Printer Friendly
The Free Library
14,715,713 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

PCR versus hybridization for detecting virulence genes of enterohemorrhagic Escherichia coli.


We compared PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
 amplification of 9 enterohemorrhagic Escherichia coli enterohemorrhagic Escherichia coli EHEC Any of the E coli serotypes–eg O29, O39, O145 that produces shiga-like toxins, causing bloody inflammatory diarrhea, evoking a HUS. See Escherichia coli O157:H7, Hemolytic uremic syndrome.  virulence factors among 40 isolates (21 O/H O/H Overhead
O/H On Hand
 antigenicity classes) with DNA hybridization DNA hybridization Molecular medicine A technique for determining the presence of a target DNA in a sample of tissue or cells. See HLA analysis, Paternity testing, RFLP analysis. . Both methods showed 100% of the chromosomal and phage phage: see bacteriophage.

phage - A program that modifies other programs or databases in unauthorised ways; especially one that propagates a virus or Trojan horse. See also worm, mockingbird. The analogy, of course, is with phage viruses in biology.
 genes: eae, stx, and stx2. PCR did not detect 4%-20% of hybridizable Hy´brid`i`za`ble

a. 1. Capable of forming a hybrid, or of being subjected to a hybridizing process; capable of producing a hybrid by union with another species or stock.
 plasmid genes: hlyA, katP, espP, toxB, open reading frame (ORF) 1 and and ORF2.

**********

Enterohemorrhagic Escherichia coli (EHEC EHEC

enterohemorrhagic Escherichia coli.

EHEC Enterohemorrhagic Escherichia coli, see there
) pathogenicity is usually linked to a Shiga toxin (1,2) and virulence factors, including adhesins, toxins, invasins, protein secretion systems, iron uptake systems, and several unidentified functions (3,4), which are unrelated to strain phylogeny. In many laboratories, sorbitol-MacConkey medium is commonly used to screen for the slow sorbitol sorbitol /sor·bi·tol/ (sor´bi-tol) a six-carbon sugar alcohol from a variety of fruits, found in lens deposits in diabetes mellitus.  fermentation phenotype of the most common Shiga toxin containing strain: O157:H7 (5), but this process does not address the pathogenic potential of the remaining sorbitol-positive E. coli E. coli: see Escherichia coli.
E. coli
 in full Escherichia coli

Species of bacterium that inhabits the stomach and intestines. E. coli can be transmitted by water, milk, food, or flies and other insects.
. These organisms can be detected by immunologic methods or PCR evaluation of virulence factors. PCR is the most useful method for virulence factor detection, and others have made convincing arguments for its use in characterizing the virulence factor patterns of potential pathogens (6,7).

Variation in virulence factor targets and use of different PCR primers contribute to variable results in detecting the most common virulence factors: stx1, stx2, eae, and hlyA (or ehxA). Variation in amplification success is likely to increase because more virulence factor variants are certain to emerge as more EHEC and Shiga toxin-producing E. coli (STEC STEC

shiga toxin-producing Escherichia coli.
) strains are identified. This study addresses the potential for a broad and well-characterized set of control strains relative to virulence factor amplification and confirmed by Southern hybridization hybridization /hy·brid·iza·tion/ (hi?brid-i-za´shun)
1. crossbreeding; the act or process of producing hybrids.

2. molecular hybridization

3.
.

The Study

We used PCR amplification and Southern blot hybridization Southern blot hybridization Southern blotting Molecular biology A method delineated by EM Southern for detecting and manipulating specific DNA sequences previously separated by gel electrophoresis.  to detect 9 virulence factors among 40 EHEC type-strains from the STEC Center, National Food Safety and Toxicology Center, Michigan State University Michigan State University, at East Lansing; land-grant and state supported; coeducational; chartered 1855. It opened in 1857 as Michigan Agricultural College, the first state agricultural college.  (East Lansing, MI, USA). The virulence factor targets were the following: 1 chromosomal (eae [8]), 2 phage (stxl and 2), and 6 plasmid (open reading frame [ORF] 1, ORF2 of pOSAK1 [1,2]; espP [9], hlyA [4,10], katP [11], and tox B [12] of pO157) (Table). DNA-DNA hybridization probes were made from virulence factors amplified from O157:H7 EDL See nonlinear video editing.

(language) EDL -

1. Experiment Description Language.

2. Event Description Language.
933 genomic DNA.

PCR amplification was carried out with PCR primers (20 pmol/L each per 50 [micro]L reaction) (Integrated DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 Technologies, Coralville, IA, USA) (Table) and 1 [micro]L genomic DNA (extracted from overnight Luria-Bertani broth cultures according to PureGene DNA isolation kit instructions [Gentra Systems, Minneapolis, MN, USA] and dissolved in 50 [micro]L 10 mmol/L Tris, pH 8.3) in a PCR cocktail containing 1x PCR buffer, 1.5 mmol/L Mg[Cl.sub.2], 1 U Vent exo(-) polymerase from New England BioLabs New England Biolabs (NEB) produces and supplies reagents for the life science industry. NEB offers a large selection of recombinant and native enzymes for genomic research. It also offers products in the areas related to proteomics and drug discovery.  (Beverly, MA, USA), and 200 [micro]mol/L each dATP, dGTP, dTTP, and dCTP. The mix was incubated for 30 cycles of 94[degrees]C, 40 s; annealing annealing (ənēl`ĭng), process in which glass, metals, and other materials are treated to render them less brittle and more workable.  (for temperatures, see Table), 45 s; 72[degrees]C, 60 s, and a final 10-rain extension at 72[degrees]C. Amplification products were confirmed by DNA sequencing.

(32) P-labeled DNA probes were made from 2 [micro]g PCR amplicons (purified by Montage PCR Cleanup Spin Column (Milipore Corp., Burlington, MA, USA). The DNA was denatured de·na·ture  
tr.v. de·na·tured, de·na·tur·ing, de·na·tures
1. To change the nature or natural qualities of.

2.
 at 94[degrees]C, 40 sec; annealed (temperatures in Table) with 50 pmol/L of the appropriate PCR primers, 45 s extended for 2 h at 72[degrees]C. The 1x buffer contained the following: 1.5 mmol/L Mg[Cl.sub.2] 0.4 mmol/L each dATP, dGTP, dTTP; 2.0 [micro]L 3,000 Ci/mmol [alpha]-[sup.32]P-dCTP (MP Bioscience, Buxton, UK); and 1.25 U Taq polymerase in a 50. [micro]L final volume. Unincorporated [sup.32P]-nucleotide was removed by Sephadex G-50 in Tris-EDTA, 1% sodium dodecyl sulfate Sodium dodecyl sulfate (or sulphate) (SDS or NaDS) (C12H25NaO4S),is an anionic surfactant that is used in household products such as toothpastes, shampoos, shaving foams and bubble baths for its thickening effect and its ability to  (SDS 1. (company) SDS - Scientific Data Systems.
2. (tool) SDS - Schema Definition Set.
).

Bacteria (800 [micro]L overnight cultures) were transferred to Hybond-N+ nitrocellulose nitrocellulose, nitric acid ester of cellulose (a glucose polymer). It is usually formed by the action of a mixture of nitric and sulfuric acids on purified cotton or wood pulp.  membrane (Amersham Biosciences UK Ltd, Buckinghamshire, UK) by dot-blot vacuum filtration apparatus (Schleicher and Schuell, Keene, NH, USA). Lysis lysis /ly·sis/ (li´sis)
1. destruction or decomposition, as of a cell or other substance, under influence of a specific agent.

2. mobilization of an organ by division of restraining adhesions.

3.
 and binding of genomic DNA fixation were carried out by exposure to lysis solution (1.5 mol/L NaC1, 0.5 mol/L NaOH) twice for 5 min each, and twice with neutralization neutralization, chemical reaction, according to the Arrhenius theory of acids and bases, in which a water solution of acid is mixed with a water solution of base to form a salt and water; this reaction is complete only if the resulting solution has neither acidic nor  solution (1 mol/L Tris-C1, pH 7.4; 1.5 mol/L NaC1) for 5 min each. The filter was then submerged in 2x SSC SSC Secondary School Certificate
SSC Standard Systems Center (USAF)
SSC State Services Commission (New Zealand)
SSC Swedish Space Corporation
SSC Salem State College (Massachusetts) 
 with gentle agitation, air dried, and the DNA UV (254 nm) cross-linked at 120,000J/cm2 (CL-1000 cross-linker, Fisher Biotech, Pittsburgh, PA, USA).

Probe hybridization was carried out in rotating hybridization bottles (Fisher Scientific lsotemp hybridization oven, Fisher Biotech) in 20 mL 6x SSC, 1% SDS at 68[degrees]C. Membranes were washed twice, for 1 min, in room temperature 2x SSC, 0.1% SDS, and twice at 45[degrees]C for 1 h in 1x SSC, 1% SDS. Hybridized membranes were exposed overnight with a phospho-imaging screen (Bio-Rad, Hercules, CA, USA) and visualized with a Personal Molecular Imager FX (Bio-Rad). The 3 chromosomal targets (stxl, stx2, and eae) were detected with 100% efficiency by both PCR and hybridization (no. positive by PCR/no. positive by hybridization): 21/21 stxI, 19/19 stxlI, and 37/37 eae. Plasmid-associated genes, however, were detected with less efficiency relative to hybridization: katP: 15/17 (88%), hlyA: 26/27 (96%), espP: 19/23 (83%), toxB: 13/16 (81%), and both ORF1 and ORF2: 4/5 (80%) (online Appendix Table, available from http://www.cdc.gov/EID/ content/13/8/1253-appT.htm).

Seventy-five percent (30/40) of the pathogenic E. coli strains tested contained at least 1 stx gene, 23% (9/40) were positive for both stx1 and stx2. The most common gene detected was intimin (eae), which was positive by both PCR and hybridization in 37/40 (93%) of the strains. While eae is strongly correlated with Shiga toxin, the adherence phenotype conveyed may be sufficient to cause a pathogenic state because 4 of the clinical isolates investigated contained only the eae gene.

Six plasmid virulence factor genes of pO157 and pOSAK1 were targeted. Thirty-one (78%) of the 40 pathogenic strains tested were positive for at least 1 (by hybridization, PCR, or both) of the 4 genes, toxB, katP, hlyA, espP, which are usually carried on the archetypal ar·che·type  
n.
1. An original model or type after which other similar things are patterned; a prototype: "'Frankenstein' . . . 'Dracula' . . . 'Dr. Jekyll and Mr. Hyde' . . .
 pO157 plasmid: 11/31 (35%) retained all 4, 4/31 (13%) carried three, 9/31 (29%) carried 2, and 5/31 (16%) carried only 1 (the sole PCR-positive/hybridization- negative isolate [espP in ED-31] was presumed to result from a nonspecific nonspecific /non·spe·cif·ic/ (non?spi-sif´ik)
1. not due to any single known cause.

2. not directed against a particular agent, but rather having a general effect.


nonspecific

1.
 amplification).

Five EHEC strains (13%) hybridized to both ORF1 and ORF2 (from pOSAK1) (1,4), but only 4 were amplifiable. These same 4 also contained eae and at least 1 Shiga toxin gene (the 1 that failed to amplify [E851/71] lacked both stx1 and stx2).

Conclusions

The current accepted standard for EHEC identification is amplification of stx1, stx2, eae, and hlyA by PCR. However, this technology is generally only available at large hospital or state health laboratories. Hybridization is superior to culture screening methods and largely complimentary to PCR, but has a potentially broader epidemiologic application since it is unaffected by minor sequence variations that can completely inhibit PCR. Only 3% of the 360 virulence factor hybridizations made in this study did not amplify. PCR failure is expected with its relatively higher sensitivity to single base primer-hybrid mismatch compared to whole amplicon hybridization. Notably, however, all 12 variations detected were among plasmid-associated virulence factors: 95% (228/240) of the plasmid hybridizable targets were amplified, compared to 100% (120/120) of the hybridizable chromosomal targets.

Although we detected the variable presence of genes ostensibly associated with 2 plasmids (pO157 and pOSAK1) and the bacterial chromosome, we did not attempt to verify either plasmid or chromosomal locations for any of the amplicons or DNA:DNA hybrids. While all virulence factor targets summarized in this study are subject to change there have been reports of any of the putative chromosomal or plasmid virulence factor targets in this study being found elsewhere.

Prager et al. (7) recently reported, using PCR alone, a wide variety of 25 virulence factor combinations among 266 pathogenic E. coli isolates representing 81 serotypes. Such diversity speaks directly to the need to accurately assess virulence factor presence to evaluate epidemiologic and clinical correlations. A similar 5% failure of the plasmid-associated virulence factor amplifications could have implications in such virulence factor correlations. Overall, however, these results are very similar to those of this study of prospective control strains. The use of a single control, such as EDL 933, will inherently bias PCR detection schemes since a failure of amplification in a test will be read as the absence of virulence factor element because it was amplifiable in the control.

If amplification failure is a measure of template variation, we find a much greater variability among plasmid-associated virulence factors. Although pO157 has been reported in most O157 H7 strains (13), our study demonstrates a high variability in the putative virulence factor content of pO157 as well as a highly variable content of pO157-associated virulence factors among the O157 isolates screened. Finally, pO157-associated virulence factors were detected among all but 4 of the 20 E. coli serotypes examined.

This study was partially supported by National Institutes of Health grant P20 RR016454 from the Infrastructure Network of Biomedical Research Excellence Program of the National Center for Research Resources The National Center for Research Resources or NCRR, is a United States government agency. NCRR provides funding to laboratory scientists and researchers for facilities and tools in the goal of curing and treating diseases. , an infrastructure research grant from the Office of Research, Idaho State University Enrollment for fall semester 2006 was 12,676 students, including 8,848 undergraduates.[1] ISU enrolls a large number of older, non-traditional students who live and work off-campus. , and grant no. F04-107 from the Graduate Student Research and Scholarship Committee, Idaho State University.

References

(1.) Nataro JP, Kaper JB. Diarrheagenic Escherichia coli Escherichia coli (ĕsh'ərĭk`ēə kō`lī), common bacterium that normally inhabits the intestinal tracts of humans and animals, but can cause infection in other parts of the body, especially the urinary tract. . Clin Microbiol Rev. 1998;11:142-201.

(2.) Makino S, Tobe T, Asakura H, Watarai M, Ikeda T, Takeshi K, et al. Distribution of the secondary type III secretion system locus found in enterohemorrhagic Escherichia coli O157:H7 isolates among Shiga toxin-producing E. coli strains. J Clin Microbiol. 2003;41:2341-7.

(3.) Hacker J, Kaper JB. Pathogenicity islands and the evolution of microbes. Annu Rev MicrobioI. 2000;54:641-79.

(4.) Burland V, Shao Y, Perna NT, Plunkett G. Sofia HJBlattner FR. The complete DNA sequence DNA sequence Genetics The precise order of bases–A,T,G,C–in a segment of DNA, gene, chromosome, or an entire genome. See Base pair, Base sequence analysis, Chromosome, Gene, Genome.  and analysis of the large virulence plasmid of Escherichia coli O157:H7. Nucleic Acids Nucleic acids
The cellular molecules DNA and RNA that act as coded instructions for the production of proteins and are copied for transmission of inherited traits.
 Res. 1998;26:4196-204.

(5.) Farmer JJ 3rd, Davis BR. H7 antiserum-sorbitol fermentation medium: a single tube screening medium for detecting Escherichia coli O157:H7 associated with hemorrhagic colitis hemorrhagic colitis
n.
Abdominal cramps and bloody diarrhea, without fever, attributed to a self-limited infection by a strain of Escherichia coli.
. J Clin Microbiol. 1985;22:620-5.

(6.) Osek J. Development of a multiplex PCR approach for the identification of Shiga toxin-producing Escherichia coli strains and their major virulence factor genes. J Appl Microbiol. 2003;95:1217-25.

(7.) Prager R. Annemuller S, Tschape H. Diversity of virulence patterns among Shiga toxin-producing Escherichia coli from human clinical cases-need for more detailed diagnostics, lnt J Med Microbiol. 2005;295:29-38.

(8.) Blanco JE, Blanco M, Blanco J, Mora MORA, In civil law. This term, in mora, is used to denote that a party to a contract, who is obliged to do anything, has neglected to perform it, and is in default. Story on Bailm. Sec. 123, 259; Jones on Bailm. 70; Poth. Pret a Usage, c. 2, Sec. 2, art. 2, n.  A, Balaguer L, Mourino M, et al. O serogroups, biotypes, and eae genes in Escherichia coli strains isolated from diarrheic and healthy rabbits. J Clin Microbiol. 1996;34:3101-7.

(9.) Brunder W, Schmidt H. Frosch M, Karch H. The large plasmids of Shiga-toxin-producing Escherichia coli (STEC) are highly variable genetic elements. Microbiology. 1999; 145:1005-14.

(10.) Makino K, Ishii K, Yasunaga T, Hattori M, Yokoyama K, Yutsudo CH, et al. Complete nucleotide sequences of 93-kb and 3.3-kb plasmids of an enterohemorrhagic Escherichia coli O157:H7 derived from Sakai outbreak. DNA Res. 1998;5:1-9.

(11.) Brunder W. Schmidt H, Karch H. KatP, a novel catalase-peroxidase encoded by the large plasmid of enterohaemorrhagic Escherichia coli O157:H7. Microbiology. 1996;142:3305-15.

(12.) Tatsuno I, Horie M, Abe H, Miki T, Makino K, Shinagawa H, et al. toxB gene on pO157 of enterohemorrhagic Escherichia coli O157: H7 is required for full epithelial cell adherence phenotype. Infect Immun. 2001;69:6660-9.

(13.) Schmidt H. Beutin L, Karch H. Molecular analysis of the plasmid-encoded hemolysin hemolysin /he·mol·y·sin/ (he-mol´i-sin) a substance that liberates hemoglobin from erythrocytes by interrupting their structural integrity.

he·mol·y·sin
n.
 of Escherichia coli O157:H7 strain EDL 933. Infect Immun. 1995;63:1055-61.

(14.) Franke J, Franke S, Schmidt H, Schwarzkopf A, Wieler LH, Baljer G, et al. Nucleotide sequence analysis of enteropathogenic enteropathogenic

having pathogenicity for the intestine.


enteropathogenic Escherichia coli
strains of E. coli which cause enteritis by close association with enteric cells. Includes attaching and effacing E. coli.
 Escherichia coli (EPEC EPEC

enteropathogenic Escherichia coli.

EPEC Enteropathic Escherichia coli, see there
) adherence factor probe and development of PCR for rapid detection of EPEC harboring virulence plasmids. J Clin Microbiol. 1994;32:2460-3.

(15.) Wieler LH, Vieler E, Erpenstein C, Schlapp T, Steinruck H, Bauerfeind R, et al. Shiga toxin-producing Escheriehia coli strains from bovines: association of adhesion with carriage of eae and other genes. J Clin Microbiol. 1996;34:2980-4.

Address for correspondence: Malcolm S. Shields, Department of Biological Sciences, Idaho State University, Pocatello, ID, 83209 USA; email: shiemalc@isu.edu

Mr Gerrish completed this work as part of his master's thesis at Idaho State University. He is currently a doctoral candidate in microbial microbial

pertaining to or emanating from a microbe.


microbial digestion
the breakdown of organic material, especially feedstuffs, by microbial organisms.
 pathogenesis at the State University of New York (body) State University of New York - (SUNY) The public university system of New York State, USA, with campuses throughout the state.  at Buffalo.

Robert S. Gerrish, * James E. Lee, * June Reed, * Joel Williams, * Larry D. Farrell, * Kathleen M. Spiegel, * Peter P. Sheridan, * and Malcolm S. Shields*

* Idaho State University, Pocatello, Idaho, USA
Table. Virulence factor taroets and primers, including
nucleotide sequences, reference, and PCR conditions *

Primer    Nucleotide sequence          Target (bp)          Ref.
name      (5' [right arrow] 3')

STX1 U    GTAACATCGCTCTTGCCACA       Stx1 gene (204)        This
STX1 D    CGCTTTGCTGATTTTTCACA                             study
STX2U     GTTCCGGAATGCAAATCAGT       Stx2 gene (206)        This
STX2D     CGGCGTCATCGTATACACAG                             study
eae-1     ACGTTGCAGCATGGGTAACTC       Intimin (818)          -8
eae-2     GATCGGCAACAGTTTCACCTG
ToxBF     TGGCCTTGCGCTCTATAAGAACCT     ToxB (823)           This
ToxBR     ACCACGCCGTGAGAATAATGTCCA                         study
HIyAlF    GGTGCAGCAGAAAAAGTTGTAG       HIyA (1551)          -13
HIyA1R    TCTCGCCTGATAGTGTTTGGTA
EspPF     CGGCAGAGTATCATCAAGAGC        EspP (397)           This
EspPR     CATTAAATGGAGTTATGCGTC                            study
KatPF     TTTAAAACGCTGGGATTTGC         KatP (1174)          This
KatPR     CTCCTGAGAGGCGTCAGTTC                             study
MaIBU     GACCTCGGTTTAGTTCACAGA       MalB promoter         This
MalBDn    AGCGCGTAGGACTGAAACACCATA        -414             study
ORF1F     TTTTTCAAAGCAAATGATGTGG          ORF 1             This
ORF1R     GGCGTAGCTAGGTTGAAATTATG     pOSAK1 (385)         study
ORF2F     CAA CCTAGCTACGCCACCAT           ORF 2             This
ORF2R     CATCAGGCGGAAATACCACT        pOSAK1 (869)         study
EAR       CAGGGTAAAAGAAAGATGATAA        Eaf (397)           -14
EAF2      TATGGGGACCATGTATTATCA
BFP1      GATTGAATCTGCAATGGC            Bfp (597)           -15
BFP2      GGATTACTGTCCTCACATAT

Primer                         PCR conditions
name              Denature           Anneal            Extension

STX1 U      95[degrees]C, 60 s      53.7[degrees]    72[degrees]
                                     C, 60 s           C, 240 s
STX1 D
STX2U       95[degrees]C, 60 s      53.7[degrees]    72[degrees]
                                     C, 60 s           C, 240 s
STX2D
eae-1       95[degrees]C, 60 s      57.1[degrees]    72[degrees]
                                     C, 60 s           C, 240 s
eae-2
ToxBF       95[degrees]C, 60 s      60[degrees]      72[degrees]
                                     C, 60 s           C, 240 s
ToxBR
HIyAlF      95[degrees]C, 60 s      55.5[degrees]    72[degrees]
                                     C, 60 s           C, 240 s
HIyA1R
EspPF       95[degrees]C, 60 s      55.5[degrees]    72[degrees]
                                     C, 60 s           C, 240 s
EspPR
KatPF       95[degrees]C, 60 s      52.0[degrees]    72[degrees]
                                     C, 60 s           C, 240 s
KatPR
MaIBU       95[degrees]C, 60 s      55.8[degrees]    72[degrees]
                                     C, 60 s           C, 240 s
MalBDn
ORF1F       95[degrees]C, 60 s      49.8[degrees]    72[degrees]
                                     C, 60 s           C, 240 s
ORF1R
ORF2F       95[degrees]C, 60 s      54.3[degrees]    72[degrees]
                                     C, 60 s           C, 240 s
ORF2R
EAR         95[degrees]C, 60 s      49.8[degrees]    72[degrees]
                                     C, 60 s           C, 240 s
EAF2
BFP1        95[degrees]C, 60 s      51.6[degrees]    72[degrees]
                                     C, 60 s           C, 240 s
BFP2

* Ref., reference; ORF, open reading frame.
COPYRIGHT 2007 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2007, Gale Group. All rights reserved.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:DISPATCHES
Author:Gerrish, Robert S.; Lee, James E.; Reed, June; Williams, Joel; Farrell, Larry D.; Spiegel, Kathleen
Publication:Emerging Infectious Diseases
Date:Aug 1, 2007
Words:2486
Previous Article:Streptococcus sinensis endocarditis outside Hong Kong.(DISPATCHES)(Disease/Disorder overview)
Next Article:Multidrug-resistant bacteria in southeastern Austria.(LETTERS)(Letter to the editor)
Topics:



Related Articles
Prevalence of Non-O157:H7 Shiga Toxin-Producing Escherichia coli in Diarrheal Stool Samples from Nebraska.
Rapid emergence of ciprofloxacin-resistant enterobacteriaceae containing multiple gentamicin resistance-associated integrons in a Dutch hospital....
Prevalence and genetic profiling of virulence determinants of non-O157 Shiga toxin-producing Escherichia coli isolated from cattle, beef, and humans,...
Enteropathogenic Escherichia coli O157 strains from Brazil. (Dispatches).
Isolation of Escherichia coli O157:H7 from intact colon fecal samples of swine (1). (Dispatches).
Human Escherichia coli O157:H7 genetic marker in isolates of bovine origin.(Dispatches)
Emerging enteropathogenic Escherichia coli strains?(Dispatches)
Genetic background of Escherichia coli and extended-spectrum [beta]-lactamase type.(Research)
Drug-resistant diarrheogenic Escherichia coli, Mexico.(DISPATCHES)
Fluoroquinolone-resistant escherichia coli, Indonesia.(RESEARCH)

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles