Printer Friendly

Molecular typing of Mycobacterium leprae strains from northern India using short tandem repeats.

Leprosy, a chronic infection caused by Mycobacterium leprae, is one of the oldest recorded diseases of humankind. According to official reports received during 2008 from 118 countries and territories, the global registered prevalence of leprosy at the beginning of 2008 stood at 212,802 cases, while the number of new cases detected during 2007 was 254,525 (excluding the small number of cases in Europe). The number of new cases detected globally has fallen by 11,100 cases (4% decrease) during 2007 compared with 2006 (1). In India, with the widespread use of multi-drug treatment (MDT) the elimination target has been achieved at the national level with a recorded prevalence of 0.83/10,000 population (2). However, some pockets of endemicity still remain in certain areas (3). Most of these remaining pockets of endemicity have been reported to be present in States of Bihar, parts of Uttar Pradesh, some parts of West Bengal, Jharkhand and Orissa (4,5). This indicates the continued transmission of the disease in these areas.

The exact mode/mechanism of transmission of M. leprae is unknown. Since M. leprae cannot be cultured in vitro and it has a long as well as highly variable incubation period, it has been difficult to assess time of exposure, onset of infection and various aspects of disease progression.

During the last 20 years, several molecular assays have been developed for detection and analysis of M. leprae directly from patient specimens. These assays have been primarily based on the amplification of M. leprae specific sequences using polymerase chain reaction (PCR) and identification of variation in the M. leprae DNA (6). Several genotyping methods have been/are being developed and used for genotyping of M. leprae (7-16). These techniques include targets, such as TTC (7,8) rpoT (9-12) and variable number of tandem repeats (VNTRs) (13-16). While initial studies had reported very high level of resemblance among M. leprae strains from different areas, subsequent use of new markers has provided usefulness in identifying strain differences. During the last several years following completion of M. leprae genome sequencing, the complexities of genome architecture has revealed a remarkable degree of structure variation present among different strains of M. leprae.

Molecular typing would not only be useful to study the global and geographical distribution of distinct clones of M. leprae, this would also provide some insight into historical and phylogenetic evolution of the bacillus (15). This information would have potential application in studying transmission dynamics. Ultimate success of the strain typing by any of these targets can only be assessed after actual investigation(s) on strains in a given geographical area. In this study, the allelic diversity of M. leprae in 10 polymorphic loci short tandem repeats (STRs) was investigated in clinical specimens obtained from leprosy patients from geographically defined areas. Slit scrapings were also studied so as to evaluate the usefulness of this simple approach of collecting specimens that would be relevant for field applications.

Material & Methods

Collection of specimens: A total of 90 specimens--70 slit scrapings and 20 biopsies positive for M. leprae specific PCR have been included in this study. These were obtained from leprosy patients who attended the Out Patient Department of Medical Unit- I of National JALMA Institute for Leprosy and Other Mycobacterial Diseases, Tajganj, Agra, and Model Rural Health Research Unit at Ghatampur (MRHRU) at Kanpur, Uttar Pradesh, India, during 2006-2007. Cases were diagnosed and classified by standard clinical criteria (17). Among these 90 specimens, 26 slit scrapings were from paucibacillary (PB) cases and 44 slit scrapings and 20 biopsies were from multibacillary (MB) cases.

Isolation of DNA:DNA was isolated from frozen biopsy (weighing approximately 100 mg) as well as from slit scrapings by following a procedure described earlier (18) as adapted by Sharma et al (18). Bacilli were disrupted by freezing and thawing, followed by enzymatic disruption by lysozyme and proteinase K and deproteinization with chloroform-isoamyl alcohol (24:1 v/v). After a brief centrifugation at 8000 g for 5 min, the upper phase was collected. DNA was then precipitated with 0.6 volume of isopropanol, washed with chilled ethanol and resuspended in 25 [micro]l of Tris-EDTA buffer before being used for PCR amplification. PCR targeting RLEP gene region was performed to confirm the diagnosis of leprosy. Positive and negative controls were included in each set of experiment.

The blade used for routine smear purpose was put in sterile 400 [micro]l of TE (pH 8.0) buffer. The material from the blade dissolved into a suspension in the TE buffer and this skin slit smear scraping suspension was used for molecular typing. DNA was extracted by similar method as for biopsies after their homogenization.

Construction of DNA Chip: A DNA Chip was developed for 37 loci targeting STRs predicted by Groathouse et al (13). For PCR amplification, primers for some of the STRs were designed earlier (9,13,20), and for rest of the STRs primers were designed by us using online software Primer3 ( STRs were amplified using these primers and the amplicons were used as spotting material to develop the DNA Chip. This DNA chip was used to screen the loci showing variability in two M. leprae strains (One reference strain and another obtained from clinical samples) by comparative genomic hybridization according to the protocol already standardized in our laboratory Cy 5 labelled DNA of standard strain Thai-53 and Cy3 labelled DNA of a lepromatous leprosy patient was used in the microarray experiments for identification of loci showing variability. The loci with a Cy5:Cy3 ratio of either >1.5 or less than <0.5 were included for further investigation for establishing the diversity.

While analyzing the diversity in 37 potential VNTRs by differences by hybridization on DNA chip, polymorphism was observed in 20 loci.

PCR amplification of STRs and sequencing: When D values were calculated with the help of Hunter Gaston Index (21), nine loci showing significant variation were identified and included in the study. One locus ML2454-55 was also included to make a comparative analysis of variability of various loci in strains from different countries.

The sequences of primer pairs for these 10 loci are listed in Table I. A total 50 [micro]l of reaction volume contained 5 [micro]l of template DNA, 200nM of each primer (forward and reverse), 10 mM tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM of Mg[Cl.sub.2], 0.2 mM dNTPs mix and 1.5U of Taq DNA polymerase (Bangalore Genei, Banglore). Following the activation step at 95[degrees]C for 5 min, 10 cycles of touchdown PCR were performed in which the annealing temperature was reduced from 68 to 58[degrees]C at a rate of 1[degrees]C per cycle. After the touchdown phase, 25 additional cycles were run at an annealing temperature of 58[degrees]C followed by a final extension at 72[degrees]C for 5 min. After PCR, the amplified fragment of the target region along with DNA ladder of 50 base pair, 25 [micro]l of PCR product were electrophoresed in a 3 per cent agarose gel (Bangalore Genei, Bangalore) using tris acetate EDTA buffer (1X) at 50 volts constant current for approximately for 2 h. After electrophoresis DNA were further eluted from gel for sequencing.

PCR amplicons for sequencing were recovered from agarose gel by MinElute Gel Extraction Kit (QIAGEN, GmbH, Germany) after electrophoresis of PCR products. Determination of sequences was performed using a Big Dye Terminator Cycle Sequencing FS Ready Reaction Kit (ABI Prism 3100 Genetic Analyzer, Perkin Elmer, USA).

Analysis of genotypic data with respect to patients/geographical distribution: Individual tandem repeats can be removed from or added to the VNTR via recombination or replication errors, leading to variants called VNTR allele with different numbers of repeats. Each variant acts as an inherited allele, allowing these to be used for personal or parental identification. In order to delineate relatedness among the north Indian strains, the VNTR data sets were subjected to phylogenetic analysis using the START (Sequence Type Analysis and Recombinational Tests, USA) software. In the START software UPGMA (Unweighted Pair Group Method with Arithmetic Mean) programme was used for analysis.

To assess the links between M. leprae strains and the likely source of infection to these leprosy patients, the unweighted pair group method with arithmetic mean (UPGMA) to produce phylogenetic trees was used. The method uses a sequential clustering algorithm (22). D (Discriminatory index) values were calculated with the help of Hunter Gaston Index (21).

Informed consent was obtained from all the patients and the study protocol was approved by the Institutional Ethical Committee.

The allelic diversity of these loci among 90 north Indian patients is summarized in Table II. While gene targets from all these specimens could be amplified by PCR, smear positivity for acid fast bacilli was observed only in 27 of 64 (42.18%) of MB patients.

Strain diversity and population structure of M. leprae in northern India: The allelic index for each locus was found to range from 0.7 to 0.8 except for rpoT (ML 1022) for which the allelic index was 0.186 (Table II). Nine alleles were detected at the ML 1182 locus, ranging from those with copy numbers of 1 to those with copy numbers of 13 (Table III). In this study, it was possible to determine repeat copy numbers for all of the loci, even from biopsies which had been scored as polar tuberculoid and with no bacilli seen by microscopy. While one allele 15-3 did not show any variation, rpoT (ML 1022) had two alleles and the remaining eight had 4-9 alleles.

Phylogenetic analysis showed evidence of clustering associated with the geographical origin of the strain detected (Fig. 1). For example, village (i) Targaoun (ii) Aranjaram (iii) Gaurikakra (iv) Katari (v) Rathgoun (vi) Tejpur (vii) Miranpur (viii) Ramsari (ix) Bhattpurwa from the same village completely similar by STRs studied.

Genotype analysisin multicase families: From analysis of strains from villages of MRHRU at Ghatampur, intrafamilial transmission appeared to occur in some cases (Table IV). Matching alleles were detected at all ten loci, indicating a common source of infection and recent transmission within the household. By the use of combination of ten STRs clustering of strains from several defined geographical areas and villages was observed. It was observed that patients belonging to the same families (Table IV, Fig. 2) had similar strains as well as subtypes whereas others had different profiles. On the other hand, allelic differences across several loci seen within patient pairs (Hirni-1 and Hirni-2; Aranjaram-5 and 6) of families suggest that the family members harboured

different strains indicating circulation of many strains in the community. It is interesting to note that Gaurikakra 1 and 2 were son and mother and infected with the same strain. Similarly, patients Hirni 1 and 2 who were also related (uncle and nephew) from the same village had same set of STRs.

In this study relapse could be successfully differentiated from possible re-infection by using these STRs. The strain of the patient (name code: JIL) was different when he was first diagnosed in 2004, treated and released from therapy. On repeat examination in 2007, the bacilli isolated from his biopsies showed different number of TTC repeats (TTC is one of STR used initially for some of the strains in the study) and other STRs indicating re-infection with new strain. It may, therefore, be interpreted that this patient may have been re-infected with a different strain circulating in the community.

Another patient (name code: DH) was treated and subsequently released from treatment after completion of schedule. Later on after reappearance of clinical symptoms, the bacilli isolated from his biopsy showed bacilli with the same number of repeats thereby indicating a case of possible relapse with the persisting organism (Table V)

Molecular typing of M. leprae presents several unique challenges and opportunities. The organism cannot be cultivated in vitro conditions and needs to be maintained by passaging in animals. Even among highly susceptible animal hosts, multiplication of M. leprae is quite slow, limited and requires several months to years to grow to a detectable bacterial mass. With such cumbersome maintenance requirements, there are relatively a few recognized M. leprae strains, and as a result very little is known about the adaptive traits or potential genetic alterations of M. leprae during long-term culture. Further, samples from leprosy patients can have many limitations. These are often of poor quality, the bacilli typically show a low per cent viability, these are frequently contaminated with other cultivable agents, and the cases may have uncertain treatment history. As M. leprae obtained through propagation in animals or derived from patient biopsies cannot be treated as a single colony, this may not represent a single clone of bacteria. In this study by focusing on STRs polymorphisms in M. leprae genome, meaningful diversity data have been generated. Only limited genetic polymorphism had been observed initially among M. leprae strains (23-25). Cole et al (6) presented an in silico analysis of M. leprae genome and showed that about 2 per cent of its chromosome consists of repetitive sequences. Such elements can be subjected to changes in size and sequence through random as well as evolutionary events and have been exploited as strain typing tools for other genetically homogeneous pathogens such as M. tuberculosis and M. bovis (26-27).

Tandem repeats are usually classified among satellites, minisatellites and microsatellites. Both micro- and minisatellite loci have been investigated in this study to identify polymorphic loci as potential markers used as the tools for molecular typing of M. leprae. However, there are limited number of studies on the application of molecular tools to trace the sources and the possible chain of transmission (16,20,25,28,29). Our data showed that loci showing polymorphism could be different in different areas. While the loci 12-5, 21-3, 18-8, and 27-5 showed polymorphism, these were not found to be polymorphic in China (25). Our data provided unique information about follow up of the cases, and relapse vs-re-infection by doing the repeat analysis on recrudence of the disease. Though the information may have greater local epidemiological application, this shows the potential of this technology to trace the sources, to address question of reinfection vs relapse and to create a larger database about the genotypes of M. leprae prevalent in India as well as all over the world, and also to the appropriate methods/loci needed to map these differences. For definitive conclusions, it would be appropriate to analyse several loci at the same time.

Clustering in strains from a family (mother and son seen in the present study) or nearby locations shows common source of infection or recent chain of transmission. While some of the strains from the same geographical area clustered, other from these geographical areas (villages) did not show such clustering suggesting circulation of different genotypes in a given area, a phenomenon commonly seen in high endemic settings when the people are exposed to different strains circulating in the community.

Analysis of these VNTR loci suggested a number of logical associations among M. leprae. The ability to link infections through bacterial genotypes raises the possibility, of using VNTRs in community-based studies on transmission of disease. However, some VNTRs appear to be hypervariable and may not be useful in either laboratory or field studies by using the Hunter Gaston Index. Others can be flanked or composed of sequences that may be problematic for reliable amplification. Certainly, little is yet known about regulation in the M. leprae genome or the influence of pseudogenes on VNTR mutation rates. Additionally, well-controlled studies with selected sets of patients or strains serially passaged in animals will be needed to describe the nature, frequency of these polymorphisms and their stability as molecular marker. The high degree of allelic diversity among M. leprae VNTRs imparts good discriminatory power for differentiating M. leprae strains. The data generated in this study suggest that genotyping has potential to become an effective tool to help monitoring drift and evolutionary changes within M. leprae strains. More in depth and prospective clinical as well as epidemiological studies need to be carried out using these loci in north India, the typing system may be useful in other settings also. Its ultimate application will require a better understanding of the biological diversity of M. leprae in different environments and cohort studies to determine linkages with actual occurrence of disease.

Authors thank ICMR (ICMR-Task Force Project No. 5/8/3(2)/2001-ECD-1), ICMR Leprosy Genomics Project (No.63/132/2001-BMS) for the financial support. Authors acknowledge the Field Staff (Shriyut Manoj, Anil Sagar, Santosh Bajpai, Kamal, Sanjay, Suresh, Mohan Pun, Vijay Pal, IA Siddiqui, Saurab, Akhilesh, Sunil, Raju and Rajendra) and other para medical staff of MRHRU, Ghatampur, for assisting in the sample collection, and thank Drs Gaurav Pratap Singh Jadaun and Pushpendra Singh for critical discussions and Shri Hari Shanker for technical help.

Received August 13, 2009

(1.) World Health Organization. Leprosy Today. Available from: (2008), accessed on February 8, 2009.

(2.) National Leprosy Eradication Programme. NLEP Data-Leprosy situation in India as on 1st April 2008. Available from:, accessed on April 1, 2008.

(3.) World Health Organization, Country Office for India. Leprosy situation in India epidemiological indicators. (2007) NLEP Indicators as on 31.06.2007. Available from:, accessed on May 8, 2009.

(4.) Kumar A, Girdhar A, Girdhar BK. Epidemiology of leprosy in urban Agra, India. Lepr Rev 2003; 74 : 31-4.

(5.) Katoch K, Sachan P, Sachan S, Parashar D, Lavania M, Sharma P, et al. Pockets of high endemicity: Unfolding of the Ghatampur story. Indian J Lepr 2005; 77 : 343-4.

(6.) Cole ST, Eiglmeier K, Parkhill J, James KD, Thomson NR, Wheeler PR, et al. Massive gene decay in the leprosy bacillus. Nature 2001; 409 : 1007-11.

(7.) Shin YC, Lee H, Lee H, Walsh GP, Kim JD, Cho SN. Variable numbers of TTC repeats in Mycobacterium leprae DNA from leprosy patients and use in strain differentiation. J Clin Microbiol 2000; 38 : 4535-8.

(8.) Lavania M, Katoch VM, Singh HB, Das R, Sharma VD, Chauhan DS, et al. Genetic polymorphism among Mycobacterium leprae strains from northern India, by using TTC repeats. Indian J Lepr 2005; 77 : 60-5.

(9.) Matsuoka M, Maeda S, Kai M, Nakata N, Chae GT, Gillis TP, et al. Mycobacterium leprae typing by genomic diversity and global distribution of genotypes. Int J Lepr Other Mycobact Dis 2000; 68 : 121-8.

(10.) Matsuoka M, Zhang L, Morris MF, Legua P, Wiens C. Polymorphism in the rpoT gene in Mycobacterium leprae isolates obtained from Latin American countries and its possible correlation with the spread of leprosy. FEMS Microbiol Letts 2005; 243 : 311-5.

(11.) Matsuoka M, Roa RI, Budiawan T, Kyaw K, Chae GT. Genotypic analysis of Mycobacterium leprae isolates from Japan and other Asian countries reveals a global transmission pattern of leprosy. FEMS Microbiol Lett 2006; 261 : 150-4.

(12.) Lavania M, Katoch K, Singh H, Das R, Gupta AK, Sharma R, et al. Predominance of three copies of tandem repeats in rpo T gene of Mycobacterium leprae from Northern India. Infect Genet Evol 2007; 7 : 627-31.

(13.) Groathouse NA, Rivoire B, Kim H, Lee H, Cho SN, Brennan PJ, et al. Multiple polymorphic loci for molecular typing of strains of Mycobacterium leprae. J Clin Microbiol 2004; 42 : 1666-72.

(14.) Truman R, Fontes AB, de Miranda AB, Suffys P, Gillis T. Genotypic variation and stability of four variable- number tandem repeats and their suitability for discriminating strains of Mycobacterium leprae. J Clin Microbiol 2004; 42 : 255-865.

(15.) Monot M, Honore N, Garnier T, Araoz R, Coppee JY, Lacroix C, et al. On the origin of leprosy. Science 2005; 308 : 1040-2.

(16.) Young SK, Ponnighaus JM, Jain S, Lucas S, Suneetha S, Lockwood DN, et al. Use of short tandem repeat sequences to study Mycobacterium leprae in leprosy patients in Malawi and India. PLoS Negl Trop Dis 2008; 2 : e214.

(17.) NLEP guidelines. Available from:, accessed on May 8, 2009.

(18.) van Soolingen D, de Haas PE, Hermans PW, Groenen PM, van Embden JD. Comparison of various repetitive DNA elements as genetic markers for strain differentiation and epidemiology of Mycobacterium tuberculosis. J Clin Microbiol 1993; 31 : 1987-95.

(19.) Sharma RK, Katoch K, Shivannavar CT, Sharma VD, Natrajan M, Bhatia AS. Comparison of sensitivity of probes targetting ribosomal RNA vs. DNA in leprosy cases. Indian J Med Microbiol 1996; 14 : 99-104.

(20.) Zhang L, Budiawan T, Matsuoka M. Diversity of potential short tandem repeats in Mycobacterium leprae and application for molecular typing. J Clin Microbiol 2005; 43 : 5221-9.

(21.) Hunter PR, Gaston MA. Numerical index of the discriminatory ability of typing systems: an application of Simpson's index of diversity. J Clin Microbiol 1988; 26 : 2465-6.

(22.) Jolley KA, Feil EJ, Chan MS, Maiden MC. Sequence type analysis and recombinational test (START). Bioinformatics 2001; 17 (Suppl 1) : 1230-1.

(23.) Williams DL, Gillis TP. A study of the relatedness of Mycobacterium leprae isolates using restriction fragment length polymorphism analysis. Acta Leprol 1989; 7 : 226-30.

(24.) Fsihi H, Cole ST. The Mycobacterium leprae genome: systematic sequence analysis identifies key catabolic enzymes, ATP-dependent transport systems and a novel polA locus associated with genomic variability. Mol Microbiol 1995; 16 : 909-19.

(25.) Weng X, Wang Z, Liu J, Kimura M, Black WC 4th, Brennan PJ, et al. Identification and distribution of Mycobacterium leprae genotypes in a region of high leprosy prevalence in China: a 3-year molecular epidemiological study. J Clin Microbiol 2007; 45 : 1728-34.

(26.) Gibson AL, Hewinson G, Goodchild T, Watt B, Story A, Inwald J, et al. Molecular epidemiology of disease due to Mycobacterium bovis in humans in the United Kingdom J Clin Microbiol 2004; 42 : 431-4.

(27.) Frothingham R, Meeker-O'Connell WA. Genetic diversity in the Mycobacterium tuberculosis complex based on variable numbers of tandem DNA repeats. Microbiology 1998; 144 : 1189-96.

(28.) Sakamuri R, Harrison J, Gelber R, Saunderson P, Brennan PJ, Balagon M, et al. A continuation: study and characterisation of Mycobacterium leprae short tandem repeat genotypes and transmission of leprosy in Cebu, Philippines. Lepr Rev 2009; 80 : 272-9.

(29.) Murthy SR, Miyako K, Wei L, Kim H, Hyeyoung L, Kiran MD, et al. Population-based molecular epidemiology of leprosy in Cebu, Philippines. J Clin Microbiol 2009; 47 : 2844-54.

Reprint requests: Dr V.M. Katoch, Secretary (Department of Health Research) & Director-General, Indian Council of Medical Research, V. Ramalingaswami Bhawan, Ansari Nagar, New Delhi 110 029, India e-mail:

Mallika Lavania, Kiran Katoch, Rahul Sharma, Pragya Sharma, Ram Das, Anuj Kumar Gupta, D.S. Chauhan & V.M. Katoch *

National JALMA Institute for Leprosy & Other Mycobacterial Diseases (ICMR), Agra, India

* Present address: Secretary (Department of Health Research) & Director-General, Indian Council of Medical Research, V. Ramalingaswami Bhawan, Ansari Nagar, New Delhi 110 029, India; e-mail: & Former Director, National JALMA Institute for Leprosy & Other Mycobacterial Diseases (ICMR), Tajganj, Agra 282 001, India
Table I. Primers used in the amplification of the short tandem repeats

Sequence (5'-3')                 Repeat      Locus    Amplicon    Tm
                                 unit (bp)            size (bp)

5 GAATCTGACCTTTCGGAAATG 3        21          21-3     312         55

5_GCCCGTCTATCCGCATCAA_3          18          18-8     348         55

5_ATTGAGCAGATGGCCGGTC_3          27          27-5     327         55

5_CTGGTCCACTTGCGGTACG_3          12          12-5     289         55

5_GCCATCGTTGTCGGTTCATC 3         6           6-7      268         62

5_GTCGCCCGGATACTGTTAAA 3         23          23-3     245         55

5_GATAAGCGTATGCGGAGACC_3         15          15-3     217         55

5_CTCGACGATCAAGCTGAGAC 3         7           7-3      250         59

5_ATGCCGAACCGGACCTCGACGTTGA_3    6           6-3a     91/97       60
5_TCGTCTTCGAGGTCGTCGAGA_3                    (rpoT)

5_GTACGCCACCAGGACAACTC_3         10          10-4     203         59

Sequence (5'-3')                 Accession no./           Reference
                                 identity                 No.

5 GAATCTGACCTTTCGGAAATG 3        ML 0058/                 13
5_CGATGCAGCTTCCTACGG_3           Pseudogene

5_GCCCGTCTATCCGCATCAA_3          ML 1334/                 13
5_GCAAAGATCAGCACGCCAAT_3         Protein coding genes

5_ATTGAGCAGATGGCCGGTC_3          ML 0568/                 13
5_AGCAGTCGGCACGCCCTT_3           Protein coding genes

5_CTGGTCCACTTGCGGTACG_3          ML 1182/                 13
5_GGAGAAGGAGGCCGAATACA_3         Protein coding genes

5_GCCATCGTTGTCGGTTCATC 3         ML 1505/                 13
5_CGGAGGAGGTGGGTACGGT_3          Protein coding genes

5_GTCGCCCGGATACTGTTAAA 3         ML 2469-70/              Present
5_TGCGATGATGCTAGCAAAGA_3         Intergenic region

5_GATAAGCGTATGCGGAGACC_3         ML 2454-55/              Present
5_GCATCGAGCTACCCAAGAAG_3         Intergenic region

5_CTCGACGATCAAGCTGAGAC 3         ML 0213/                 Present
5_CACCTAGCACGTCCTCCAAT_3         Protein coding genes

5_ATGCCGAACCGGACCTCGACGTTGA_3    ML 1022/                 9
5_TCGTCTTCGAGGTCGTCGAGA_3        Protein coding genes

5_GTACGCCACCAGGACAACTC_3         ML 0970/                 20
5_TGGCGGGCGTGCAGCCAAAC_3         Pseudogene

Table II. Allelic diversity of variable number of tandem repeats

S     Accession     Repeat     Locus    No. of     Diversity
No.   no.          unit (bp)            alleles

1     ML 0058         21       21-3        4         0.701
2     ML 0568         27       27-5        6         0.708
3     ML 2469-70      23       23-3        5         0.721
4     ML 1505          6        6-7        6         0.708
5     ML 0970         10       10-4        5         0.726
6     ML 1334         18       18-8        8         0.834
7     ML 0213          7        7-3        7         0.804
8     ML 1182         12       12-5        9         0.841
9     ML 2454-55      15       15-3       No          Nil
10    ML 1022          6        6-3        2         0.186

Table III. Variation of allelic diversity at
STR loci in M. leprae strains

Allele      0568    2469-70       0058       1334       1182
            27-5       23-3       21-3       18-8       12-5

1             --         12         20         --          8
2             --         33         44          1          7
3             10         37         23          1         12
4             11         --         --         --         10
5             47          3         --          6         32
6             18          3         --         14         15
7              1         --         --         42         --
8             --         --         --         22          1
9             --         --         --          1          1
10            --         --          1         --          2
11             1         --         --         --         --
12            --         --         --         --         --
13            --         --         --          1         --
Total          6          5          4          8          9

Allele      0213       0970       1505    2454-55       1022
             7-3       10-4        6-7       15-3        6-3

1             --          5         --         --         --
2             29         29         --         --         --
3             37         --         15         88         82
4             10         41         19         --          6
5             --          2         34         --         --
6              5         --         13         --         --
7              5         --          6         --         --
8              1         11          1         --         --
9             --         --         --         --         --
10            --         --         --         --         --
11             1         --         --         --         --
12            --         --         --         --         --
13            --         --         --         --         --
Total          7          5          6          1          2

Table IV. Alleles present at VNTR loci in
M. leprae from patients in same area

Village          Block/        ML    ML-        ML    ML-    ML-
name             State        1022   0568   2469-70   0058   1334

* Gaurikakra-1   Bhitargaon     3      4         3      2      7
Gaurikakra-2     Bhitargaon     3      4         3      2      7
Hirni-2          Patara         3      6         3      1      7
Hirni-1          Patara         3      6         1      2      6
Katari-1         Ghatampur      3      6         3      1      7
Ramsari-1        Patara         3      5         2      2      7
Ramsari-2        Patara         3      5         2      2      7
Moradabad-3      UP             3      6         3      2      7
Moradabad-5      UP             3      6         3      2      7
Aranjaram 5      Bhitargaon     3      6         3      2      7
Aranjaram 6      Bhitargaon     3      5         3      2      7
Aranjaram 2      Bhitargaon     3      6         3      2      7
Aranjaram 1      Bhitargaon     3      6         3      2      7
Miranpur         Patara         3      5         2      3      7
Miranpur         Patara         3      5         2      3      7
Targoun          Patara         3      5         3      2      7
Targoun          Patara         3      5         3      2      7
Tejpur           Patara         3      5         2      3      7
Tejpur           Patara         3      5         2      3      7
Bhattpurwa       Ghatampur      3      5         2      2      8
Bhattpurwa       Ghatampur      3      5         2      2      8

Village              ML    ML-    ML-    ML-    ML-    Relationship
name             2454-55   1182   0213   0970   1505

* Gaurikakra-1        3      5      6      1      5        Son
Gaurikakra-2          3      5      6      1      5       Mother
Hirni-2               3      5      4      2      3       Nephew
Hirni-1               3      6      6      2      3       Uncle
Katari-1              3      5      3      2      3
Ramsari-1             3      1      2      8      5     Neighbour
Ramsari-2             3      1      2      8      5     Neighbour
Moradabad-3           3     10      2      2      5
Moradabad-5           3     10      2      2      5
Aranjaram 5           3      5      3      2      5       Father
Aranjaram 6           3      5      3      2      4      Daughter
Aranjaram 2           3      5      3      2      5
Aranjaram 1           3      5      3      2      5
Miranpur              3      2      2      4      3
Miranpur              3      2      2      4      3
Targoun               3      5      3      4      6
Targoun               3      5      3      4      6
Tejpur                3      3      3      4      5
Tejpur                3      3      3      4      5
Bhattpurwa            3      4      4      2      5
Bhattpurwa            3      4      4      2      5

* One of the patients possibly got the infection from his
mother who had disease 10 yrs ago as seen by these ten VNTRs

Table V. Differentiation between Relapse and
re-infection by using STRs

Pt Code      TTC   ML1022    ML-     ML       ML-    ML-     ML
                    rpoT    0568   2469-70   0058   1334   2454-55

JIL (2004)   15      3        4       3        1      6       3
JIL (2007)   20      3        5       2        2      7       3
DH (2004)    17      3        5       2        3      8       3
DH (2007)    17      3        5       2        3      8       3

Pt Code       ML-    ML-    ML-    ML-
             1182   0213   0970   1505

JIL (2004)    6      7      1      5      May be a case of
JIL (2007)    1      2      8      5      re-infection
DH (2004)     5      7      8      3      May be a
DH (2007)     5      7      8      3      relapse case
COPYRIGHT 2011 Indian Council of Medical Research
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2011 Gale, Cengage Learning. All rights reserved.

 Reader Opinion

Article Details
Printer friendly Cite/link Email Feedback
Author:Lavania, Mallika; Katoch, Kiran; Sharma, Rahul; Sharma, Pragya; Das, Ram; Gupta, Anuj Kumar; Chauhan
Publication:Indian Journal of Medical Research
Article Type:Report
Geographic Code:9INDI
Date:Jun 1, 2011
Previous Article:Pulmonary tuberculosis among health care workers at two designated DOTS Centers in urban city of Ibadan, Nigeria.
Next Article:Smoking cessation support in Iran: availability, sources & predictors.

Terms of use | Copyright © 2015 Farlex, Inc. | Feedback | For webmasters