Printer Friendly
The Free Library
5,678,886 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Nosocomial infection with vancomycin-dependent enterococci (1).


We report three patients infected with unique strains of vancomycin-dependent enterococci enterococci

bacteria in the genus Enterococcus.
. Two were first infected by genetically identical strains of vancomycin-resistant enterococci (VRE VRE

vancomycin-resistant enterococcus.

VRE Vancomycin-resistent enterococcus, see there
). All three patients had much greater exposure to vancomycin and third-generation cephalosporins Cephalosporins Definition

Cephalosporins are medicines that kill bacteria or prevent their growth.
Purpose

Cephalosporins are used to treat infections in different parts of the body—the ears, nose, throat, lungs, sinuses, and
 than did two control groups (patients infected with VRE and hospitalized patients without enterococcal infections). While antimicrobial pressure promotes nosocomial nosocomial /noso·co·mi·al/ (nos?o-ko´me-il) pertaining to or originating in a hospital.

nos·o·co·mi·al
adj.
1. Of or relating to a hospital.

2.
 colonization by VRE, prolonged exposure to vancemycin may foster the transition from vancomycin resistance to dependence.

**********

Vancomycin-resistant enterococci (VRE) are major nosocomial pathogens worldwide (1). Recent case reports, however, describe nosocomial infections Nosocomial infections
Infections that were not present before the patient came to a hospital, but were acquired by a patient while in the hospital.

Mentioned in: Enterobacterial Infections, Staphylococcal Infections
 caused by enterococci that require vancomycin for growth (2-12). Since 1993, we have identified three patients in our center infected by vancomycin-dependent enterococci (VDE (1) (Video Display Editor) A WordStar and WordPerfect-compatible shareware word processor written by Eric Meyer.

(2) (Verband Deutscher Elektrotechniker) The German counterpart of the U.S. Underwriters Lab.
). We report the microbiologic features and molecular epidemiology molecular epidemiology Molecular medicine An evolving field that combines the tools of standard epidemiology–case studies, questionnaires and monitoring of exposure to external factors with the tools of molecular biology–eg, restriction endonucleases,  of nosocomial infection Nosocomial infection
An infection that can be acquired in a hospital. ABPA is a nosocomial infection.

Mentioned in: Allergic Bronchopulmonary Aspergillosis, Hospital-Acquired Infections, Pseudomonas Infections

 caused by these organisms.

Methods

Enterococci showing growth on media containing 6 [micro]g/mL of vancemycin and an MIC >8 [micro]g/mL were considered vancomycin-resistant. Strains unable to grow in the absence of vancomycin 6 [micro]g/mL, despite multiple subcultures, were considered vancomycin-dependent.

The genotypic basis of vancomycin resistance was determined by using polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is  to amplify sequences coding for resistance, using oligonucleotide primers for vanA (5'CATGAATAGAATAAAAGTTGC and 5'CTTATCACCCCTTTAACG, Department of Pharmacology, University of Wisconsin-Madison “University of Wisconsin” redirects here. For other uses, see University of Wisconsin (disambiguation).
A public, land-grant institution, UW-Madison offers a wide spectrum of liberal arts studies, professional programs, and student activities.
, Madison, WI) and vanB (5'AAATTCGATCCGCACTACNFC and 5'AA-CGATGCCGCCATCCTCCTG, University of Wisconsin Bio-technology Center, Madison, WI). Susceptibility was assessed by National Committee for Clinical Laboratory Standards criteria using Mueller-Hinton II agar (BBL "Be back later." See digispeak.

(chat) BBL - (I will) be back later.
, Becton-Dickinson, Cockeysville, MD) containing vancomycin 6 [micro]g/mL. The capacity of D-alanyl-D-alanine to support growth of the VDE was tested by using 2.5-mg and 5-mg disks of D-alanyl-D-alanine on Mueller-Hinton II agar. Screening for revertants was performed by plating serial dilutions of an overnight culture of VDE in vancomycin-containing broth to Mueller-Hinton II agar with and without vancomycin, which was incubated for 48 hours at 35[degrees]C. Molecular relation of strains was determined by using pulsed-field gel electrophoresis (PFGE PFGE Pulsed-Field Gel Electrophoresis ) after digestion of genomic DNA with restriction endonuclease restriction endonuclease

one of over 200 enzymes isolated from bacteria that cleave any DNA molecule at specific sites which are usually palindromes of 4 to 10 or so nucleotides to yield a collection of restriction DNA fragments that can be separated, usually by electrophoresis in
 Sma1 (Gibco BRL BRL

In currencies, this is the abbreviation for the Brazilian Real.

Notes:
The currency market, also known as the Foreign Exchange market, is the largest financial market in the world, with a daily average volume of over US $1 trillion.
, Prmncga, Madison, WI) (13).

Case Reports

Patient 1

A 32-year-old woman with long-standing type 1 diabetes mellitus type 1 diabetes mellitus Brittle DM, insulin-dependent DM, juvenile-onset DM Endocrinology A severe form of DM caused by ↓ endogenous insulin production by the pancreas, which comprises +– 10% of DM Clinical Extreme hyperglycemia, lability of glucose  and end-stage renal disease End-stage renal disease (ESRD)
Total kidney failure; chronic kidney failure is diagnosed as ESRD when kidney function falls to 5-10% of capacity.

Mentioned in: Chronic Kidney Failure

end-stage renal disease 
 was admitted for a kidney-pancreas transplant. Postoperatively, she had multiple complications, including transplant renal failure renal failure
n.
Acute or chronic malfunction of the kidneys resulting from any of a number of causes, including infection, trauma, toxins, hemodynamic abnormalities, and autoimmune disease, and often resulting in systemic symptoms, especially edema,
 and intraperitoneal infection caused by vancomycin-resistant Enterococcus faecium. She received vancomycin, teicoplanin, imipenem, amikacin cefazolin, ceftazidime, ciprofloxacin ciprofloxacin /cip·ro·flox·a·cin/ (sip?ro-flok´sah-sin) a synthetic antibacterial effective against many gram-positive and gram-negative bacteria; used as the hydrochloride salt.

cip·ro·flox·a·cin
n.
, gentamicin gentamicin /gen·ta·mi·cin/ (jen?tah-mi´sin) an aminoglycoside antibiotic complex isolated from bacteria of the genus Micromonospora, , metronidazole metronidazole /met·ro·ni·da·zole/ (-ni´dah-zol) an antiprotozoal and antibacterial effective against obligate anaerobes; used as the base or the hydrochloride salt. It is also used as a topical treatment for rosacea. , ticarcillin-clavulanate, trimethoprim-sulfamethoxazole, and intravenous amphotericin B. On hospital day 53, intraabdominal fluid specimens obtained at surgery yielded vancomycin-resistant E. faecium that did not grow on media without vancomycin (Figure 1). The infection was treated with surgical drainage and a combination of teicoplanin and gentamicin. Despite this, the patient died of refractory sepsis on hospital day 268. VDE were isolated from multiple intraabdominal cultures in the month before death.

[FIGURE 1 OMITTED]

Patient 2

A 40-year-old woman with type 1 diabetes mellitus and end-stage renal disease received a kidney-pancreas transplant, which was complicated by multiple intraabdominal abscesses that were drained surgically. On posttransplant day 82, VRE were isolated from intraabdominal cultures. The transplanted kidney was removed on posttransplant day 115 and the transplanted pancreas 10 days later. However, the patient continued to show signs of sepsis.

Blood cultures were positive on radiometric monitoring. Subculturing onto media containing vancomycin confirmed bacteremia bacteremia: see septicemia.
bacteremia

Presence of bacteria in the blood. Short-term bacteremia follows dental or surgical procedures, especially if local infection or very high-risk surgery releases bacteria from isolated sites.
 with a strain of E. faecium that did not grow in the absence of vancomycin. The patient remained critically ill, despite prolonged therapy with intravenous quinupristin-dalfopristin, and died after 4 days of refractory VDE bacteremia, 132 days after transplantation.

Patient 3

A 47-year-old woman with chronic myelogenous leukemia Chronic myelogenous leukemia (CML)
Also called chronic myelocytic leukemia, malignant disorder that involves abnormal accumulation of white cells in the marrow and bloodstream.

Mentioned in: Bone Marrow Transplantation
 received a matched-unrelated donor bone marrow transplant bone marrow transplant: see bone marrow. . Subsequently, when severe graft-versus-host disease, acute renal failure acute renal failure Acute kidney failure Nephrology An abrupt decline in renal function, triggered by various processes–eg, sepsis, shock, trauma, kidney stones, drug toxicity-aspirin, lithium, substances of abuse, toxins, iodinated radiocontrast. , cyclosporine cyclosporine /cy·clo·spor·ine/ (-spor´en) a cyclic peptide from an extract of soil fungi that selectively inhibits T cell function; used as an immunosuppressant to prevent rejection in organ transplant recipients and to treat severe  neurotoxicity neurotoxicity /neu·ro·tox·ic·i·ty/ (noor?o-tok-sis´it-e) the quality of exerting a destructive or poisonous effect upon nerve tissue. , prolonged respiratory failure, and bacteremia with Corynebacterium Corynebacterium /Co·ry·ne·bac·te·ri·um/ (-bak-ter´e-um) a genus of bacteria including C. ac´nes, a species present in acne lesions, C. diphthe´riae, the etiologic agent of diphtheria, C.  spp. resistant to [beta]-lactam antimicrobial agents developed, the patient received a prolonged course of vancomycin. On hospital day 80, when vancomycin-containing media was used, she was found to have catheter-associated urinary tract infection urinary tract infection (UTI),
n infection in one or more of the structures that make up the urinary system. Occurs more often in women and is most commonly caused by bacteria.
 with a strain of enterococcus enterococcus /en·tero·coc·cus/ (en?ter-o-kok´us) pl. enterococ´ci   an organism belonging to the genus Enterococcus.
Enterococcus /En·tero·coc·cus/ (
 that required vancomycin for growth. Efforts were not made to eradicate VDE from the urine. The patient ultimately died of refractory graft-versus-host disease with multiple organ dysfunction syndrome Multiple organ dysfunction syndrome MODS, previously known as multiple organ failure (MOF), is altered organ function in an acutely ill patient requiring medical intervention to perform homeostasis.  on posttransplant day 87.

Case-Control Study

Potential risk factors for nosocomial infection were compared in the 3 patients and 10 randomly selected patients with nosocomial infection caused by VRE and 10 at-risk, concurrently hospitalized patients not infected by enterococci. Controls were matched by age and admission to the same hospital service as patients in the VRE cohort.

Results

PFGE analysis indicated that the three strains of vancomycin-dependent enterococci were clonally distinct (Figure 2) when the criteria of Tenover et al. were used (14). In the two cases in which strains of VRE were isolated before VDE were first detected, the restriction fragment patterns of the initial VILE strain and subsequent VDE isolate were identical.

[FIGURE 2 OMITTED]

All three strains of VDE were E. faecium; two were genotype vanA, and one was vanB. All showed resistance to penicillin, ampicillin ampicillin (ăm'pĭsĭl`ĭn), a penicillin-type antibiotic that is effective against both gram-negative microorganisms and gram-positive microorganisms such as Escherichia coli. , anaoxicillin-clavulanate, gentamicin, and erythromycin erythromycin (ĭrĭth'rōmī`sĭn), any of several related antibiotic drugs produced by bacteria of the genus Streptomyces (see antibiotic). . All were susceptible to quinupristin-dalfopristin; two were intermediately susceptible, and one was susceptible to teicoplanin. The rate of spontaneous reversion to nondependence on vancomycin was 1.2 x [10.sup.-6] for strain 1, 2.5 x [10.sup.-6] for strain 2, and 2.6 x [10.sup.-3] for strain 3. Growth of VDE was not supported by D-alanyl-D-alanine.

All three patients infected by VDE were female transplant recipients and experienced posttransplant acute renal failure; by contrast, the VRE group had lower exposure to the intensive care unit (Table). No other significant differences were noted between the two groups of patients with enterococcal infection and the group of at-risk controls in underlying conditions, severity of illness, or exposure to invasive devices. However, in the 60 days before onset of the nosocomial enterococcal infection, major differences in exposure to antimicrobial agents occurred: mean [+ or -] standard deviation (SD) total antimicrobial days 103 [+ or -] 40 for VDE, 86 [+ or -] 31 for VRE, and 28.6 [+ or -] 23.1 for noninfected controls (VDE or VRE vs. controls, p < 0.01), especially vancomycin (27 [+ or -] 14 days for VDE, 9 [+ or -] 10 for VRE, and 5.7 [+ or -] 7.6 for controls; VDE vs. VRE, p = 0.03) and third-generation cephalosporins (17.0 [+ or -] 11.4 days for VDE, 15.6 [+ or -] 11.9 for VRE, and 2.9 [+ or -] 4.8 for noninfected controls; VDE or VRE vs. controls, p < 0.01). All 3 patients with VDE infection died during hospitalization, contrasted with 3 of 10 patients infected with VRE and 2 of 10 uninfected control patients who died (p = 0.03).

Discussion

Vancomycin resistance is thought to be mediated primarily by the strain's acquiring the capacity to synthesize the cell wall by using D-alanine-D-lactate (1). In the first clinical reports of VDE infection, Fraimow et al. (2) and Green et al. (4) independently reported that D-alanyl-D-alanine supported the growth of a vancomycin-dependent E. faecalis strain (2) and a vanB E. faecium strain (4), respectively; Sng et al. (9) quantified the amount of D-alanyl-D-alanine required to support growth of their VDE strain. The phenomenon of vancomycin dependence may derive from the loss of a D-alanyl-D-alanine ligase ligase /li·gase/ (li´gas) (lig´as) any of a class of enzymes that catalyze the joining together of two molecules coupled with the breakdown of a pyrophosphate bond in ATP or a similar triphosphate.  in a VRE strain, which is then unable to survive unless vancomycin induces the production of D-alanine-D-lactate ligase (2,4). Previous reports (2-12) and our experience (Figure 2) suggest that infecting strains of VRE make the transition in situ to a state of vancomycin dependence only after prolonged exposure to vancomycin.

Sixteen patients infected by enterococci dependent on vancomycin for growth have been reported (2-12). In every case with data reported on prior antimicrobial exposure, the patients had also received a glycopeptide, vancomycin, or teicoplanin. We sought to minimize the effect of control group bias (15) by selecting as a control group concurrently hospitalized patients at risk for nosocomial infection with VRE or VDE but not infected with enterococci. We found that intense use of third-generation cephalosporins was the most important risk factor for both VDE and VRE when compared with the uninfected control group. This finding is in line with our recent observation of the striking commonality of risk factors for nosocomial colonization and infection with a diverse array of multiresistant pathogens, in particular, heavy exposure to third-generation cephalosporins (16). Selection pressure from broad-spectrum antimicrobial agents apears to promote nosocomial colonization with VRE, which, after prolonged exposure to vancomycin, may lead to the emergence of vancomycin dependence in the colonizing strain.

Renal insufficiency was the other risk factor identified in our study. The ecologic impact of vancomycin exposure is magnified and extended in patients with renal insufficiency, especially those with end-stage renal disease requiring hemodialysis (all 3 of our patients and 5 of the 16 previously reported cases), where a single dose persists in the patient's body for many days. The emergence of novel strains of Staphylococcus aureus exhibiting resistance to vancomycin has also been reported in this clinical setting (17). The prevalence of nosocomial infection or colonization with VDE can only be determined by the use of media containing vancomycin when processing cultures from patients at risk for VDE infection, namely those who have had prolonged exposure to vancomycin or third-generation cephalosporins, especially if they are already known to be colonized Colonized
This occurs when a microorganism is found on or in a person without causing a disease.

Mentioned in: Isolation
 or infected by VRE.

These infections are clearly not trivial, although their clinical importance remains to be fully determined. Five of the 16 previously reported VDE infections were bacteremias (4,7,9,11). VDE was considered the immediate cause of death in one of our patients and a contributory cause in another. Green et al. (4) reported the spontaneous reversion of VDE to nondependence at 1 in [10.sup.6], which we confirmed in all three of our strains. Thus, vancomycin discontinuation alone may not be sufficient to treat patients with VDE infection, especially if the patient has renal failure.

The best management of infection with VDE--beyond source control and treatment with linezolid, quinupristindal-fopristin, or daptomycin--remains to be determined. More effective antimicrobial stewardship policies are needed to prevent VDE, VRE, and other resistant nosocomial pathogens from emerging.
Table. Clinical and epidemiologic features of
patients with nosocomial enterococcal infections
and uninfected control patients (a)

                                           VDE                VRE
Features                                 (n = 3)            (n = 10)

Age, y, mean [+ or -] SD              39.0 [+ or -]      41.7 [+ or -]
                                           7.5                20.2
Sex, no.
  Male                                      0                  5
  Female                                    3                  5
Duration of hospitalization,          41.7 [+ or -]      33.6 [+ or -]
 days, mean [+ or -] SD                     13                12.1
ICU stay, days, mean [+ or -] SD      9.3 [+ or -]       1.0 [+ or -]
                                           4.0              1.9 (b)
Site of nosocomial enterococcal
 infection
  Primary bloodstream infection             0                  5
  Surgical wound infection                  1                  2
  Intraabdominal infection                  1                  1
  Urinary tract Infection                   1                  1
Service, no.
  Medicine or pediatrics                    1                  5
  Surgery                                   2                  5
Associated conditions, no.
  Malignancy                                1                  4
  Diabetes mellitus                         2                  3
  Renal failure                             3                  3
  Trauma                                    0                  2
  Transplant recipient                      3                  4
APACHE II score, mean [+ or -] SD     18.7 [+ or -]      15.1 [+ or -]
                                           2.1                6.7
Serum creatinine, mg/dL, mean         2.8 [+ or -]       1.5 [+ or -]
 [+ or -] SD                              0.5 (c)               0.8
Days antimicrobial agent
 administered
  Vancomycin                          27.3 [+ or -]      9.1 [+ or -]
                                         13.7 (d)             10.3
  Aminoglycosides                     11.3 [+ or -]      9.7 [+ or -]
                                           6.7                9.8
  First- or second-generation         0.7 [+ or -]       1.1 [+ or -]
   cephalosporins                          0.6                2.2
  Third-generation cephalosporins     17.0 [+ or -]      15.6 [+ or -]
                                         11.4 (e)           11.9 (f)
  Quinolones                          10.3 [+ or -]      8.0 [+ or -]
                                           5.5                9.2
  Clindamycin                         2.3 [+ or -]       7.1 [+ or -]
                                           4.0                11.7
  Metronidazole                       4.3 [+ or -]       4.4 [+ or -]
                                           7.5                6.3
  Trimethoprim-sulfamethoxazole       32.7 [+ or -]      14.6 [+ or -]
                                         18.0 (e)             19.2
  Others                              1.0 [+ or -]       5.6 [+ or -]
                                           1.7                9.5
Total                                 106.3 [+ or -]     83.5 [+ or -]
                                         44.7 (e)           29.4 (f)

                                    Uninfected control
Features                            patients (n = 10)

Age, y, mean [+ or -] SD            51.1 [+ or -] 13.0
Sex, no.
  Male                                      7
  Female                                    3
Duration of hospitalization,        37.6 [+ or -] 44.7
 days, mean [+ or -] SD
ICU stay, days, mean [+ or -] SD     7.4 [+ or -] 7.4
Site of nosocomial enterococcal
 infection
  Primary bloodstream infection             0
  Surgical wound infection                  0
  Intraabdominal infection                  0
  Urinary tract Infection                   0
Service, no.
  Medicine or pediatrics                    5
  Surgery                                   5
Associated conditions, no.
  Malignancy                                2
  Diabetes mellitus                         4
  Renal failure                             4
  Trauma                                    0
  Transplant recipient                      2
APACHE II score, mean [+ or -] SD   19.4 [+ or -] 10.0
Serum creatinine, mg/dL, mean        1.9 [+ or -] 1.8
 [+ or -] SD
Days antimicrobial agent
 administered
  Vancomycin                         5.7 [+ or -] 7.6
  Aminoglycosides                    2.5 [+ or -] 5.1
  First- or second-generation        3.6 [+ or -] 7.5
   cephalosporins
  Third-generation cephalosporins    2.9 [+ or -] 4.8
  Quinolones                         3.4 [+ or -] 4.8
  Clindamycin                        1.2 [+ or -] 3.8
  Metronidazole                      1.8 [+ or -] 3.8
  Trimethoprim-sulfamethoxazole      2.7 [+ or -] 5.7
  Others                             4.8 [+ or -] 9.6
Total                               28.6 [+ or -] 23.1

(a) VDE, vancomycin-dependent enterococci; VRE, vancomycin-resistant
enterococci; ICU, intensive care unit; APACHE, Acute Physiology and
Chronic Health Evaluation score.

(b) VRE vs. controls, p = 0.03.

(c) VDE vs. VRE, p = 0.02.

(d) Vde vs. VRE, p = 0.03.

(e) VDE vs. controls, p < 0.01.

(f) VRE vs. controls, p < 0.01.


Acknowledgments

We thank Bernard Weisblum for providing the primers for the polymerase chain reactions used to characterize the strains as either vanA or vanB.

References

(1.) Murray BE. Vancomycin-resistant enterococci Am J Med. 1997;102:284-93.

(2.) Fraimow HS, Jungkind DL, Lander DW, Delso DR, Dean JL. Urinary tract infection with an Enterococcus faecalis isolate that requires vancomycin for growth. Ann Intern Med. 1994;121:22-6.

(3.) Woodford N, Johnson AP, Morrison D, Hastings JGM JGM Joint Gravity Model
JGM Journal of General Microbiology
JGM Just Got Married
, Elliot TSJ TSJ Tribunal Superior de Justicia (Spain)
TSJ The Super Jesus (Australian band) 
, Worthington A, et al. Vancomycin-dependent enterococci in the United Kingdom [letter]. J Antimicrob Chemother. 1994;33:1066.

(4.) Green M, Shlaes JH, Barbadora K, Shlaes DM. Bacteremia due to vancomycin-dependent Enterococcus faecium. Clin Infect Dis. 1995;20:712-4.

(5.) Rosato A, Pierre J, Billot-Klein D, Buu-Hoi A, Gutmann L. Inducible and constitutive expression of resistance to glycopeptides and vancomycin dependence in glycopeptide resistant Enterococcus avium. Antimicrob Agents Chemother: 1995;39:830-3.

(6.) Rossney AS, McConkey SJ, Keane CT. Vancomycin-dependent enterococcus [letter]. Lancet. 1997;349:430.

(7.) Farrag N, Eltringham I, Liddy H. Vancomycin-dependent Enterococcus faecalis. Lancet. 1996;348:1581-2.

(8.) Dever LL, Smith SM, Handwerger S, Eng RHK RHK Ratahallintokeskus (Finnish: Finnish Rail Administration)
RHK Ryan Hankin Kent (RHK, Inc. marketing consulting firm)
RHK Rigshospitalets Kollegium (Copenhagen, Denmark dorm) 
. Vancomycin-dependent Enterococcus faecium isolated from stool following oral vancomycin therapy. J Clin Microbial microbial

pertaining to or emanating from a microbe.


microbial digestion
the breakdown of organic material, especially feedstuffs, by microbial organisms.
. 1995;33:2770-3.

(9.) Sng LH, Cornish N, Knapp CC, Ludwig MD, Hall GS, Washington JA. Antimicrobial susceptibility testing of a clinical isolate of vancomycin-dependent enterococcus using D-alanine-D-alanine as a growth supplement. Am J Clin Pathol. 1998;109:399-403.

(10.) Yowler CJ, Blinkhorn RJ, Fratianne RB. Vancomycin-dependent enterococcal strains: case report and review. J Trauma. 2000;48:783-5.

(11.) Majumdar A, Lipkin GW, Eliott TSJ, Wheeler DC. Vancomycin-dependent enterococci in a uremic uremic

pertaining to or emanating from uremia.


uremic poisoning
see uremia, visceral gout.

uremic toxins
 patient with sclerosing peritonitis. Nephrol Dial Transplant. 1999;14:765-7.

(12.) Kirkpatrick BD, Harrington SM, Smith D, Marcellus D, Miller C, Dick J, et al. An outbreak of vancomycin-dependent Enterococcus faecium in a bone marrow transplant unit. Clin Infect Dis. 1999;29:1268-73.

(13.) Alvarado CJ, Stolz SM, Maki DG Nosocomial infections from contaminated endoscopes: a flawed automated endoscope endoscope, any instrument used to look inside the body. Usually consisting of a fiber-optic tube attached to a viewing device, endoscopes are used to explore and biopsy such areas as the colon and the bronchi of the lungs.  washer. An investigation using molecular epidemiology. Am J Med. 1991;9:272S-80S.

(14.) Harris AD, Samore MH, Lipsitch M, Kaye KS, Perencevich E, Carmeli Y. Control-group selection importance in studies of antimicrobial resistance: examples applied to Pseudomonas aeruginosa, enterococci and Escherichia coli. Clin Infect Dis. 2002;34:1558-63.

(15.) Tenover FC, Arbeit RD, Goering PV, Mickelsen PA, Murray BE, Persing DH, et al. Interpreting chromosomal DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbial. 1995;33:2233-9.

(16.) Centers for Disease Control and Prevention Centers for Disease Control and Prevention (CDC), agency of the U.S. Public Health Service since 1973, with headquarters in Atlanta; it was established in 1946 as the Communicable Disease Center. . Staphylococcus aureus resistant to vancomycin--United States, 2002. MMWR MMWR Morbidity & Mortality Weekly Report Epidemiology A news bulletin published by the CDC, which provides epidemiologic data–eg, statistics on the incidence of AIDS, rabies, rubella, STDs and other communicable diseases, causes of mortality–eg,  Morb Mortal Wkly Rep. 2002;51:565-7.

(17.) Safdar N, Maki DG. The commonality of risk factors for nosocomial colonization/infection with antimicrobial resistant pathogens: methicillin resistant Staphylococcus aureus, vancomycin resistant enterococcus, extended spectrum beta-lactamase producing gram-negative bacilli bacilli /ba·cil·li/ (bah-sil´i) plural of bacillus.

bacilli

see bacillus.
, Clostridium difficile and candida. Ann Intern Med. 2002;136:834-44.

Address for correspondence: Paul A. Tambyah, Department of Medicine, National University of Singapore The National University of Singapore (Abbreviation: NUS) is Singapore's oldest university. It is the largest university in the country in terms of student enrollment and curriculum offered. , 5 Lower Kent Ridge Road, Singapore 119074, Singapore; fax: 65-67794112; email: mdcpat@nus.edu.sg

Paul A. Tambyah, * John A. Marx, * and Dennis G. Maki *

* University of Wisconsin Medical School, Madison, Wisconsin, USA

(1) Presented in part at the 38th Interscience Conference on Antimicrobial Agents and Chemotherapy Antimicrobial Agents and Chemotherapy (print-ISSN 0066-4804, CODEN AMACCQ; canceled ISSN 0074-9923, canceled CODEN AACHAX) is an academic journal published by the American Society for Microbiology. , San Diego, CA, September 24-27, 1998.

Dr. Tambyah is consultant infectious disease physician and associate professor of medicine at the National University of Singapore, Singapore. This research was conducted when he was employed at the University of Wisconsin. His research interests are in nosocomial infections, in particular, emerging nosocomial pathogens such as SARS and multidrug-resistant bacteria.
COPYRIGHT 2004 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2004, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Research
Author:Maki, Dennis G.
Publication:Emerging Infectious Diseases
Geographic Code:1U3WI
Date:Jul 1, 2004
Words:2772
Previous Article:Rapid assessment tool for Haemophilus influenzae type b disease in developing countries (1).(Research)
Next Article:Q fever outbreak in industrial setting.(Research)
Topics:



Related Articles
Proficiency in detecting vancomycin resistance in enterococci among clinical laboratories in Santiago, Chile.(Brief Article)
Fecal Colonization with Vancomycin-Resistant Enterococci in Australia.
Increasing Resistance to Vancomycin and Other Glycopeptides in Staphylococcus aureus.
INFECTION CONTROL TOOL KIT.(Brief Article)
Absence of high-level vancomycin resistance in enterococci isolated from meat-processing facilities. (Dispatches).
Excretion of Vancomycin-resistant enterococci by wild mammals. (Dispatches).
Antecedent treatment with different antibiotic agents as a risk factor for vancomycin-resistant Enterococcus. (Research).(Statistical Data Included)
First characterization of a cluster of VanA-type glycopeptide-resistant Enterococcus faecium, Colombia.
Characterizing vancomycin-resistant enterococci in neonatal intensive care.(DISPATCHES)

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles