using samples obtained from patients with respiratory disease, hemorrhagic fever, tuberculosis, and urinary tract infections. In all cases, array analysis detected an agent consistent with the diagnosis obtained by culture or PCR. GreeneLAMP analysis detected human enterovirus A, human respiratory syncytial syncytial /syn·cy·tial/ (sin-sish´al) of or pertaining to a syncytium.

syncytial

pertaining to or producing a syncytium.


bovine syncytial virus
see retroviridae.
 A virus, influenza A virus, Lake Victoria marburgvirus (MARV MARV Mammoth Armed Reclamation Vehicle (Command & Conquer 3: Kane's Wrath; computer game)
MARV Marburg Virus
MARV Maneuverable Reentry Vehicle
MARV Mobile Armored Reconnaissance Vehicle
MARV Mars Aerial Research Vehicle
), SARS-CoV, lactobacillus lactobacillus

Any of the rod-shaped, gram-positive (see gram stain) bacteria that make up the genus Lactobacillus. They are widely distributed in animal feeds, manure, and milk and milk products.
, mycobacteria mycobacteria

members of the genus Mycobacterium.


anonymous mycobacteria
see opportunist (atypical) mycobacteria (below).

nontubercular mycobacteria
see opportunist (atypical) mycobacteria (below).
, and gammaproteobacteria (Table 3). Specific real-time PCR analyses indicated viral loads of 6.3 x [10.sup.5] copies/assay for SARS-CoV (10), 1.1 x [10.sup.3] copies/assay for respiratory syncytial virus (11), and 5.46 x [10.sup.5] copies/assay for enterovirus A (12) in clinical specimens. Details of the array analysis process are presented below for the detection of 2 viruses and 2 bacteria in clinical specimens.

Sample 200501379 contained RNA extracted from the blood of a person who died of VHF. In GreeneLAMP analysis, MARV TaxID 11269 was the top prediction by the combined p-value method using QFAST (9). The highest relative number of positive probes (10/11, 90.9%) also corresponded to MARV (Figure 1A). In contrast, only 2 of 16 probes were positive for the next best predicted TaxID 11901, bovine leukemia virus bovine leukemia virus

see bovine viral leukosis.
. Sequence-based analysis identified GenBank accession no. DQ447653 (Lake Victoria marburgvirus--Angola2005 strain Ang 1379c) with 8 positive probes as the best match. The 10 positive probes aligned with all 8 MARV gene motifs represented on the array (Figure 1B). Only 4 (17%) of 23 probes were positive for the next best predicted GenBank entry, AF534225 (Gorilla gorilla lymphocryptovirus 1); all aligned with only 1 motif.

[FIGURE 1 OMITTED]

Sample TM-167 contained RNA extracted from the lung of a person who died from SARS during the 2003 outbreak in Toronto, Ontario, Canada. In GreeneLAMP analysis, SARS-CoV was the top prediction by the combined p-value method. The highest relative number of positive probes (9/20, 45.0%) also corresponded to SARS-CoV. Sequence-based analysis identified GenBank accession no. AY274119 (SARS-CoV Tor2) with 9 probes representing 9 distinct genome motifs. The next best prediction was for AY738457 (influenza A virus); all influenza virus probes represented only 1 genome motif.

Analyses of bacterial samples were more complex because many rRNA probes are cross-reactive between taxa taxa: see taxon. , and the GreeneLAMP algorithm is not designed to take into account >100 probes positive for 1 TaxID. Thus, the program was run considering only probes that reacted with 1 genus-level TaxID. This strategy identified mycobacteria in sample CUMC-DL3 and lactobacilli Lactobacilli,
cariogenic,
n a type of bacteria that may play an important role in tooth decay. It is usually found in small amounts in dental plaque. Its concentration increases with high sugar intake.
 in sample CUMC-LO1. In sample CUMC-DL3, the sequence-based algorithm identified AY725810 (uncultured Mycobacterium mycobacterium

Any of the rod-shaped bacteria that make up the genus Mycobacterium. The two most important species cause tuberculosis and leprosy in humans; another species causes tuberculosis in both cattle and humans.
 sp.) as significant, with 231 positive probes across 6 nonoverlapping regions. In sample CUMC-LO1, AJ853317 (Lactobacillus vaginalis) was the most significant result with 87 positive probes. Consensus PCR assays were developed for mycobacteria and lactobacilli. Primers designed by using Greene SCPrimer (http://scprimer.cpmc.columbia.edu/SCPrimerApp.cgi) were Myco_U901 : 5'-ATCGAGGATGTCGAGTTGGC-3' (forward); Myco_L968: 5'-TACTGGTAGAGGCGGCGATG-3' (reverse); Lacto 817: 5"-CGGTGGAATGCGTAGATATATGGA-3' (forward); and Lacto_1026: 5"-TCCTTTGAGTTTCAACCTTGCGGT-3' (reverse). Products obtained after PCR amplification were sequenced and matched the predicted GenBank entries.

Analysis of Unknown Sample from Patient with VHF-like Syndrome

Within 6-8 days of infection, MARV causes an acute febrile illness acute febrile illness A nonspecific term for an illness of sudden onset accompanied by fever  that frequently progresses to liver failure, delirium, shock, and hemorrhage (13,14). From October 2004 through July 2005, a MARV outbreak in Angola resulted in 252 cases of hemorrhagic fever; 227 (90%) cases were fatal (15). Although most of the putative cases infected with MARV were confirmed by PCR, some were not. During this outbreak, a healthcare worker from a non-governmental organization had acute fever and liver failure that culminated in death within 1 week. PCR assays of RNA extracted from blood showed no evidence of MARV infection. The same RNA was tested in a multiplex PCR for VHF that used primers for detection of Zaire Ebola, Sudan Ebola, MARV, Lassa fever, Rift Valley fever Rift Valley fever

An arthropod-borne (primarily mosquito), acute, febrile, viral disease of humans and numerous species of animals. Rift Valley fever is caused by a ribonucleic acid (RNA) virus in the genus Phlebovirus of the family Bunyaviridae.
, Crimean-Congo hemorrhagic fever Crimean-Congo hemorrhagic fever

a zoonotic disease of humans, in central Asia through to eastern Europe, who are in contact with livestock. Caused by a bunyavirus, it is transmitted by ticks. The principal signs are fever, widespread hemorrhages and necrotizing hepatitis.
, Hantaan, Seoul, yellow fever, and Kyasanur Forest disease Kyasanur Forest disease

a highly fatal flavivirus disease of monkeys in the Kyasanur Forest of India, communicable to humans, in whom it produces hemorrhagic symptoms. See also encephalitis.
 viruses (3) for differential diagnosis of VHF. Because this test did not identify an etiologic agent, the RNA was processed for panviral analysis with GreeneChipVr. Because no significant hybridization was detected, the RNA was assayed with GreeneChipPm. Bioinformatic analysis identified a Plasmodium plasmodium, name for a stage in the life cycle of a slime mold. Also, Plasmodium is the name given to the genus of the protozoan parasite that causes malaria.  sp. with 21 (62%) of 34 probes positive (Table 5). Chart review showed that the patient had recently arrived in Angola from a country where malaria was not endemic and that he had not taken malaria prophylaxis.

Hybridized cDNA was eluted from the array, cloned, and sequenced. Identified clones contained sequences corresponding to 18S rRNA and 5.8S rRNA of P. falciparum (Figure 2, Table 6). Plasmodia contain several alternative 18S-5.8S-28S rRNA genes. The expression of each rRNA set is developmentally regulated, which results in expression of a different set of rRNAs at different stages of the life cycle of the organism (17); e.g., S-type rRNA is expressed primarily in the mosquito vector, but A-type rRNA is expressed primarily in the human host (17). Only A-type sequences were recovered from the array. Analysis of the original RNA extract in a SYBR Green real-time PCR assay designed to amplify a 190-bp product of the P. falciparum 5.8S rRNA gene confirmed the presence of P. falciparurn (2 x [10.sup.6] [+ or -] 8 x [10.sup.4] copies/[micro]L blood), and indicated a parasite load >5%. The similarity of the signs and symptoms of severe malarial disease with viral hemorrhagic disease, the detection of a parasite load >5% (18), and the origin of this patient from a country nonendemic for malaria are consistent with a diagnosis of infection with P. falciparum as the most likely cause of death.

[FIGURE 2 OMITTED]

Discussion

Differential diagnosis of hemorrhagic fevers poses challenges for clinical medicine and public health. Syndromes associated with agents are not distinctive, particularly early in the course of disease. In some instances, including the case presented here, more than 1 agent may be endemic in the region of the outbreak. Outbreaks caused by different agents may also overlap in time and geography. Examples of such coincident outbreaks include monkeypox and varicella-zoster viruses in the Democratic Republic of Congo in 1996 and 2001 (19,20) and measles and Ebola viruses in Sudan in 2004 (21). Furthermore, implicit in globalization is the risk of known or new agents that appear in novel contexts. In 1996, a presumptive diagnosis of Ebola VHF in 2 children who had recently returned to New York City New York City: see New York, city.
New York City

City (pop., 2000: 8,008,278), southeastern New York, at the mouth of the Hudson River. The largest city in the U.S.
 from West Africa resulted in closing a hospital emergency room (22). One of the children died of cardiac failure caused by P. falciparum parasitemia parasitemia /par·a·si·te·mia/ (par?ah-si-te´me-ah) the presence of parasites, especially malarial forms, in the blood.

par·a·si·te·mi·a
n.
The presence of parasites in the blood.
 and hemolysis hemolysis (hĭmŏl`ĭsĭs), destruction of red blood cells in the bloodstream. Although new red blood cells, or erythrocytes, are continuously created and old ones destroyed, an excessive rate of destruction sometimes occurs.  (23). Therapeutic options for treatment of VHF are limited; however, rapid isolation of infected persons is critical to curb contagion Contagion

The likelihood of significant economic changes in one country spreading to other countries. This can refer to either economic booms or economic crises.

Notes:
An infamous example is the "Asian Contagion" that occurred in 1997 and started in Thailand.
. In contrast, whereas human-to-human transmission is not a primary concern with malaria, early specific therapy can have a profound effect on illness and death (24).

To address the challenges of emerging infectious diseases and biodefense, public health practitioners and diagnosticians need a comprehensive set of tools for pathogen surveillance and isolation. PCR methods have advantages with respect to sensitivity, throughput, and simplicity, but are limited in potential for multiplexing. Although mieroarrays have potential to allow highly multiplexed, unbiased surveillance, their use has been limited because of low sensitivity and unwieldy analytical programs. The GreeneChip system introduces sample preparation and labeling methods that enhance sensitivity, as well as userfriendly analytical software that we anticipate will facilitate clinical application. The advent of validated highly multiplexed microbiologic assays will afford unprecedented opportunities for unbiased pathogen surveillance and discovery and reduction of illness and death caused by infectious disease.

Acknowledgments

We thank Mady Homig for helpful comments and providing host immune response probes and David Smith, David Boyle, Phyllis Della-Latta, Adolfo Garcia-Sastre, Gerry Hamett, Phillipa Jack, Cheryl Johansen, Anthony Mazzuli, John Mackenzie, Hendrik Nollens, Pilar Pilar

strong-minded female leader of a group of guerrillas in the Spanish Civil War. [Am. Lit.: Hemingway For Whom the Bell Tolls]

See : Female Power


Pilar
 Perez-Brena, and David Williams for specimens used in assay development and validation. We dedicate this paper to Allan Rosenfield, a humanitarian and visionary in global health.

The study was supported by National Institutes of Health grants AI51292, AI056118, AI55466, U54AI57158 (Northeast Biodefense Center-Lipkin), and U01AI070411, and the Ellison Medical Foundation.

References

(1.)Briese T, Palacios G, Kokoris M, Jabado O, Liu Z, Renwick N, et al. Diagnostic system for rapid and sensitive differential detection of pathogens. Emerg Infect Dis. 2005; 11:310-3.

(2.) Lamson D, Renwick N, Kapoor V, Liu Z, Palacios G, Ju J, et al. MassTag polymerase-chain reaction detection of respiratory pathogens, including a new rhinovirus rhinovirus

Any of a group of picornaviruses capable of causing common colds in humans. The virus is thought to be transmitted to the upper respiratory tract by airborne droplets.
 genotype, that caused influenza-like illness in New York State during 2004-2005. J Infect Dis. 2006;194:1398-402.

(3.)Palacios G, Briese T, Kapoor V, Jabado O, Liu Z, Venter venter /ven·ter/ (ven´ter) pl. ven´tres   [L.]
1. a fleshy contractile part of a muscle.

2. abdomen.

3. a hollowed part or cavity.


ven·ter
n.
 M, et al. MassTag polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is  for differential diagnosis of viral hemorrhagic fevers. Emerg Infect Dis. 2006; 12:692-5.

(4.) Lin B, Wang Z, Vota GJ, Thomton JA, Schnur JM, Thach DC, et al. Broad-spectrum respiratory tract pathogen identification using resequencing DNA microarrays. Genome Res. 2006;16:527-35.

(5.) Wang D, Coscoy L, Zylberberg M, Avila PC, Boushey HA, Ganem D, et al. Microarray-based detection and genotyping of viral pathogens. Proc Natl Acad Sci U S A. 2002;99:15687-92.

(6.) Ksiazek TG, Erdman D, Goldsmith CS, Zaki SR, Peret T, Emery S, et al. A novel coronavirus associated with severe acute respiratory syndrome. N Engl J Med. 2003;348:1953-66.

(7.) Finn RD, Mistry J, Schuster-Bockler B, Griffiths-Jones S, Hollich V, Lassmann T, et al. Pfam: clans, web tools and services. Nucleic Acids Res. 2006;34(Database issue):D247-51.

(8.) Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basie local alignment search tool. J Mol Biol. 1990;215:403-10.

(9.) Bailey TL, Gribskov M. Combining evidence using p-values: application to sequence homology searches. Bioinformatics. 1998;14:48-54.

(10.) Zhai J, Briese T, Dai E, Wang X, Pang X, Du Z, et al. Real-time polymerase chain reaction In Molecular Biology, real-time polymerase chain reaction, also called quantitative real time polymerase chain reaction (QRT-PCR) or kinetic polymerase chain reaction  for detecting SARS coronavirus, Beijing, 2003. Emerg Infect Dis. 2004; 10:300-3.

(11.) van Elden L J, van Loon loon, common name for migratory aquatic birds found in fresh- and saltwater in the colder parts of the Northern Hemisphere. Its strange, laughing call carries for great distances. Like the grebes, loons float low in the water and their legs are placed far back.  AM, van der Beek A, Hendriksen KA, Hoepelman AI, van Kraaij MG, et al. Applicability of a real-time quantitative PCR assay for diagnosis of respiratory syncytial virus infection Respiratory Syncytial Virus Infection Definition

Respiratory syncytial virus (RSV) is a virus that can cause severe lower respiratory infections in children under the age of two, and milder upper respiratory infections in older children and adults.
 in immunocompromised immunocompromised /im·mu·no·com·pro·mised/ (-kom´pro-mizd) having the immune response attenuated by administration of immunosuppressive drugs, by irradiation, by malnutrition, or by certain disease processes (e.g., cancer).  adults. J Clin Microbiol. 2003;41:4378-81.

(12.) Witso E, Palacios G, Cinek O, Stene LC, Grinde B, Janowicz D, et al. Natural circulation of human enteroviruses: high prevalence of human enterovirus A infections. J Clin Microbiol. 2006 [Epub ahead of print].

(13.) Mahanty S, Bray M. Pathogenesis of filoviral haemorrhagic fevers. Lancet Infect Dis. 2004;4:487-98.

(14.) Peters CJ, Zaki SR. Role of the endothelium endothelium /en·do·the·li·um/ (-the´le-um) pl. endothe´lia   the layer of epithelial cells that lines the cavities of the heart, the serous cavities, and the lumina of the blood and lymph vessels.  in viral hemorrhagic fevers. Crit Care Med. 2002;30(5 Suppl):S268-73.

(15.) Towner JS, Khristova ML, Sealy TK, Vincent MJ, Erickson BR, Bawiec DA, et al. Marburg virus genomics and association with a large hemorrhagic fever outbreak in Angola. J Virol. 2006;80:6497-516.

(16.) Kumar S, Tamura K, Nei M. MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief Bioinform. 2004;5:150-63.

(17.) Rooney AP. Mechanisms underlying the evolution and maintenance of functionally heterogeneous 18S rRNA genes in apicomplexans. Mol Biol Evol. 2004;21:1704-11.

(18.) Severe falciparum malaria fal·cip·a·rum malaria
n.
Malaria caused by Plasmodium falciparum and characterized by severe malarial paroxysms that recur about every 48 hours and often by acute cerebral, renal, or gastrointestinal manifestations.
. World Health Organization, Communicable Diseases Cluster. Trans R Soc Trop Med Hyg. 2000;94(Suppl 1):S1-90.

(19.) Hutin YJ, Williams RJ, Malfait P, Pebody R, Loparev VN, Ropp SL, et al. Outbreak of human monkeypox, Democratic Republic of Congo, 1996 to 1997. Emerg Infect Dis. 2001;7:434-8.

(20.) Meyer H, Perrichot M, Stemmler M, Emmerich P, Schmitz H, Varaine F, et al. Outbreaks of disease suspected of being due to human monkeypox virus infection in the Democratic Republic of Congo in 2001. J Clin Microbiol. 2002;40:2919-21.

(21.) Outbreak of Ebola haemorrhagic fever in Yambio, south Sudan, April-June 2004. Wkly Epidemiol Rec. 2005;80:370-5.

(22.) Ebola false alarm (imported malaria)--New York, USA. Archive number 19960826.1475. 1997 [cited 2006 Nov 1]. Available from http://www.promedmail.org/

(23.) Malaria, imported, fatal--New York, USA. Archive number 19960830.1492. 1997 [cited 2006 Nov 1]. Available from http://www.promedmail.org

(24.) Newman RD, Parise ME, Barber AM, Steketee RW. Malaria-related deaths among U.S. travelers, 1963-2001. Ann Intern Med. 2004;141:547-55.

(1) These authors contributed equally to this study.

Gustavo Palacios, * (1) Phenix-Lan Quan, * (1) Omar J. Jabado, * Sean Conlan, * David L. Hirschberg, ([dagger]) Yang Liu, ([doubledagger]) Junhui Zhai, * Neil Renwick, * Jeffrey Hui, * Hedi Hegyi, * ([section]) Allen Gro, ([paragraph]) James E. Strong, ([paragraph]) Jonathan S. Towner, # Thomas W. Geisbert, ** Peter B. Jahrling, ([doubledaggers]) Cornelia Buchen-Osmond, * Heinz Ellerbrok, ([doubledagger]) ([doubledagger]) Maria Paz Sanchez-Seco, ([subsection]) Yves Lussier, ([doubledagger]) Pierre Formenty, ([paragraphs]) Stuart T. Nichol, # Heinz Feldmann, ([paragraph]) ## Thomas Briese, * and W. lan Lipkin *

* Columbia University, New York, New York, USA; ([dagger]) Stanford University, Stanford, California, USA; ([doubledagger]) University of Chicago, Chicago, Illinois, USA; ([section]) Institute of Enzymology en·zy·mol·o·gy
n.
The branch of science that deals with the biochemical nature and activity of enzymes.



enzymology

the study of enzymes and enzymatic action.
, Budapest, Hungary; ([paragraph]) Public Health Agency of Canada, Winnipeg, Manitoba, Canada; # Centers for Disease Control and Prevention, Atlanta, Georgia, USA; ** US Army Medical Research Institute of Infectious Diseases, Fort Detrick, Frederick, Maryland, USA; ([doubledagger]) National Institutes of Health Integrated Research Facility, Fort Detrick, Frederick, Maryland, USA; ([doubledagger]) ([doubledagger]) Robert Koch Institut, Berlin, Germany; ([subsection]) Instituto de Salud Carlos III, Madrid, Spain; ([paragraphs]) World Health Organization, Geneva Geneva, canton and city, Switzerland
Geneva (jənē`və), Fr. Genève, canton (1990 pop. 373,019), 109 sq mi (282 sq km), SW Switzerland, surrounding the southwest tip of the Lake of Geneva.
, Switzerland; and ## University of Manitoba Location
The main Fort Garry campus is a complex on the Red River in south Winnipeg. It has an area of 2.74 square kilometres. More than 60 major buildings support the teaching and research programs of the university.
, Winnipeg, Manitoba, Canada

Dr Palacios is an associate research scientist at the Jerome L. and Dawn Greene Infectious Disease Laboratory at the Columbia University Mailman School of Public Health. His research focuses on the molecular epidemiology of viruses, virus interactions with their hosts, and innovative pathogen detection methods.

Address for correspondence: W. Ian Lipkin, Jerome L. and Dawn Greene Infectious Disease Laboratory, Mailman School of Public Health, Columbia University, 722 West 168th St, Rm 1801, New York, NY 10032, USA; email: wil2001@columbia.edu
Table 1. DNA virus isolates from tissue culture samples used to
test GreeneChip performance

Virus                                           Genus

Sealpoxvirus 1 *                                Parapoxvirus
Pseudocowpox virus ([dagger])                   Parapoxvirus
Orf virus ([dagger])                            Parapoxvirus
Cowpox virus ([dagger])                         Orthopoxvirus
Human herpesvirus ([dagger]) *                  Simplexvirus
Gallid herpesvirus 1 ([dagger])                 Iltovirus
Human adenovirus E (HAdV-4) ([double dagger])   Mastadenovirus
Human adenovirus C (HAdV-5) ([double dagger])   Mastadenovirus

* University of Florida, Gainesville, FL, USA.

([dagger]) Commonwealth Scientific and Industrial Research
Organization, Melbourne, Victoria, Australia.

([double dagger]) American Type Culture Collection, Manassas, VA, USA.

Table 2. RNA virus isolates from tissue culture samples used to test
GreeneChip performance

Virus                                                   Genus

Negative-strand virus
  Lake Victoria marburgvirus ([dagger])                 Marburgvirus
  Zaire ebolavirus ([double dagger])                    Ebolavirus
  Sudan ebolavirus ([double dagger])                    Ebolavirus
  Reston ebolavirus ([double dagger])                   Ebolavirus
  Human respiratory syncytial virus A ([section])       Pneumovirus
  Human respiratory syncytial virus B ([section])       Pneumovirus
  Human parainfluenza virus 1 ([section])               Respirovirus
  Human parainfluenza virus 3 ([section])               Respirovirus
  Newcastle disease virusl ([paragraph])                Avulavirus
  Vesicular stomatitis Indiana virusl ([paragraph])     Vesiculovirus
  Bovine ephemeral fever virus ([paragraph])            Ephemerovirus
  Influenza A virus (H5N1) #                            Orthomyxovirus
  Influenza B virus ([section])                         Orthomyxovirus
  Guanarito virus ([double dagger])                     Arenavirus
  Machupo virus ([double dagger])                       Arenavirus
  Junin virus ([double dagger])                         Arenavirus
  Lassa virus strain Josiah ([double dagger])           Arenavirus
  Lassa virus strain Weller ([double dagger])           Arenavirus

Positive-strand virus
  Human enterovirus B (E25) ([section])                 Enterovirus
  Human enterovirus A (HEV71) ([section])               Enterovirus
  Human enterovirus B (E14) ([section])                 Enterovirus
  Human enterovirus B (E30) ([section])                 Enterovirus
  Vesicular exanthema of swine virus ([paragraph])      Vesivirus
  SARS * coronavirus **                                 Coronavirus
  Human coronavirus OC43 ([section])                    Coronavirus
  Human coronavirus 229E ([section])                    Coronavirus
  Dengue virus 1 #                                      Flavivirus
  Dengue virus 2 #                                      Flavivirus
  Dengue virus 3 #                                      Flavivirus
  Dengue virus 4 #                                      Flavivirus
  Yellow fever virus #                                  Flavivirus
  West Nile virus **                                    Flavivirus
  Saint Louis encephalitis virus **                     Flavivirus
  Alfuy virus ([double daggers])                        Flavivirus
  Murray Valley encephalitis virus ([double daggers])   Flavivirus
  Chikungunya virus #                                   Alphavirus
  Sindbis virus ([paragraph])                           Alphavirus

Double-strand virus
  Bluetongue virus ([paragraph])                        Orbivirus
  Epizootic hemorrhagic disease virus-2 ([paragraph])   Orbivirus

* SARS, severe acute respiratory syndrome.

([dagger]) Centers for Disease Control and Prevention, Atlanta,
GA, USA.

([double dagger]) US Army Medical Research Institute of Infectious
Diseases, Fort Detrick, Frederick, MD, USA.

([section]) American Type Culture Collection, Manassas, VA, USA.

([paragraph]) Commonwealth Scientific and Industrial Research
Organization, Melbourne, Victoria, Australia.

# Centro Nacional de Microbiologica, Madrid, Spain.

** Columbia University, New York, NY, USA.

([double daggers]) Curtin Institute of Technology, Perth, Western
Australia, Australia.

Table 3. Clinical samples used to test GreeneChip performance

Pathogen                              Genus            Sample

SARS * coronavirus                    Coronavirus      Lung
Human respiratory syncytial virus A   Pneumovirus      Nasopharyngeal
Human enterovirus A (CAV10)           Enterovirus      Nasopharyngeal
Lake Victoria marburgvirus            Marburgvirus     Blood
Influenza A virus (H1N1)              Orthomyxovirus   Nasopharyngeal
Klebsiella pneumoniae ([dagger])      Klebsiella       Urine
Escherichia coli ([dagger])           Escherichia      Urine
Mycobacterium tuberculosis            Mycobacterium    Lung
  ([double dagger])
Mycobacterium tuberculosis            Mycobacterium    Endometrial
  ([double dagger])                                    biopsy
Lactobacillus sp. ([section])         Lactobacillus    Urine

* SARS, severe acute respiratory syndrome.

([dagger]) Detected on the array as a gammaproteobacterium.

([double dagger]) Detected on the array as a mycobacterium.

([section]) Detected on the array as a lactobacillus.

Table 4. GreeneChip sensitivity for detection of various
infectious agents *

Agent                         Genus            Origin ([double dagger])

Human adenovirus E            Mastadenovirus   ATCC VR-1572
Human adenovirus C            Mastadenovirus   ATCC VR-5
Human respiratory syncytial   Pneumovirus      ATCC VR-26
  virus A
West Nile virus               Flavivirus       GIDL
Saint Louis encephalitis      Flavivirus       GIDL
  virus
SARS ([double]) coronavirus   Coronavirus      GIDL
Human enterovirus B           Enterovirus      ATCC VR-184
Influenza A virus H1N1        Orthomyxovirus   MSSM

Agent                         Strain              Sensitivity

Human adenovirus E            HAdV-4 RI-67        1.1 x [10.sup.4]
Human adenovirus C            HAdV-5 Adenoid 75   3.2 x [10.sup.4]
Human respiratory syncytial   Long                1.0 x [10.sup.4]
  virus A
West Nile virus               NY 99               1.9 x [10.sup.3]
Saint Louis encephalitis      Parton              3.0 x [10.sup.3]
  virus
SARS ([double]) coronavirus   Tor2                4.7 x [10.sup.3]
Human enterovirus B           CBV4 strain JVB     5.2 x [10.sup.3]
Influenza A virus H1N1        A/New Caledonia/    9.8 x [10.sup.3]
                              20/1999

* Viral RNA extracted from infected cell supernatants was quantitated
by real-time PCR, serially diluted, and subjected to GreeneChip
analysis by using template concentrations ranging from [10.sup.6] to
[10.sup.1] copies/assay. The threshold level of sensitivity for each
virus tested is indicated.

([dagger]) SARS, severe acute respiratory syndrome.

([double dagger]) ATTCC, American Type Culture Collection; GIDL,
Jerome L. and Dawn Greene Infectious Disease Laboratory, Columbia
University, New York, NY, USA.; MSSM, Mount Sinai School of Medicine,
New York, NY, USA.

Table 5. Sequences of Plasmodium-reactive probes used to predict
presence of plasmodia in blood sample Angola-460

Probe          Sequences (5' [right arrow] 3')   Z score

Eu_5820_309    CGATTAATAGGAGTAGCTTGGGGGCATTTG     3.699
               TATTCAGATGTCAGAGGTGAAATTCTTAGA
Eu_5820_328    AGGGAGTGAAGACGCTCAGATACCGTCGTA     3.685
               ATCTTAACCATAAACTATGCCGACTAGGCT
Eu_5820_322    ATAGGAGTAGCTTGGGGGCATTTGTATTCA     3.681
               GATGTCAGAGGTGAAATTCTTAGATTTTCT
Eu_5820_282    TTGTAATTGGAATGGTGGGAATTTAAAACC     3.672
               TTCCCAGAGTAACAATTGGAGGGCAAGTCT
Eu_5820_269    GCGTAAATTACCCAATTCTAAAGAAGAGAG     3.624
               GTAGTGACAAGAAATAACAATGCAAGGCCA
Eu_5820_296    TTAATAGGAGTAGCTTGGGGGCATTTGTAT     3.563
               TCAGATGTCAGAGGTGAAATTCTTAGATTT
Eu_44417_518   ATCGTGATGGGGATAGATTATTGCAATTAT     3.558
               TAATCTTCAACGAGGAATGCCTAGTAGGCG
Eu_5820_277    AACTGCGAAAGCATTTGCCTAAAATACTTC     3.542
               CATTAATCAAGAACGAAAGTTAAGGGAGTG
Eu_44417_516   GCATCGTGATGGGGATAGATTATTGCAATT     3.539
               ATTAATCTTCAACGAGGAATGCCTAGTAGG
Eu_5820_325    CTTAGTTACGATTAATAGGAGTAGCTTGGG     3.515
               GGCATTTGTATTCAGATGTCAGAGGTGAAA
Eu_5820_298    GCAATTATTAATCTTGAACGAGGAATGCCT     3.507
               AGTAAGCATGATTCATCAGATTGTGCTGAC
Eu_5820_285    ATCGTCTTCACTCCCTTAACTTTCGTTCTT     3.432
               GATTAATGGAAGTATTTTAGGCAAATGCTT
Eu_5820_286    CTAACACAAGGAAGTTTAAGGCAACAACAG     3.407
               GTCTGTGATGTCCTTAGATGAACTAGGCTG
Eu_5820_311    GTCTAACACAAGGAAGTTTAAGGCAACAAC     3.347
               AGGTCTGTGATGTCCTTAGATGAACTAGGC
Eu_5820_318    AATTATTAATCTTGAACGAGGAATGCCTAG     3.290
               TAGCATGATTCATCAGATTGTGCTGACTAC
Eu_5820_281    AAGTTTAAGGCAACAACAGGTCTGTGATGT     3.282
               CCTTAGATGAACTAGGCTGCACGCGTGCTA
Eu_5820_299    TCGATAACGAACGAGATCTTAACCTGCTAA     3.256
               TTAGCGGTAAATACAACATATTCTTAAGTA
Eu_5820_308    TGATTGTAAAGCTTCTTAGAGGAACATTGT     3.255
               GTGTCTAACACAAGGAAGTTTAAGGCAACA
Eu_5820_324    AGTTTAAGGCAACAACAGGTCTGTGATGTC     3.151
               CTTAGATGAACTAGGCTGCACGCGTGCTAC
Eu_5820_275    TGATTGTAAAGCTTCTTAGAGGGACATTGT     3.030
               GTGTCTAACACAAGGAAGTTTAAGGCAACA
Eu_5820_301    CCCTGTTCTACTATAATTTGTTTTTTTTAC     2.834
               TCTATTTCTCTCTTCTTTTAAGAATGTACT

Table 6. Fragments of Plasmodium falciparum sequence recovered after
GreeneChip hybridization of blood sample Angola-460

Clone   Position in     Size,   BLAST similarity
        the genome *    nt

B06     286692-286986   295     100% P. falciparum, 98% P. reichenowi
D09     289685-289784   100     99% P. falciparum, 95% P. berghei
C01     291256-291624   369     100% P. falciparum, 98% P. berghei
A09     291521-291631   111     100% P. falciparum, 98% P. berghei
A08     291521-291614   94      100% P. falciparum, 98% P. berghei
H10     291521-291616   96      100% P. falciparum, 98% P. berghei
G02     291601-291637   37      100% P. falciparum
A01     291939-292088   150     100% P. falciparum, 98% P. berghei
J01     292039-292364   326     100% P. falciparum, 98% P. berghei

* Corresponds to GenBank accession no. AL929354 (P. falciparum strain
3D7, chromosome 5, segment 4/4, rRNA).
COPYRIGHT 2007 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2007, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Author:Lipkin, W. Ian
Publication:Emerging Infectious Diseases
Geographic Code:1CANA
Date:Jan 1, 2007
Words:5685
Previous Article:Primary Pneumocystis infection in infants hospitalized with acute respiratory tract infection.(RESEARCH)
Next Article:Subtypes of Cryptosporidium parvum in humans and disease risk.(RESEARCH)
Topics:



Related Articles
Falciparum Malaria in European Tourists to the Dominican Republic.
Molecular Approaches to Diagnosing and Managing Infectious Diseases: Practicality and Costs.(Statistical Data Included)
Evaluating detection and diagnostic decision support systems for bioterrorism response.(Research)
DXS AND SANGTEC SIGN SCORPIONS TECHNOLOGY LICENSE PACT.
Upcoming infectious disease activities.(News & Notes)(Calendar)
Notifiable disease surveillance and practicing physicians.(Policy Review)
Early detection of disease outbreaks.(Products & Services)
Canine and Feline Infectious Diseases and Parasitology.(Brief article)(Book review)
A rare cause of rhabdomyolysis.(Letters to the Editor)
CDC's Division of Vector-Borne Infectious Diseases.(Environmental Health-'Net)(Center for Disease Control and Prevention)(Brief article)

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles