Oropouche virus isolation, Southeast Brazil.An Oropouche virus strain was isolated from a novel host (Callithrix sp.) in Arinos, Minas Gerais State, southeastern Brazil. The virus was identified by complement fixation test Noun 1. complement fixation test - a blood test in which a sample of serum is exposed to a particular antigen and complement in order to determine whether or not antibodies to that particular antigen are present; used as a diagnostic test and confirmed by reverse transcription--polymerase chain reaction. Phylogenetic analysis identified this strain as a genotype III isolate previously recognized only in Panama. ********** Oropouche virus (OROV) is one of the most important arthropodborne orthobunyaviruses (Bunyaviridae, Orthobunyavirus) (1) that infect humans; it causes an acute febrile illness acute febrile illness A nonspecific term for an illness of sudden onset accompanied by fever called Oropouche fever (2). OROV was originally reported in Trinidad in 1955, when the prototype virus strain was isolated from the blood of a febrile patient and from a pool of Coquillettidia venezuelensis mosquitoes (3). In Brazil, OROV was initially described in 1960, when it was isolated from a sloth (Bradypus tridactylus) captured near a forest area during the construction of the Belem-Brasilia highway, and from a pool of Ochlerotatus serratus mosquitoes captured nearby (4). More than one-half million persons have been infected with OROV, which makes this virus a public health threat in tropical and subtropical areas of Central and South America (5). OROV genome consists of 3 partite par·tite adj. Divided into parts. [Latin part tus, past participle of part , single-stranded, negative-sense RNAs,
named large (L), medium (M), and small (S) RNA RNA: see nucleic acid. RNA in full ribonucleic acid One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic . These RNAs are predicted to encode a large protein (L: polymerase activity), viral surface glycoproteins (Gc and Gn), and nonstructural NSM protein, as well as both nucleocapsid nucleocapsid /nu·cleo·cap·sid/ (noo?kle-o-kap´sid) a unit of viral structure, consisting of a capsid with the enclosed nucleic acid. nu·cle·o·cap·sid n. (N) and NSS proteins (1). Complete nucleotide sequences have been determined for all 3 RNA segments (6-8), and previous studies of the molecular biology of the N gene (SRNA) of 28 different OROV strains indicated the existence of 3 genotypes, designated I, II, and III (6). The Study A field study was conducted in the Arinos region, Minas Gerais State, within the Grande Sertao Veredas National Park, in February 2000. The park is located 90 km from Arinos city (15[degrees]54'S, 46[degrees]W) (Figure 1). The Arinos region is part of the epizootic ep·i·zo·ot·ic adj. Affecting a large number of animals at the same time within a particular region or geographic area. Used of a disease. ep area of sylvatic sylvatic /syl·vat·ic/ (sil-vat´ik) sylvan; pertaining to, located in, or living in the woods. sylvatic found in the woods; occurring in animals of the forest. yellow fever virus yellow fever virus n. An arbovirus of the genus Flavivirus that causes yellow fever and is transmitted by mosquitoes. transmission, as previously reported (9). [FIGURE 1 OMITTED] Using a biosafety cabinet class II B-2, we prepared suspensions of viscera viscera /vis·ce·ra/ (vis´er-ah) plural of viscus. vis·cer·a pl.n. 1. The soft internal organs of the body, especially those contained within the abdominal and thoracic cavities. (liver, spleen, and kidney) obtained from the monkey and then injected suckling mice by the intracerebral in·tra·cer·e·bral adj. Existing within the cerebrum. route. Animals were observed daily and were immediately collected when they died or showed signs of disease. The virus was identified by using the complement fixation test (CF), performed according to a described technique (10). The BeAn 626990 antigen was tested against different mice immune ascitic fluids (MIAFs) prepared for a large number of arboviruses arboviruses (ar´bōvī´r n. circulating in Brazil. Molecular studies were conducted to confirm the serologic results. Viral RNA was extracted by using the Trizol reagent (Invitrogen, Carlsbad, CA, USA) technique as described elsewhere, and the entire SRNA segment was amplified, applying a 1-step reverse transcription--polymerase chain reaction (RT-PCR RT-PCR reverse transcriptase-polymerase chain reaction. See PCR1. ) assay using the primers ORO N5 (5' AAAGAGGATCCAATAATGTCAGAGTT CATTT CATTT Contrast, Analogy, Theory, Target, Tale (methodology of a discourse) CATTT Creating Alternative Thinking Through Theatre 3'), ORO N3 (5' GTG AAT Alpha-1-antitrypsin (AAT) A blood component that breaks down infection-fighting enzymes such as elastase. Mentioned in: Chronic Obstructive Lung Disease TCC ACT ATA (1) (AT Attachment) The specification for IDE drives. See IDE. (2) See analog telephone adapter. ATA - Advanced Technology Attachment TGC CAA Caa See CCC. TTC CGA ATT ATT ammonia tolerance test. 3'), ORO 1A (5' AGTA-GTGTACTCCACTAT 3') (6), ORONR 271 (5' CGACTG-GAACTGTGGGAAAT 3'), OROF593 (5' AAGTCCT-CCGGCAGAGGTAT 3') and ORO2S (5' AGT AGT antiglobulin test. AGT GTG GCT CCA CAT 3') (6). Amplicons were direct sequenced in an automated sequencer (AB1377, Applied Biosystems, Foster City, CA, USA) using the Kit ABI Abi (ā`bī) [short for Abijah], in the Bible, King Hezekiah's mother. (Application Binary Interface) A specification for a specific hardware platform combined with the operating system. PRISM Dye Terminator (Applied Biosystems) by the dideoxyribonucleotide chain terminator method (11). Nucleotide sequence obtained for the strain BeAn 626990 were compared with 44 other OROV N gene nucleotide sequences (AF164531-AF164558; AY704559--AY704568; AY993909--AY993912), and phylogenetic trees were constructed by using both neighbor-joining (NJ) (12) and maximum parsimony (MP) (13) methods implemented in the Mega 2.1 (14) and PAUP 4.0 software, respectively. Bootstrap analyses with 1,000 replicates were used to place confidence values on groupings (15). Mice injected with the strain BeAn 626990 showed signs of disease 48-72 hours after intracerebral injection. By CF, the suspension prepared from the brain of infected mice showed positive reaction with the MIAF prepared for the Brazilian prototype strain of OROV BeAn 19991 ([greater than or equal to] 32/16). No cross-reactivity was observed with any other MIAF prepared for the most common arboviruses currently circulating in the region. The monkey strain was then identified as OROV. The N gene was found to be 693 nt in length, while the 5' and 3' terminal regions showed 290 and 161 nt, respectively. After the sequences assembly, accomplished by using the Seq Man program (DNA DNA: see nucleic acid. DNA or deoxyribonucleic acid One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes. STAR software package, DNASTAR Inc., Madison, WI, USA), the full-length SRNA was determined (754 nt). The multiple sequence analysis for the entire N gene of the strain BeAn 626990, when Mega 2.1 software was used, showed homology with different OROV strains previously sequenced (92%-100%), as described (6). Two overlapping open reading frames were determined. One consisted of 693 nt (231 amino acids) and was predicted to encode the N protein. The other open reading frame consisted of 273 nt (91 amino acids) and was predicted to encode the NSs proteins. Both coding regions were flanked by 2 noncoding regions, located at the 5' and 3' terminals that were 44 nt and 14 nt in length, respectively. Phylogenetic analysis carried out for 44 OROV N gene sequences (693 nt) with MP and NJ methods resulted in trees with similar topology, even though slightly low bootstrap values had been assigned for the MP consensus tree. The NJ tree suggested that the strain BeAn 626990 was more closely related to those included in genotype III. Bootstrap support values of 100%, 74%, and 100% were assigned for the genotypes I, II, and III, respectively (Figure 2). [FIGURE 2 OMITTED] Conclusions The known OROV epidemic sites are restricted to tropical areas of Central and South America, especially those in the Amazon Basin. From 1961 to 1980, in Brazil, OROV was reported in the northern state of Parer, where the most important epidemics occurred in Belem, and other regions of the state; hundred of thousands of persons were affected. From 1980 to 2004, OROV spread to 5 other northern Brazilian states (Amazonas, Amapa, Acre, Rondonia, and Tocantins) and 1 state in the northeast (Maranhao), indicating, in a short period of time, a dangerous epidemic potential (Table) (5,6). The first isolation of OROV in the Arinos area in Minas Gerais, Brazil, is of concern because this virus, under favorable ecologic conditions, can spread, and Oropouche fever may develop in the local people, who are susceptible to OROV. In fact, explosive Oropouche fever epidemics have been reported in all of the following areas in Brazil: Maranhao, Tocantins, Amazonas, Acre, Pardi, and Rondonia States. Such epidemics have also been reported in Iquitos and Madre de Dios Madre de Dios (mäd`rā thā dyōs), river, c.700 mi (1,130 km) long, rising in the Andes of SE Peru and flowing NE through NW Bolivia to the Beni River. , Peru; and in Bejuco, Panama (5). Molecular studies (6) recognized 3 genotypes and suggested the distribution for OROV in South and Central America. The authors showed that in Brazil, genotype I, the most widespread in the country, and genotype II, found in Rondonia (a bordering state with Peru), and also in Para state (M.R.T. Nunes, unpub. data) cocirculate. In Peru, only genotype II has been identified. Genotype III has been reported only in Panama, whereas in Trinidad, only genotype I has been isolated (Table). The genetic data obtained in this study, for the S segment of the strain BeAn 626990 (S: AY 117135), suggest its genetic relationship with other OROV strains. Phylogenetically phy·lo·ge·net·ic adj. 1. Of or relating to phylogeny or phylogenetics. 2. Relating to or based on evolutionary development or history: a phylogenetic classification of species. , the monkey strain was shown to be more closely related to genotype III OROV isolates (Figure 2) and is the first report of genotype III in southeastern Brazil. More importantly, OROV was detected for the first time outside the known epidemiologic area for OROV transmission in South America. Our findings also represent the first report of OROV isolation from a monkey. The potential impact of OROV in Brazil can be better assessed by viewing it in its demographic context. The southeast is the most populated region in Brazil, comprising urban areas such as the cities of Belo Horizonte, Rio de Janeiro Rio de Janeiro, city, Brazil Rio de Janeiro (rē`ō də zhänā`rō, Port. rē` thĭ zhənĕē`r , and Sao Paulo. The entire region has
intense intra- and interregional migration, fostered by improved
technology and transportation, which may lead to increases in the
dissemination of both human and animal pathogens along these areas.
Therefore, further studies on the ecology, epidemiology, and molecular
epidemiology of OROV are needed, not only to improve knowledge about the
epidemiology of this arbovirus arbovirusAny of a large group of viruses that develop in arthropods (chiefly mosquitoes and ticks). The name derives from “arthropod-borne virus.” The spheroidal virus particle is encased in a fatty membrane and contains RNA; it causes no apparent harm to the but also to find out if its epidemic area is spreading outside the Amazon region and toward the southeast and other populated regions in Brazil. This situation is of particular concern because Oropouche fever epidemics have been reported in several small villages in the Brazilian Amazon region in 2003 and 2004 (Vasconcelos PFC, unpub. data). As a consequence, the risk of spreading OROV to susceptible areas has increased considerably in Brazil. More research and program development are needed to control this potential epidemic arboviral disease. Acknowledgments We are grateful to Basilio Silva Buna bu·na n. A synthetic rubber made from the polymerization of butadiene and sodium. [Originally a trademark.] Noun 1. , Iveraldo Ferreira da Silva, and Luiz Roberto Oliveira da Costa for their technical support during the viral isolation process and serologic tests; and to the Coordenacao Estadual de Zoonoses/Superintendencia de Epidemiologia/Secretaria de Estado da Saude, Minas Gerais State, for providing the monkey material for virus isolation. This work was supported by the IEC/SVS/Ministry of Health, CNPq (302770/2002-0), and CAPES grants. References (1.) Buchen-Osmond C, editor. ICTVdB management. New York: Columbia University; 2003. (2.) Le Duc JW, Pinheiro FP. Oropouche fever. In: Monath TP, editor. The arboviruses: epidemiology and ecology. Boca Raton (FL): CRC (Cyclical Redundancy Checking) An error checking technique used to ensure the accuracy of transmitting digital data. The transmitted messages are divided into predetermined lengths which, used as dividends, are divided by a fixed divisor. Press; 1989. p.1-14. (3.) Anderson CR, Spence L, Downs WG, Aitken THG. Oropouche virus: a new human disease agent from Trinidad, West Indies. Am J Trop Med Hyg. 1961;10:574-8. (4.) Pinheiro FP, Pinheiro M, Bensabath G; Causey OR, Shope RE. Epidemia de virus Oropouche em Belem. Revista do Servico Especial de Saude Publica. 1962;12:15-23. (5.) Pinheiro FP, Travassos da Rosa APA (All Points Addressable) Refers to an array (bitmapped screen, matrix, etc.) in which all bits or cells can be individually manipulated. APA - Application Portability Architecture , Vasconcelos PFC. Oropouche fever. In: Feigin RD, editor. Textbook of pediatric pediatric /pe·di·at·ric/ (pe?de-at´rik) pertaining to the health of children. pe·di·at·ric adj. Of or relating to pediatrics. infectious diseases. Philadelphia: W.B. Saunders Co.; 2004. p. 2418-23. (6.) Saeed MF, Wang H, Nunes MRT MRT, n manual resistance technique, a treatment method used during the acute and recovery phases to relieve pain and rehabilitate the body's tissues and muscles. , Vasconcelos PFC, Weaver SC, Shope RE, et al. Nucleotide sequences and phylogeny of the nucleo-capsid gene of Oropouche virus. J Gen Virol. 2000;81:743-8. (7.) Wang H, Beasley DW, Li L, Holbrook MR, Barrett AD. Nucleotide sequence and deduced amino acid sequence of the medium RNA segment of Oropouche, a Simbu serogroup virus: comparison with the middle RNA of Bunyamwera and California serogroup viruses. Virus Res. 2001;73:153-62. (8.) Aquino VH, Moreli ML, Moraes Figueiredo LT. Analysis of Oropouche virus L protein amino acid sequence showed the presence of an additional conserved region that could harbour an important role for the polymerase activity. Arch Virol. 2003;148:19-28. (9.) Vasconcelos PFC, Bryant JE, Travassos da Rosa APA, Tesh RB, Rodrigues SG, Barrett ADT. Genetic divergence and dispersal of yellow fever virus, Brazil. Emerg Infect Dis. 2004;10:1578-84. (10.) Shope RE, Sather GE. Arboviruses. In: Lennette EH, Schmidt NJ, editors. Diagnostic procedures for viral, rickettsial rickettsial /rick·ett·si·al/ (ri-ket´se-al) pertaining to or caused by rickettsiae. rick·ett·si·al adj. Relating to, or caused by a member of the genus Rickettsia. and chlamydial infections. 5th ed. Washington: American Public Health Association The American Public Health Association (APHA) is Washington, D.C.-based professional organization for public health professionals in the United States. Founded in 1872 by Dr. Stephen Smith, APHA has more than 30,000 members worldwide. ; 1979. p. 767-814. (11.) Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. Proe Natl Acad Sci U S A. 1977;74:5463-7. (12.) Saitou N, Nei M. The neighbor-joining method: a new method for reconstruction phylogenetic trees. Mol Biol Evol. 1987;4:406-25. (13.) Swofford DL. PAUP. Phylogenetic analysis using parsimony (and other methods), version 4. Sunderland (MA): Sinauer Associates; 1998. (14.) Kumar S, Tamura K, Nei M. Molecular evolutionary genetic analysis. Version 1.01. University Park (PA): Pennsylvania State University Pennsylvania State University, main campus at University Park, State College; land-grant and state supported; coeducational; chartered 1855, opened 1859 as Farmers' High School. ; 2000. (15.) Felsenstein J. Confidence limits on phylogenies: an approach using the bootstrap. Evolution. 1985;39:783-91. Marcio Roberto Teixeira Nunes, * Livia Caricio Martins, * Sueli Guerreiro Rodrigues, * Jannifer Oliveira Chiang, * Raimunda do Socorro da Silva Azevedo, * Amelia P.A. Travassos da Rosa, ([dagger]) and Pedro Fernando da Costa Vasconcelos * * Instituto Evandro Chagas, Belem, Para, Brazil; and ([dagger]) University of Texas Medical Branch "UTMB" redirects here. For other system schools, see University of Texas System. The University of Texas Medical Branch (UTMB) is a component of the University of Texas System located in Galveston, Texas, about 50 miles (80 km) southeast of downtown Houston. , Galveston, Texas, USA Dr Nunes is a researcher in the Department of Arbovirology and Hemorrhagic Fevers at Instituto Evandro Chagas, Ministry of Health, in Belem, Para State, Brazil. His research interests are focused on arbovirology, particularly molecular biology and molecular epidemiology. Address for correspondence: Marcio Roberto Teixeira Nunes, Department of Arbovirology and Hemorrhagic Fevers, Instituto Evandro Chagas, Av. Almirante Barroso 492, 66090-000, Belem, Brazil; fax: 5591-3226-1284; email: marcionunes@iec.pa.gov.br
Table. Examples of epidemics and isolates of Oropouche fever
virus genetically characterized in Latin American countries, 1955-2004
Years of
occurrence Location Genotypes
1955 Trinidad I
Brazil (Para State)
1960 Brazil (Santa Maria *)
1961, 1968, 1979-80 Brazil (Belem) I
1967, 1979-80 Brazil (Braganga region)
1972 Brazil (Baiao)
1974-75 Brazil (Santarem) I
1988 Brazil (Tucurui) I
1996 Brazil (Oriximina, Altamira)
2003 Brazil (Parauapebas)
2004 Brazil (Preto de Moz) II
1992 Peru (Iquitos) II
1998 Peru (Madre de Dios) II
Brazil (Acre State)
1996 Brazil (Xapuri) I
Brazil (Amazonas State)
1980-1981 Brazil (Manaus and Barcelos) I
Brazil (Maranhao State)
1988 Brazil (Preto Franco) I
Brazil (Rondonia State)
1991 Brazil (Ariquemes/Ouro Preto) II
Brazil (Tocantins State)
1988 Brazil (Tocantinopolis) I
2002 Brazil (Parana)
1989 Panama ([dagger]) III
* Bradypus tridactylus.
([dagger]) Chame, Chilibre, and San Miguelito.
|
|
||||||||||||||||||

tus, past participle of part
thĭ zhənĕē`r
Printer friendly
Cite/link
Email
Feedback
Reader Opinion