Printer Friendly
The Free Library
14,457,684 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Mycobacterium haemophilum and lymphadenitis in children.


Infections associated with Mycobacterium haemophilum are underdiagnosed because specific culture methods required for its recovery are not applied routinely. Using polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is  (PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
) technology on fine needle aspirates and biopsied specimens from 89 children with cervicofacial lymphadenitis Lymphadenitis Definition

Lymphadenitis is the inflammation of a lymph node. It is often a complication of a bacterial infection of a wound, although it can also be caused by viruses or other disease agents.
, we assessed the importance of M. haemophilum. Application of a Mycobacterium mycobacterium

Any of the rod-shaped bacteria that make up the genus Mycobacterium. The two most important species cause tuberculosis and leprosy in humans; another species causes tuberculosis in both cattle and humans.
 genus-specific real-time PCR in combination with amplicon sequencing and a M. haemophilum-specific PCR resulted in the recognition of M. haemophilum as the causative agent in 16 (18%) children with cervicofacial lymphadenitis. M. avium was the most frequently found species (56%), and M. haemophilum was the second most commonly recognized pathogen. Real-time PCR results were superior to culture because only 9 (56%) of the 16 diagnosed M. haemophilum infections were positive by culture.

**********

Cervicofacial lymphadenitis is the most frequently encountered manifestation of nontuberculous mycobacterial mycobacterial

emanating from or pertaining to mycobacterium.


mycobacterial granuloma
may be caused by Mycobacterium tuberculosis (see cutaneous tuberculosis), M.
 (NTM NTM New Tribes Mission
NTM Notice to Members (NASD)
NTM Notice To Mariners
NTM Nontuberculous Mycobacteria
NTM Non-Tariff Measures
NTM National Technical Means (formerly National Assets) 
) disease in children. In previous studies, Mycobacterium avium has been identified as the cause in >80% of the patients (1). Other mycobacterial species isolated from patients with lymphadenitis are M. tuberculosis M. tuberculosis,
n the bacterium responsible for tuberculosis, generally a respiratory infection in man; nonrespiratory tuberculosis is considered an indicator disease for AIDS. See also tuberculosis.
, M. malmoense, M. kansasii, M. scrofulaceum, M. intracellulare, and M. xenopi. M. haemophilum has been described as the causative agent of lymphadenitis as well (2-7).

In an ongoing multicenter study in the Netherlands, the optimal treatment for NTM lymphadenitis is investigated. Diagnosis of mycobacterial infection is performed by using mycobacterial differential skin tests and fine needle aspiration biopsy Fine needle aspiration biopsy
A procedure using a thin needle to remove fluid and cells from a lump in the breast.

Mentioned in: Breast Biopsy

fine needle aspiration biopsy 
. Biopsied specimens are subjected to acid-fast staining, mycobacterial culturing, and Mvcobacterium genus-specific real-time PCR. Of 89 patients included in the study so far, mycobacterial species were identified in 55 cases, of which M. avium had been found in 50 patients (8). In addition, a mycobacterial infection without further identification was detected in 16 patients. An atypical mycobacterial infection atypical mycobacterial infection Infectious disease Clinical infection with mycobacteria other than those causing TB or lepra Risk factors Immune compromise, AIDS Clinical Abscesses, septic arthritis, osteomyelitis; AMIs include those with M avium  was diagnosed in these patients because either acid-fast staining results were positive or the Mycobacterium genus specific real-time polymerase chain reaction In Molecular Biology, real-time polymerase chain reaction, also called quantitative real time polymerase chain reaction (QRT-PCR) or kinetic polymerase chain reaction  (PCR) was positive. Cultures or species-specific real-time PCR for M. avium and M. tuberculosis remained negative. Previously, an attempt to characterize these mycobacteria mycobacteria

members of the genus Mycobacterium.


anonymous mycobacteria
see opportunist (atypical) mycobacteria (below).

nontubercular mycobacteria
see opportunist (atypical) mycobacteria (below).
 by sequence analysis of the genus-specific PCR fragment was successful in only 2 cases and showed M. haemophilum (8). In the current study, we further analyzed these uncharacterized mycobacteria.

M. haemophilum requires special growth conditions (9), and most of the diagnostic laboratories do not use these culture conditions. Furthermore, no molecular test is available to detect M. haemophilum directly in clinical materials. Therefore, M. haemophilum infection could be seriously underdiagnosed (4,10-12). In this study, we developed a species-specific real-time PCR to detect M. haemophilum directly in patient materials. This assay can show the actual prevalence of M. haemophilum in patients with mycobacterial lymphadenitis, but it could also be applied in other diseases and help elucidate the incidence and distribution of this species.

Materials and Methods

Bacterial Strains

Five M. haemophilum reference strains (all clinical isolates) were available for 16S and internal transcribed spacer ITS (for internal transcribed spacer) refers to a piece of non-functional RNA situated between structural ribosomal RNAs (rRNA) on a common precursor transcript. Read from 5' to 3', this polycistronic rRNA precursor transcript contains the 5' external transcribed sequence (5' ETS),  (ITS) sequencing. Three strains were provided by the National Institute for Public Health and the Environment and 2 were provided by the Institute for Tropical Medicine tropical medicine, study, diagnosis, treatment, and prevention of certain diseases prevalent in the tropics. The warmth and humidity of the tropics and the often unsanitary conditions under which so many people in those areas live contribute to the development and  (Antwerp, Belgium). The 25 mycobacterial strains used for specificity testing included M. tuberculosis complex, M. kansasii, M. xenopi, M. avium, M. intracellulare, M. gordonae, M. chelonae, M. fortuitum, M. marinum, M. scrofulaceum and M. malmoense. A complete list of all strains (species and subspecies subspecies, also called race, a genetically distinct geographical subunit of a species. See also classification. ) has been published in Bruijnesteijn et al. (8). The strains were cultured in liquid Dubos medium at 35[degrees]C. The M. haemophilum strains were cultured at 30[degrees]C on solid Lowenstein-Jensen (LJ) medium with added iron citrate citrate /cit·rate/ (sit´rat) a salt of citric acid.

citrate phosphate dextrose  (CPD) anticoagulant citrate phosphate dextrose solution.
 or in liquid Mycobacteria Growth Index Tube (MGIT MGIT Mahatma Gandhi Institute of Technology (India)
MGIT Maritime Group Inport Training
) medium with X-factor-strip added (Becton-Dickinson, Alphen a/d Rijn, the Netherlands).

Patients and Samples

Clinical materials were obtained from patients included in the CHIMED-study. In CHIMED (a multicenter nationwide study on the optimal treatment for children with lymphadenitis), treatment is randomized ran·dom·ize  
tr.v. ran·dom·ized, ran·dom·iz·ing, ran·dom·iz·es
To make random in arrangement, especially in order to control the variables in an experiment.
 between surgical and medical treatment. Pediatric patients were included on the basis of clinical appearance of atypical mycobacterial lymphadenitis and a positive skin test (13,14). Fine needle aspirates were taken from affected lymph nodes Lymph nodes
Small, bean-shaped masses of tissue scattered along the lymphatic system that act as filters and immune monitors, removing fluids, bacteria, or cancer cells that travel through the lymph system.
. In patients who underwent surgical treatment, the removed lymph nodes were also submitted for investigation. A control group to assess the specificity of the assay was assembled from 50 patients with lymphadenitis caused by Bartonella henselae Bartonella henselae Rochalimaea henselae Infectious disease A slender, fastidious coccobacillary bacterium of the normal flora of cats associated with bacteremia, endocarditis, cat-scratch disease, bacillary angiomatosis, peliosis hepatis; it may affect .

Mycobacterial Diagnostics

Clinical materials were decontaminated with a Nalc-NaOH decontamination decontamination /de·con·tam·i·na·tion/ (de?kon-tam-i-na´shun) the freeing of a person or object of some contaminating substance, e.g., war gas, radioactive material, etc.

de·con·tam·i·na·tion
n.
 protocol (15). Auramine staining was performed on the decontaminated materials for detection of acid-fast rods. Standard mycobacterial culturing was performed at 35[degrees]C in liquid MGIT medium and on solid LJ medium. M. haemophilum specific culturing was performed at 30[degrees]C on LJ medium with added iron citrate and in MGIT medium with X-factor-strip added. Mycobacterial species were identified by using the InnoLipa and more recently using the Inno-Lipa V2 assay (InnoGenetics, Gent, Belgium) (16). When no growth was detected after 12 weeks of incubation, the culture results were listed as negative. Samples were also investigated for the presence of other bacterial pathogens by conventional bacterial cultures and by PCR for B. henselae (17).

Nucleic Acid nucleic acid, any of a group of organic substances found in the chromosomes of living cells and viruses that play a central role in the storage and replication of hereditary information and in the expression of this information through protein synthesis.  Isolation

All clinical materials were processed as described in Bruijnesteijn et al. (8). DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 was extracted from bacterial strains and clinical materials according to the method of Boom et al. (18) with an overnight incubation with proteinase proteinase /pro·tein·ase/ (pro´ten-as?) endopeptidase.

pro·tein·ase
n.
A protease that begins the hydrolytic breakdown of proteins usually by splitting them into polypeptide chains.
 K.

Primers and Probes

Genus-specific primers for sequencing the total ITS region of mycobacteria were described by Frothingham et al. (19). Primers described previously for a genus-specific real-time PCR (8) were also used for sequencing a part of the ITS region directly from clinical materials. Using these primer sets combined, we applied a seminested PCR approach to increase the amount of amplicon. The part of the ITS region used in this real-time PCR shows considerable variation between mycobacterial species (20) (Figure). The primers used in the real-time PCR are genus-specific, and for the design of the M. haemophilum--specific minor groove binding (MGB MGB Mini-Gastric Bypass
MGB Minor Groove Binder (molecular biology)
MGB Manual Gearbox
MGB Matthew Good Band
MGB May God Bless
MGB Medial Geniculate Body
MGB Medium Girder Bridge
MGB Motor Gun Boat
MGB Microsoft Global Briefing
) probe, the intraspecies in·tra·spe·cif·ic   also in·tra·spe·cies
adj.
Arising or occurring within a species: intraspecific competition.

Adj. 1.
 and interspecies variation in the amplified ITS region was investigated. Alignments were made of the sequences of the M. haemophilum strains and of different mycobacterial species. The Mycobacterium genus-specific probe is described in Bruijnesteijn et al. (8).

The M. haemophilum--specific probe sequence was checked by using the primer 3 program (http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi/) (21) and oligo-analyzer 3.0 (http://biotools.idtdna.com/ analyzer/) (IDT IDT Integrated Device Technology, Inc. (Santa Clara, CA, USA)
IDT I Don't Think
IDT Identity Theft
IDT Interrupt Descriptor Table
IDT Integrated DNA Technologies
IDT Inactive Duty Training
IDT Instructional Design & Technology
 Biotools, Coralville, IA), to ensure minimal self-complementary binding and to prevent the presence of secondary structures. By using the unique features of the MGB group (22), a short and highly specific probe could be designed. The probe was designed on the anti-sense strand to ensure an A/T rich MGB-site. An NCBI NCBI National Center for Biotechnology Information (NIH)
NCBI National Coalition Building Institute
NCBI National Council for the Blind of Ireland (Dublin, Ireland) 
 BLAST search was performed to check the specificity of the probe. The primers were prepared by Biolegio (Biolegio, Malden, the Netherlands), and the MGB probe was generated by ABI Abi (ā`bī) [short for Abijah], in the Bible, King Hezekiah's mother.


(Application Binary Interface) A specification for a specific hardware platform combined with the operating system.
 (Applied Biosystems Inc, Nieuwekerk a/d IJssel, The Netherlands). The broad range primers P1 and P4 were used for 16S sequencing. Primers and probes are listed in Table 1, and their positioning in the genome is illustrated in the Figure.

Sensitivity Testing

A plasmid with the ITS sequence of M. haemophilum was prepared by cloning the PCR product in a vector and was subsequently quantified (IQ corporation, Groningen, the Netherlands). Dilution series of this plasmid were tested in duplicate in the genus-specific and the M. haemophilum specific real-time PCR.

Sequence Analysis

After amplification, PCR products were subjected to a cycle sequencing reaction with the Big Dye Terminator Cycle Sequencing ready reaction kit (Applied Biosystems). Samples underwent electrophoresis and sequences were detected and analyzed on ABI model 310 DNA sequencer (Applied Biosystems).

Real-time PCR

Real-time PCR was performed in 50 [micro]L of reaction mixture consisting of 25 [micro]L of 2x IQ supennix (Bio-Rad, Veenendaal, the Netherlands), 20 pmol of each primer, 12.5 pmol of the genus-specific probe or 10 pmol of the M. haemophilum--specific probe, and 10 [micro]L template. The PCR thermal profile consisted of an initial incubation of 3 min at 95[degrees]C for activation of the enzyme, followed by 50 cycles of 30 s at 95[degrees]C, 40 s at 55[degrees]C, and 30 s at 72[degrees]C. Amplification, detection, and data analysis were performed with an iCycler IQ real-time detection system (Bio-Rad). The reaction mix and PCR profile were similar for both the genus-specific probe and the M. haemophilum probe.

Each DNA extract was tested by real-time PCR for the detection of the genus Mycobacterium and species M. haemophilum. As positive control for the genus-specific real-time PCR and extraction protocol, a dilution of M. bovis was used.

Results

Identification of M. haemophilum in Patient Material

In 16 (18%) of 89 patients from the CHIMED study, a mycobacterial infection was suspected, but initially no species identification could be established. After a positive signal was generated by the genus-specific real-time PCR and negative results from the cultures, the amplicons generated in real-time PCR were sequenced to determine the species. Sequencing of the ITS fragment formed in the real-time PCR was difficult, owing to the small amount of amplicon, but eventually the sequences of 4 patient samples were successfully derived. On 4 more samples, a seminested PCR was performed to increase the amount of specific amplicon. This enhancement of PCR resulted in the successful amplification and sequencing of all fragments. No variation was encountered between the ITS sequences of all 8 strains analyzed here. Because no M. haemophilum ITS sequences were available in the public databases, 3 complete ITS sequences from M. haemophilum strains isolated from different CHIMED patients were determined and submitted to the NCBI database (accession no. AY579398, AY579399, and AY579400). After specific culturing, the identity of the strains was confirmed by comparing partial 16S-gene sequences to the sequences in the NCBI (http://www.ncbi.nlm.nih.gov/) and the RIDOM database (http://www.ridom.com/). A variable part of the 16S gene of 330 base pairs was analyzed, and a 100% agreement was obtained with 16S sequences of 7 available M. haemophilum strains, including ATCC ATCC American Type Culture Collection, see there  29548. The M. haemophilum strains had at least 4 mismatches in the analyzed 16S PCR fragment in comparison to other mycobacterial species; therefore, all these strains were M. haemophilum. The identity was also confirmed because of a minimum of 4 mismatches in the 16S fragment between the M. haemophilum sequence and other mycobacterial species.

Application of Real-time PCR to the Recognition of M. haemophilum

The real-time PCR was designed to the ITS region. The same conserved primers were used as described previously. The obtained ITS sequences were used to select an M. haemophilum--specific probe.

The detection limit of the M. haemophilum--specific real-time PCR was assessed at 1 copy per reaction by using a dilution series of the plasmid standard. The mycobacterial genus--specific PCR was tested simultaneously with the M. haemophilum--specific PCR and resulted in the same analytical sensitivity. As determined previously, the sensitivity of the primer set in clinical materials was estimated to be 1,100 CFU CFU

see colony-forming units.
 in pus pus, thick white or yellowish fluid that forms in areas of infection such as wounds and abscesses. It is constituted of decomposed body tissue, bacteria (or other micro-organisms that cause the infection), and certain white blood cells.  (8). Specificity testing of the M. haemophilum-specific real-time PCR with 25 other species and subspecies showed no aspecific reactions. All 50 Bartonella-positive samples from the control group remained negative in the real-time PCR assay as well.

Of 16 patients with evidence for M. haemophilum infection, 9 (56%) were positive on auramine staining, and 9 (56%) were positive in M. haemophilum--specific cultures. In addition, in 1 patient (6%), the pathogen was able to grow on and in normal mycobacterial cultures. Thirteen patients (81%) had positive specimens in mycobacterial genus-specific real-time PCR, 11 of which were also positive in the M. haemophilum-specific real-time PCR (Table 2). In contrast, 2 genus-specific M. haemophilum-negative specimens were positive in the M. haemophilum-specific real-time PCR. Thus, the 2 PCRs combined yielded 15 positive (94%) patients. These 4 samples with inconsistent results all had high threshold cycle values, indicating that the amount of bacterial DNA present was close to the detection limit of the assays. This finding was confirmed by retesting the samples 5 times in both PCRs, which yielded 2 or 3 positive reactions in the genus-specific PCR and in the M. haemophilum-specific PCR. No correlation was found between the threshold cycle values in the real-time PCR assay and the culture or auramine-staining results. All 9 patients with positive specimens by auramine staining also had positive results in the real-time PCR assay. Three patients' conditions were diagnosed by real-time PCR only. Only 1 patient had a positive culture while results of the real-time PCR or auramine staining remained negative. Real-time PCR on the isolate cultured from this patient resulted in a positive signal.

The M. haemophilum-specific culturing method was less sensitive than the real-time PCR assay. The materials from the first 6 patients were cultured specifically for M. haemophilum after negative results were obtained from conventional culturing methods. The stored decontaminated materials were thawed and incubated at 30[degrees]C on enriched media. From these 6 patients, 2 samples (33%) yielded positive cultures. The materials from the 10 other patients were cultured directly and yielded positive results from 7 (70%) patients. M. haernophilum--specific real-time PCR was performed additionally on all positive cultures to confirm the specific growth of M. haemophilum.

From the 16 patients positive for M. haemophilum, 22 samples were collected: 9 tissue biopsy specimens and 13 fine needle aspirates. Of these samples, 19 (86%) were positive in the real-time PCR assay, while 11 (50%) samples yielded positive results in auramine staining and 9 (36%) were positive in culture. No discrepancies were encountered in the real-time PCR assay when all samples instead of patients were considered. Application of the real-time PCR assay increased the diagnostic yield by 23%.

Discussion

M. haemophilum was found to be the causative agent of lymphadenitis in 16 (18%) of the children included in this study. Despite the use of specific enriched culture mediums, only 9 (56%) of the 16 M. haemophilum infections were culture-positive. In contrast, the real-time PCR assay was positive in 15 (94%) patients.

M. haemophilum infection is not diagnosed frequently and is therefore not considered a common cause of lymphadenitis. However, most studies on children with mycobacterial lymphadenitis have not used optimized cultures for M. haemophilum, and infection with this species is therefore likely underdiagnosed. Nevertheless, differences in geographic distribution may also contribute to the variable prevalence of M. haemophilum. For instance, no M. haemophilum was found in children with atypical mycobacterial lymphadenitis in a study in Ohio (24), whereas in a study in Israel, M. haemophilmn was found in 12 of 29 patients (5). Both studies used appropriate culture conditions for M. haemophilum. Another reason for an underestimation of the occurrence of M. haemophihtm infections is the misleading positive skin test. M. haemophilum can induce similar reactions in the Mantoux test Man·toux test
n.
A tuberculin test in which a small amount of tuberculin is injected under the skin.



Mantoux test

a tuberculin skin test used in humans to detect prior exposure to Mycobacterium spp.
 as M. tuberculosis and could be misdiagnosed when no positive cultures are obtained (4,5).

The natural source of M. haemophilum infection is unknown. Its geographic distribution appears to be related to the occurrence of large bodies of water (6). A few natural reservoirs have been suggested (25-27), but studies focusing on the environmental reservoirs of NTM tend to culture without optimized conditions for M. haemophilum, which may be the reason the organism is rarely found. The temperature for culture is often too high (28,29), cultures do not contain heroin or iron citrate, or the incubation time is too short (30). Only 1 study detected M. haemophilum in water distribution systems, although the culture method was not optimal (26). Therefore, M. haemophilum may be widely distributed and present in several natural reservoirs; water is the most likely one (12).

M. haemophilum is slow growing, iron dependent, and has an optimal growth temperature from 30[degrees]C to 32[degrees]C. It is unable to grow on routine media such as LJ Middlebrook 7H9 and 7H10, or BACTEC broth. Media used to recover M. haemophilum on primary isolation include commercially available solid media or broth enriched with ferric ammonium citrate ferric ammonium citrate
n.
An iron-containing salt, Fe(NH4)3(C6H5O7)2, used in the treatment of some forms of anemia.
 or hemin hemin /he·min/ (he´min)
1. a porphyrin chelate of iron, derived from red blood cells; the chloride of heme. It is used to treat the symptoms of various porphyrias.

2. hematin (1).
 (31). Chocolate agar and lysed blood agar blood agar
n.
A nutrient culture medium that is enriched with whole blood and used for the growth of certain strains of bacteria.
 are mentioned as inexpensive and suitable alternatives (32,33). Little is known about the sensitivities of direct culturing of clinical materials for the recovery of M. haemophilum, and not all media have equal capacity for stimulating the growth (34).

Because application of culture conditions specific for M. haemophilum are not likely to become standard in clinical microbiologic laboratories, including this specific diagnosis might be useful for molecular methods. A species-specific real-time PCR was developed to identify M. haemophilum directly in patient materials. Because M. haemophihtm was not expected to be an important pathogen, no specific culturing was applied initially. After the recognition of M. haemophilum by molecular methods, the culture methods were optimized, which resulted in 70% positive cultures. Additionally, all stored decontaminated materials from culture-negative specimens were recultured under M. haemophilum-specific conditions. Most likely because of these additional freezing and thawing steps, cultures were less sensitive for these materials and resulted in 33% positive cultures.

Identification of M. haemophilum in patient materials was performed by 16S sequencing (of cultures) and ITS sequencing. Two versions of a commercial reverse line hybridization hybridization /hy·brid·iza·tion/ (hi?brid-i-za´shun)
1. crossbreeding; the act or process of producing hybrids.

2. molecular hybridization

3.
 assay (the Inno-Lipa assay and the V2 InnoLipa assay) were also used for the recognition of M. haemophilum, but these tests can only be applied on cultured isolates. The V2 Inno-Lipa can identify M. haemophilum by a specific probe, which was absent in the previous version of the Inno-Lipa assay. The reactions were uniformly positive only for M. haemophilum in the V2 Inno-Lipa.

The design of the real-time PCR MGB probe was based on the ITS sequences that were obtained from the patient materials and reference strains. An MGB probe enables specific detection of the target by using a shorter sequence than that of a TaqMan probe or a molecular beacon.

Sequencing of the ITS amplicons from the genus-specific real-time PCR on patient samples was difficult because of the small amounts of target sequence. To enhance the specific amplification, a seminested PCR was applied. Of the 8 clinical samples from which sequences were obtained, 4 samples also yielded positive cultures once the culture protocol was optimized. The ITS and 16S sequences derived from the cultured isolates confirmed the authenticity of the identified pathogen.

In this study, both fine needle aspiration fine needle aspiration Diagnostics A method of in which a thin or “skinny”–18- to 23-gauge needle is used to suck in cells or tissue bits for diagnoses; the sites selected for FNAs are often guided by radiologists with fluoroscopy, CT, MRI  and excisional biopsy excisional biopsy A surgical procedure intended to completely remove–ie, excise a lesion submitted for pathological evaluation; in EBs, the nature of the lesion–ie benign vs malignant is often unknown at the time of operation, and thus the margin of  were not applied as treatment options but as diagnostic procedures. Complete surgical excision of the affected lymph nodes is considered as the treatment of choice for atypical mycobacterial lymphadenitis (1,35,36). However, surgical excision leaves scarring and carries the risk of damaging branches of the peripheral facial nerves (37,38). Antimicrobial therapy as a conservative treatment is currently the topic of our study. Incision and drainage Incision and drainage is a minor surgical procedure to release pus or pressure built up under the skin, such as from an abscess or boil. It is performed by treating the area with an antiseptic, such as iodine based solution, and then making a small incision to puncture the skin  increase the risk for sinus tract Sinus tract
A narrow, elongated channel in the body that allows the escape of fluid.

Mentioned in: Actinomycosis
 formation or recurrence of infection (33,35). This risk also applies to fine needle aspiration, but the usage of fine needle aspirate as·pi·rate
v.
To take in or remove by aspiration.

n.
A substance removed by aspiration.


Aspirate
The removal by suction of a fluid from a body cavity using a needle.
 for PCR will provide a rapid diagnosis and thereby allow treatment to begin earlier and thus lower the risk for complications.

In conclusion, for detecting and identifying M. haemophilum, real-time PCR is a sensitive and specific assay suitable for direct application on clinical materials. In this study, by using the real-time PCR, M. haemophilum was shown to be an important pathogen involved in lymphadenitis. Because of special growth requirements, the clinical spectrum of diseases associated with M. haemophilum is largely unknown. Real-time PCR may be particularly useful for testing clinical samples such as sputum sputum /spu·tum/ (spu´tum) [L.] expectoration; matter ejected from the trachea, bronchi, and lungs through the mouth.

sputum cruen´tum  bloody sputum.
, cerebrospinal fluid cerebrospinal fluid (CSF)

Clear, colourless liquid that surrounds the brain and spinal cord and fills the spaces in them. It helps support the brain, acts as a lubricant, maintains pressure in the skull, and cushions shocks.
, and synovial fluid synovial fluid: see joint.  for M. haemophilum to determine the role of M. haemophilum in more detail.
Table 1. Sequences of oligonucleotides used in this study *

                                                            Target
Primer                      Probe sequence (5'-3')          sequence

ITS forward primer          GGGGTGTGGTGTTTGAG               Partial ITS
real-time PCR

ITS reverse primer          CTCCCACGTCCTTCATC               Partial ITS
real-time PCR

Forward primer Ec16S.1390p  TTGTACACACCGCCCGTCA             Total ITS
([dagger])

Reverse primer Mb23S.44n    TCTCGATGCCAAGGCATCCACC          Total ITS
([dagger])

16S forward primer P1       TAACACATGCAAGTCGAACG            16S
([double dagger])

16S reverse primer P4       TCGTTGCGGGACTTAACCCAAC          16S
([double dagger])

Mycobacterium               Fam-GGATAGTGGTTGCGAGCATC-Tamra  ITS
genus-specific TaqMan
probe

Mycobacterium               VIC-ACGCCACCATTACT-MGB          ITS
haemophilum-specific
MGB-probe

* ITS, internal transcribed spacer.

([dagger]) Primers published in (19).

([double dagger]) Primers published in (23).

Table 2. Results of diagnostics tests of 16 Mycobacterium
haemophilum-positive patients

M. haemophilum-                Acid-fast              Culture
positive patient               staining           30[degrees]C *

1                                  +               -
2                                  -               +
3                                  +               -
4                                  -               -
5                                  -               -
6                                  +               +
7                                  +               -
8                                  +               + ([dagger])
9                                  +               +
10                                 +               +
11                                 +               -
12                                 -               +
13                                 -               +
14                                 -               -
15                                 -               +
16                                 +               +
Total positive patients            9               9

                                                  M. haemophilum-
M. haemophilum-             Genus-specific           specific
positive patient             real-time PCR         real-time PCR

1                         +                     +
2                         -                     -
3                         +                     +
4                         +                     +
5                         +                     +
6                         +                     +
7                         +                     +
8                         +                     +
9                         + ([double dagger])   - ([double dagger])
10                        - ([double dagger])   + ([double dagger])
11                        + ([double dagger])   - ([double dagger])
12                        - ([double dagger])   + ([double dagger])
13                        +                     +
14                        +                     +
15                        +                     +
16                        +                     +
Total positive patients   13                    13

* Lowenstein-Jensen (LJ) medium with added iron citrate or liquid
MGIT medium with X-factor-strip added. Cultures at 30[degrees]C
were performed after storage for patients 1 to 6.

([dagger]) Patient material was also culture positive at
35[degrees]C.

([double dagger]) Because of discrepant polymerase chain reaction
(PCR) results with high threshold cycle values, the PCR was
performed 5 times on these samples, which resulted in at least 2
specific positive signals for both PCRs on every sample. Therefore,
the amount of mycobacterial DNA is estimated at the detection limit
of the assay. The first obtained PCR result is described in the
table.


Acknowledgments

We thank Kate Templeton for her help in the development of the real-time PCR and D. van Soolingen and F. Portaels for the reference strains.

This work was supported by a grant from the Foundation Microbiology Leiden. Ms. Bruijnesteijn's work is performed in collaboration with the National Mycobacterial Reference Laboratory (D. van Soolingen, RIVM RIVM Rijksinstituut voor Volksgezondheid en Milieu , the Netherlands).

References

(1.) American Thoracic Society American Thoracic Society (ATS ), established in 1905, is an independently incorporated, international, educational and scientific society, serving its 18,000 members world-wide who are dedicated in respiratory and critical care medicine. . Diagnosis and treatment of disease caused by nontuberculous mycobacteria. Am J Respir Crit Care Med. 1997(Suppl);156:S1-25.

(2.) Dawson DJ, Blacklock ZM, Kane DW. Mycobaeterium haemophilum causing lymphadenitis in an otherwise healthy child. Med J Aust. 1981;2:289-90.

(3.) Thibert k, Lebel F, Martineau B. Two cases of Mycobacterium haemophilum infection in Canada. J Clin Microbiol. 1990;28:621-3.

(4.) Armstrong KL, James RW, Dawson DJ, Francis PW, Masters B. Mycobaeterium haemophilum causing perihilar or cervical lymphadenitis in healthy children. J Pediatr. 1992;121:202-5.

(5.) Haimi-Cohen Y, Zeharia A, Mimouni M, Soukhman M, Amir J. Skin indurations in response to tuberculin testing in patients with nontuberculous mycobacterial lymphadenitis. Clin Infect Dis. 2001;33:1786-8.

(6.) Saubolle MA, Kiehn TE, White MH, Rudinsky MF, Armstrong D. Mycobacterium haemophilum: microbiology and expanding clinical and geographic spectra of disease in humans. Clin Microbiol Rev. 1996;9:435-47.

(7.) van de Griendt EJ, Rietra PJ, van Andel RN, Mycobacterium haemophilum as the cause of lymphadcnitis in the neck in an otherwise healthy boy. Ned Tijdschr Geneeskd. 2003;147:1367-9.

(8.) Bruijnesteijn van Coppenraet ES, Lindeboom JA, Prins JM, Peeters MF, Claas ECJ ECJ European Court of Justice , Kuijper EJ. Real-time PCR assay using fine-needle aspirates and tissue biopsy specimens for rapid diagnosis of mycobacterial lymphadenitis in children. J Clin Microbiol. 2004;42:2644-50.

(9.) Samra Z, Kaufman L, Bechor J, Bahar J. Comparative study of three culture systems for optimal recovery of mycobacteria from different clinical specimens. Eur J Clin Microbiol Infect Dis. 2000;19:750-4.

(10.) Sampaio JL, Alves VA, Leao SC, De Magalhaes VD, Martino MD, Mendes CM, et al. Mycobacterium haemophilum: emerging or under-diagnosed in Brazil? Emerg Infect Dis. 2002;8:1359-60.

(11.) Shah MK, Sebti A, Kiehn TE, Massarella SA, Sepkowitz KA. Mycobacterium haemophilum in immunocompromised immunocompromised /im·mu·no·com·pro·mised/ (-kom´pro-mizd) having the immune response attenuated by administration of immunosuppressive drugs, by irradiation, by malnutrition, or by certain disease processes (e.g., cancer).  patients. Clin Infect Dis. 2001;33:330-7.

(12.) Dobos KM, Quinn FD, Ashford DA, Horsburgh CR, King CH. Emergence of a unique group of necrotizing necrotizing /nec·ro·tiz·ing/ (nek´ro-tiz?ing) causing necrosis.
Necrotizing
Causing the death of a specific area of tissue. Human bites frequently cause necrotizing infections.
 mycobacterial diseases. Emerg Infect Dis. 1999;5:367-78.

(13.) von Reyn CF, William DE, Horsburgh CR Jr, Jaege AS, Mars BJ, Haslov K, et al. Dual skin testing with Mycobacterium avium sensitin and purified protein derivative purified protein derivative

see purified protein derivative of tuberculin.
 to discriminate pulmonary disease due to M. avium complex from pulmonary disease due to Mycobacterium tuberculosis Mycobacterium tuberculosis
n.
Tubercic bacillus.


Mycobacterium tuberculosis
. J Infect Dis. 1998;177:730-6.

(14.) Hansen KN, Heltberg I, Hjelt K. Sensitivity to tuberculin tuberculin /tu·ber·cu·lin/ (-lin) a sterile solution containing the growth products of, or specific substances extracted from, the tubercle bacillus; used in various forms in the diagnosis of tuberculosis; see also under test.  and sensitins from atypical mycobacteria (M. chelonae subsp, abscessus, M. avium, M. intracellulare, M. scrofulaceum) in 100 Danish school children. Dan Med Bull. 1989;36:399-401.

(15.) Kubica GP, Dye WE, Cohn ML, Middlebrook G. Sputum digestion and decontamination with N-acetyl-L-cysteine-sodium hydroxide for culture of mycobacteria. Am Rev Resp Dis. 1963;87:775-9.

(16.) Tortoli E, Mariottini A, Mazzarelli G. Evaluation of INNO-LiPA MYCOBACTERIA v2: improved reverse hybridization multiple DNA probe DNA probe
An agent that binds directly to a predefined sequence of nucleic acids.

Mentioned in: Legionnaires' Disease

DNA probe,
n See deoxyribonucleic acid probes.
 assay for mycobacterial identification. J Clin Microbiol. 2003;41:4418-20.

(17.) Bergmans AM, Groothedde JW, Schellekens JF, van Embden JD, Ossewaarde JM, Schouls LM. Etiology of cat scratch disease cat scratch disease
n.
An infectious disease that may follow the scratch or bite of a cat, producing localized inflammation of lymph nodes and a low-grade fever. Also called benign inoculation lymphoreticulosis, cat scratch fever.
: comparison of polymerase chain reaction detection of Bartonella (formerly Rochalimaea) and Afipia felis DNA with serology Serology

The division of biological science concerned with antigen-antibody reactions in serum. It properly encompasses any of these reactions, but is often used in a limited sense to denote laboratory diagnostic tests, especially for syphilis.
 and skin tests. J infect Dis. 1995;171:916-23.

(18.) Boom R, Sol CJ, Salimans MM, Jansen CL, Wertheim-van Dillen PM, van der Noordaa J. Rapid and simple method for purification of nucleic acids Nucleic acids
The cellular molecules DNA and RNA that act as coded instructions for the production of proteins and are copied for transmission of inherited traits.
. J Clin Microbiol. 1990;28:495-503.

(19.) Frothingham R, Wilson KH. Sequence-based differentiation of strains in the Mycobacterium avium complex Mycobacterium avium complex (MAC) is a group of genetically-related bacteria belonging to the genus Mycobacterium. It includes Mycobacterium avium subspecies avium (MAA), Mycobacterium avium subspecies hominis (MAH), and . J Bacteriol. 1993;175:2818-25.

(20.) Roth A, Fischer M, Hamid ME, Michalke S, Ludwig W, Mauch H. Differentiation of phylogenetically phy·lo·ge·net·ic  
adj.
1. Of or relating to phylogeny or phylogenetics.

2. Relating to or based on evolutionary development or history: a phylogenetic classification of species.
 related slowly growing mycobacteria Mycobacteria that form colonies clearly visible to the naked eye in more than 7 days on subculture are termed slow growers. List of slowly growing Mycobacteria
Nonchromogenic
Rough
  • Mycobacterium africanum
  • Mycobacterium bovis
 based on 16S-23S rRNA gene internal transcribed spacer sequences. J Clin Microbiol. 1998;36:139-47.

(21.) Rozen S, Skaletsky HJ. Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S, editors. Bioinformatics methods and protocols: methods in molecular biology molecular biology, scientific study of the molecular basis of life processes, including cellular respiration, excretion, and reproduction. The term molecular biology was coined in 1938 by Warren Weaver, then director of the natural sciences program at the Rockefeller . Totowa (NJ): Humana Press; 2000. p. 365-86.

(22.) Kutyavin IV, Afonina IA, Mills A, Gorn VV, Lukhtanov EA, Belousov ES, et al. 3'-minor groove binder-DNA probes increase sequence specificity at PCR extension temperatures. Nucleic Acids Res. 2000;28:655-61.

(23.) Kuijper EJ, Stevens S, Imamura T, De Wever B, Claas EC. Genotypic identification of erythromycin-resistant Campylobacter Campylobacter

Genus of gram-negative spiral-shaped bacteria infecting mammals. Many species, especially C. fetus, cause miscarriage in sheep and cattle. C. jejuni is a common cause of food poisoning. Sources include meats (particularly chicken) and unpasteurized milk.
 isolates as Helicobacter species and analysis of resistance mechanism. J Clin Microbiol. 2003;41:3732-6.

(24.) Wolinsky E. Mycobacterial lymphadenitis in children: a prospective study of 105 nontuberculous cases with long-term follow-up. Clin Infect Dis. 1995;20:954-63.

(25.) Smith S, Taylor GD, Fanning EA. Chronic cutaneous cutaneous /cu·ta·ne·ous/ (ku-ta´ne-us) pertaining to the skin.

cu·ta·ne·ous
adj.
Of, relating to, or affecting the skin.


Cutaneous
Pertaining to the skin.
 Mycobacterium haemophilum infection acquired from coral injury. Clin Infect Dis. 2003;37:e100-1.

(26.) Falkinham JO 3rd, Norton CD, LeChevallier MW. Factors influencing numbers of Mycobacterium avium, Mycobacterium intracellulare, and other mycobacteria in drinking water drinking water

supply of water available to animals for drinking supplied via nipples, in troughs, dams, ponds and larger natural water sources; an insufficient supply leads to dehydration; it can be the source of infection, e.g. leptospirosis, salmonellosis, or of poisoning, e.g.
 distribution systems. Appl Environ Microbiol. 2001;67:1225-31.

(27.) Pal HH, Chen WC, Peng CF. Isolation of non-tuberculous mycobacteria from hospital cockroaches cockroaches

insects which may carry Salmonella spp. in their gut and play a part in the spread of the disease.
 (Periplaneta americana). J Hosp Infect. 2003;53:224-8.

(28.) Chang CT, Wang LY, Liao CY, Huang SP. Identification of non-tuberculous mycobacteria existing in tap water by PCR-restriction fragment length polymorphism. Appl Environ Microbiol. 2002:68:3159-61.

(29.) Covert TC, Rodgers MR, Reyes AL, Stelma GN Jr. Occurrence of nontuberculous mycobacteria in environmental samples Appl Environ Microbiol. 1999;65:2492-6.

(30.) Carson LA, Bland LA, Cusick LB, Favero MS, Bolan GA, Reingold AL, et al. Prevalence of nontuberculous mycobacteria in water supplies of hemodialysis centers. Appl Environ Microbiol. 1988;54:3122-5.

(31.) Vadney FS, Hawkins JE. Evaluation of a simple method for growing Mvcobacterium haemophilum. J Clin Microbiol. 1985:22:884-5.

(32.) Murray PR. Manual of clinical microbiology, 8th ed. Washington: ASM (1) (Association for Systems Management) An international membership organization based in Cleveland, Ohio. Founded in 1947 and disbanded in 1996, it sponsored conferences in all phases of administrative systems and management.  Press; 2003.

(33.) Dawson DJ, Jennis F. Mycobacteria with a growth requirement for ferric ammonium citrate, identified as Mycobacterium haemophilum. J Clin Microbiol. 1980;11:190-2.

(34.) McBride JA, McBride M, Wolf JE. Evaluation of commercial blood-containing media for cultivation of Mycobacterium haemophilum. Am J Clin Pathol. 1992;98:282-6.

(35.) Kvaerner KJ, Kvestad E, Orth M. Surgery required to verify atypical mycobacterial infections Mycobacterial Infections, Atypical Definition

Atypical mycobacterial infections are infections caused by several types of mycobacteria similar to the germ that causes tuberculosis.
. Int J Pedriatr. Otorhinolaryngology otorhinolaryngology /oto·rhi·no·lar·yn·gol·o·gy/ (-ri?no-lar?ing-gol´ah-je) the branch of medicine dealing with the ear, nose, and throat.

o·to·rhi·no·lar·yn·gol·o·gy
n.
. 2001:61:121-8.

(36.) Rahal A, Abela A, Arcand PH, Quintal QUINTAL. A weight of one hundred pounds  MC, Lebl MH, Tapier BF. Nontuberculous mycobacterial adenitis adenitis /ad·e·ni·tis/ (ad?e-ni´tis) inflammation of a gland.

Bartholin adenitis  inflammation of the greater vestibular gland (Bartholin's gland) resulting from acute infection of the gland.
 of the head and neck in children. Laryngoscope la·ryn·go·scope
n.
A tubular endoscope that is inserted through the mouth and into the larynx and that is used for examining the interior of the larynx.



la·ryn
. 2001;111:1791-6.

(37.) Berger C, Pfyffer GE, Nadal D. Treatment of nontuberculous mycobacterial lymphadenitis with clarithromycin plus rifabutin. J Pediatr. 1996:128:383-6.

(38.) Lindeboom JA, de gange J, van den Akker HP. Clarithromycin as a single-modality treatment in mycobacterial avium-intracellulare infections. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 1999:87:50-54.

Lesla E.S. Bruijnesteijn van Coppenraet, * Edward J. Kuijper, * Jerome A. Lindeboom, ([dagger]) Jan M. Prins, ([dagger]) and Eric C. J. Claas *

* Leiden University Medical Center The Leiden University Medical Center (Dutch: Leids Universitair Medisch Centrum) or LUMC, is the university hospital affiliated with Leiden University, of which it forms the medical faculty. , Leiden, the Netherlands; and ([dagger]) Academic Medical Centre, Amsterdam, the Netherlands

Address for correspondence: E.J. Kuijper, Department of Medical Microbiology. Center of Infectious Diseases, LUMC LUMC Leids Universitair Medisch Centrum
LUMC Leiden University Medical Center
LUMC Loyola University Medical Center
LUMC Lakewood United Methodist Church
LUMC Littleton United Methodist Church (Littleton, Colorado) 
 Albinudreef 2, 2333 ZA Leiden. the Netherlands; fax: +3171 5248148; e-mail: e.j.kuijper@lume.nl

Ms. Bruijnesteijn is Ph.D. candidate in the Department of Medical Microbiology at Leiden University Medical Center. Her main area of research interest is atypical mycobacteria.
COPYRIGHT 2005 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2005, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Research
Author:Claas, Eric C.J.
Publication:Emerging Infectious Diseases
Geographic Code:1USA
Date:Jan 1, 2005
Words:4727
Previous Article:Genetic background of Escherichia coli and extended-spectrum [beta]-lactamase type.(Research)
Next Article:HEPA/vaccine plan for indoor anthrax remediation.(Research)
Topics:



Related Articles
Emergence of a Unique Group of Necrotizing Mycobacterial Diseases.
Nontuberculous Mycobacterial disease following hot tub exposure. (Dispatches).
Mycobacterium celatum pulmonary infection in the immunocompetent: case report and review. (Dispatches).
Mycobacterium xenopi pneumonia in the Southeastern United States. (Case Report).
Mycobacterium lentiflavum infection in immunocompetent patient.(Dispatches)
Mycobacterium abscessus and other nontuberculous mycobacteria: evolving respiratory pathogens in cystic fibrosis: a case report and review.(Case...
Spoligotyping and Mycobacterium tuberculosis.(RESEARCH)
Mycobacterium neoaurum contamination.(LETTERS)(Letter to the Editor)
Multidrug-resistant tuberculosis detection, Latvia.(DISPATCHES)
Vaccination-related Mycobacterium bovis BCG infection.(LETTERS)(Disease/Disorder overview)

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles