Printer Friendly
The Free Library
14,506,614 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Molecular epidemiology of SARS-associated coronavirus, Beijing.


Single nucleotide variations (SNVs) at 5 loci loci

[L.] plural of locus.

loci Plural of locus, see there
 (17564, 21721, 22222, 23823, and 27827) were used to define the molecular epidemiologic characteristics of severe acute respiratory syndrome-associated coronavirus coronavirus /co·ro·na·vi·rus/ (ko-ro´nah-vi?rus) any virus belonging to the family Coronaviridae.
Coronavirus /Co·ro·na·vi·rus/ (ko-ro´nah-vi?rus 
 (SARS-CoV) from Beijing patients. Five fragments targeted at the SNV SNV Synovus Financial Corp. (stock symbol)
SNV Schweizerische Normenvereinigung (Swiss standards body)
SNV Stichting Nederlandse Vrijwilligers (Netherlands Development Organization) 
 loci were amplified directly from clinical samples by using reverse transcription-polymerase chain reaction (RTPCR RTPCR Reverse Transcriptase Polymerase Chain Reaction ), before sequencing the amplified products. Analyses of 45 sequences obtained from 29 patients showed that the GGCTC motif dominated among samples collected from March to early April 2003; the TGTTT motif predominanted afterwards. The switch from GGCTC to TGTTT was observed among patients belonging to the same cluster, which ruled out the possibility of the coincidental co·in·ci·den·tal  
adj.
1. Occurring as or resulting from coincidence.

2. Happening or existing at the same time.



co·in
 superposition su·per·po·si·tion  
n.
1. The act of superposing or the state of being superposed: "Yet another technique in the forensic specialist's repertoire is photo superposition" 
 of 2 epidemics running in parallel in Beijing. The Beijing isolates underwent the same change pattern reported from Guangdong Province Noun 1. Guangdong province - a province in southern China
Guangdong, Kwangtung
. The same series of mutations occurring in separate geographic locations and at different times suggests a dominant process of viral adaptation to the host.

**********

Severe acute respiratory syndrome Severe Acute Respiratory Syndrome (SARS) Definition

Severe acute respiratory syndrome (SARS) is the first emergent and highly transmissible viral disease to appear during the twenty-first century.
 (SARS) is a new infectious disease Infectious disease

A pathological condition spread among biological species. Infectious diseases, although varied in their effects, are always associated with viruses, bacteria, fungi, protozoa, multicellular parasites and aberrant proteins known as prions.
 that spread worldwide in early 2003, affecting >30 countries, with >8,098 cases and 774 deaths reported (I). Beijing, People's Republic People's Republic
n.
A political organization founded and controlled by a national Communist party.
 of China, experienced the largest SARS outbreak in the world, with 2,523 cases and 181 deaths by June 12, 2003 (2,3). The epidemic occurred in 2 phases. The first phase began on March 5, 2003, and was caused by a patient who had been infected in Guangzhou and was involved in a superspreader event (SSE (1) An earlier full-screen editor in OS/2.

(2) (Streaming SIMD Extensions) A series of additional instructions built into Pentium CPU chips for improved multimedia performance by performing mathematical operations on multiple sets of data at the
) in Beijing hospitals. Most patients in this period proved to be directly or indirectly linked with the index patient by traditional epidemiologic investigations. Molecular epidemiology molecular epidemiology Molecular medicine An evolving field that combines the tools of standard epidemiology–case studies, questionnaires and monitoring of exposure to external factors with the tools of molecular biology–eg, restriction endonucleases, , based on genome sequencing of the early isolates, also provided evidence that Beijing infections were closely related to those from the Guangdong epidemic (4). The second phase was marked by widespread transmission in healthcare facilities and communities, with incidence peaking in late April, followed by a dramatic decline in occurrence during the first week of May. The last probable case was noted on May 29, 2003 (5). During this phase, many case-patients had no apparent contact with SARS patients.

After the sequencing of the whole genome (6-9) information on viral strains from different geographic and temporal origins became available in GenBank. Comparative sequence analyses identified 5 loci, sequence variants of which segregated together as specific genotypic genotypic

emanating from or pertaining to genotype.


genotypic selection
selection of breeding stock on the basis of known inherited characteristics.
 patterns, which could be used to define epidemic phases (10). All or some of the 5 loci were included in previous molecular epidemiologic studies (4,11-13), making them important genetic signatures to differentiate lineage-specific and temporal-specific patterns. In this study, we investigated the genetic variations of SARS-CoV in Beijing based on the 5-locus signature. Also, by sequence comparison among patients from 1 case cluster and different samples from 1 patient, the adaptable mutation of the virus in the host was further explored.

Methods

Participants

Study participants were recruited from 2 hospitals designated for SARS patients in Beijing. All of them fit the World Health Organization (WHO) case definition for probable SARS, i.e., temperature [greater than or equal to] 38[degrees]C, cough or shortness of breath Shortness of Breath Definition

Shortness of breath, or dyspnea, is a feeling of difficult or labored breathing that is out of proportion to the patient's level of physical activity.
, new pulmonary infiltrates Infiltrates
Cells or body fluids that have passed into a tissue or body cavity.

Mentioned in: Eosinophilic Pneumonia
 on chest radiograph radiograph /ra·dio·graph/ (-graf?) the film produced by radiography.

ra·di·o·graph
n.
, and a history of exposure to a SARS patient or of living in an area of on-going SARS transmission (14). After informed consent was obtained, epidemiologic and clinical data were collected from the participants by using a standard data collection form with interview and medical record review. The information obtained included the following items: age, sex, occupation, medical history, time and nature of exposure, symptoms and physical findings, laboratory tests at admission to hospital, and outcomes on discharge or transfer. Patients also provided clinical specimens (sputum sputum /spu·tum/ (spu´tum) [L.] expectoration; matter ejected from the trachea, bronchi, and lungs through the mouth.

sputum cruen´tum  bloody sputum.
 and stool) for SARS-CoV detection by RTPCR assay with specific primers (COR1, COR2) recommended by WHO. Only the patients with positive RT-PCR RT-PCR

reverse transcriptase-polymerase chain reaction. See PCR1.
 results were included in the study.

Laboratory Methods

Specimens were analyzed by using RT-PCR techniques. Briefly, total RNA RNA: see nucleic acid.
RNA
 in full ribonucleic acid

One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic
 was extracted by using the QIAamp virus RNA mini kit (Qiagen, Hilden, Germany) as instructed by the manufacturer. RNA was used to synthesize To create a whole or complete unit from parts or components. See synthesis.  eDNA with the SuperScript Any letter, digit or symbol that appears above the line. For example, 10 to the 9th power is written with the 9 in superscript (109). Contrast with subscript.  II RNase H- reverse transcriptase Reverse transcriptase

Any of the deoxyribonucleic acid (DNA) polymerases present in particles of retroviruses which are able to carry out DNA synthesis using an RNA template.
 system (Invitrogen, Carlsbad, CA, USA). Five sets of primers were used in nested PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
 to amplify the fragments covering the 5-locus genetic signatures (17564, 21721, 22222, 23823, and 27827) (Table 1). Then, with the purified PCR products as templates and the second round primers as sequencing primers, the fragments were sequenced in ABI Abi (ā`bī) [short for Abijah], in the Bible, King Hezekiah's mother.


(Application Binary Interface) A specification for a specific hardware platform combined with the operating system.
 Prism 377 DNA sequencer A DNA sequencer is an instrument used to automate the DNA sequencing process.

DNA sequencers have become more important due to large genomics projects and the need to increase productivity.
 (Applied Biosystems Applied Biosystems, Inc. (formerly NASDAQ: ABIO) is the original name of a pioneer biotechnology company founded in 1981 in Foster City, California, among the Silicon Valley cities of the southern San Francisco Bay Area.  Inc, Foster City, CA, USA). Each PCR fragment was directly sequenced from both inward and outward directions, in duplicate.

All the original base data were processed for base calling, assembly, and editing by the SegMan II sequences analysis software of DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 Star package (DNASTAR, Madison, WI, USA). The comparisons with other sequences available from public database (GenBank) were made by using the default parameter of ClustalW (http://www.ebi.ac.uk/clustalw/). Single nucleotide variations (SNVs) were indicated, and the deduced amino acid amino acid (əmē`nō), any one of a class of simple organic compounds containing carbon, hydrogen, oxygen, nitrogen, and in certain cases sulfur. These compounds are the building blocks of proteins.  changes were described.

Results

A total of 160 samples (81 stools and 79 sputum samples) from 62 patients with positive results by RT-PCR were included this study. Of these, 45 samples (36 sputum samples and 9 stools) from 29 patients (17 men and 12 women, with a median age of 32 years) yielded amplicons for the 5 targeted loci (Table 2). The patients came from 2 SARS-designated hospitals in Beijing This is a list of hospitals in Beijing. Beijing
  • Arrail Dental Clinic
  • Beijing Hospital for Stomatology
  • Beijing Shunyi Hospital
  • Beijing United Family Hospital
  • Beijing Hospital of Traditional Chinese Medicine
  • Beijing Friendship Hospital
, with disease onset ranging from March to May, 2003. Four patients had serious conditions during hospitalization, including pulmonary aggravation Any circumstances surrounding the commission of a crime that increase its seriousness or add to its injurious consequences.

Such circumstances are not essential elements of the crime but go above and beyond them.
 requiring oxygen ventilation or transfer to an intensive care unit. No patient died.

The sequences of the 45 positive specimens were compared with SARS-CoV genome sequences available from the public database (GenBank). The sequence variants in 5 loci (17564, 21721, 22222, 23823, and 27827) defined 3 kinds of motifs: GGCTC, TGTTT, and GATTC (Table 2). In addition, 4 new SNVs were identified at nucleotides 17620, 22077, 22589, and 27749 in >1 patient. These variations appeared independently in several isolates, which indicates that they are not RT-PCR artifacts artifacts

see specimen artifacts.
. None of them had been previously reported, with 3 nucleotide substitutions leading to amino acid changes (Table 3).

Twelve patients in this study belonged to a cluster. They derived from an SSE indirectly linked with the earliest SARS patients in Beijing. The first 2 patients of this cluster, who became ill on March 10 and 21, respectively, harbored the GGCTC motif. The remaining patients, who became ill from March 31 to May 4, showed the TGTTT motif. Among patients outside of the cluster, 5 of 6 patients with onset date before April had the GGCTC motif, while the TGTTT motif became predominant later (9 of 11 patients until May 12). A new motif, GATTC, was found in 2 patients outside the cluster. In addition, no intrapatient variation was observed in the 5 amplicons from specimens collected at different times or from different sources (sputum or stools).

The possible role of genetic mutations in patients' prognosis was also investigated. The presence of nucleotide substitution was compared between 2 groups of patients: 1 with good prognosis (absence of pulmonary aggravation; n = 25) and 1 with adverse outcome (pulmonary aggravation 8-12 days after onset of symptoms requiring oxygen ventilation or transfer to ICU ICU intensive care unit.

ICU
abbr.
intensive care unit



ICU

see intensive care unit.

ICU 
; n = 4). No mutation was found associated with disease severity (Table 2).

Discussion

During the 2003 SARS epidemic, conventional epidemiologic investigation, aided by viral sequencing analysis, identified viral genetic signatures that are linked to geographic and temporal clusters of infection (4,10-12, 15-18). Findings of these studies are summarized in the Figure, connecting the worldwide epidemic to a transmission event in hotel M in Hong Kong Hong Kong (hŏng kŏng), Mandarin Xianggang, special administrative region of China, formerly a British crown colony (2005 est. pop. 6,899,000), land area 422 sq mi (1,092 sq km), adjacent to Guangdong prov.  in late February 2003.

Beijing had experienced the SARS epidemic from March to June; however, only a few Beijing strains from the early epidemic have been analyzed in previous studies. Our study is the first to provide phylogenetic phy·lo·ge·net·ic
adj.
1. Of or relating to phylogeny or phylogenetics.

2. Relating to or based on evolutionary development or history.
 information on Beijing strains from the early and middle epidemic, as well as the late epidemic, by using the 5-locus motif of previous studies. The series of mutations in the 5-locus motif observed in Beijing followed the same path as isolates in Guangdong Province and the worldwide epidemic, i.e., the early introduction of GACTC GACTC Greater Altoona Career & Technology Center (Pennsylvania)  motif was followed by transition to a GGCTC motif, before switching to a stable TGTTT motif. The observation of the same series of mutations occurring in 2 separate locations at different times suggests a dominant process of viral adaptation to the host. Moreover, this finding can expand our understanding of SARS-CoV response to selection pressures in humans, since early Beijing isolates (BJ01, BJ02, and BJ03), which are traceable to Guangdong, underwent an independent selection process and would not be subject to the same sampling bias caused by superspreading events in Hong Kong isolates. The GGCTC [right arrow] TGTTT switch was observed among patients belonging to the same cluster in this study, which rules out the possibility of the coincidental superposition of 2 epidemics (GGCTC and TGTTT) coexisting in Beijing.

The mutations involved in the GGCTC [right arrow] TGTTT switch are responsible for amino acid changes in a nonstructural protein (17564, region Orf1b) in S protein (21721 and 22222) and in a noncoding region (27827, X3). We were not able to identify a correlation between these changes and the clinical status of patients. We did not find sequence variations in specimens obtained from the same patients either collected at different times or among different specimen types, which suggests that within-individual variations are rare in the partial genome of this study, although the phenomenon was described in a previous study (15). A new motif, GATTC, which represents a new transitional motif between GACTC and TGTTT, was described on 2 occasions in patients who were not part of the cluster. Similarly, 4 new SNVs were identified at nucleotides 17620, 22077, 22589, 27749.

In summary, this study confirms the evolution of SARS-CoV strains towards a TGTTT motif in positions 17564, 21721,22222, 23823, and 27827 in Beijing, as was observed in Guangdong province before the hotel M outbreak in Hong Kong. Whether this motif is associated with higher transmission or virulence remains to be elucidated.

Acknowledgments

We thank Guo-Ping Zhao, Huai-Dong Song, and Guo-Wei Zhang for their assistance with this study.

This work was partly supported by the EC grant EPISARS (511063), the Programme de Recherche re·cher·ché  
adj.
1. Uncommon; rare.

2. Exquisite; choice.

3. Overrefined; forced.

4. Pretentious; overblown.
 en Reseaux Franco-Chinois (P2R), the National Institutes of Health CIPRA CIPRA Commission Internationale pour La Protection des Alpes (French: International Commission for Protection of the Alps)
CIPRA Comprehensive International Program of Research on AIDS
CIPRA Canadian Imaging Products Remanufacturers Association
 Project (NIH "Not invented here." See digispeak.

NIH - The United States National Institutes of Health.
 U19 AI51915), and the National 863 Program of China (2003AA208406, 2003AA208412C).

Dr Liu is an epidemiologist in the Department of Epidemiology, Beijing Institute of Microbiology and Epidemiology. Her primary research interests are molecular epidemiology and emerging infectious disease An emerging infectious disease (EID) is an infectious disease whose incidence has increased in the past 20 years and threatens to increase in the near future. EIDs include diseases caused by a newly identified microorganism or newly identified strain of a known microorganism (e.g. .

References

(1.) World Health Organization. SARS epidemiology to date [monograph on the Internet]. 2003. [cited 2003 Apr 11]. Available from: http://www.who.int/csr/sars/epi2003_04_11/en/

(2.) World Health Organization. Multicentre Collaborative Network for Severe Acute Respiratory Syndrome (SARS) Diagnosis. A multicentre collaboration to investigate the cause of severe acute respiratory syndrome. Lancet. 2003;361:1730-3.

(3.) World Health Organization. Cumulative number of reported probable cases of severe acute respiratory syndrome (SARS) [monograph on the Internet]. [cited 2003 Jul 11]. Available from: http://www. who.int/csr/sars/country/en/

(4.) Guan guan: see curassow.  Y, Peiris JS, Zheng B, Poon poon  
n.
Any of several trees of the genus Calophyllum, of southern Asia, having light hard wood used for masts and spars.



[Sinhalese p
 LL, Chan KH, Zeng FY, et al. Molecular epidemiology of the novel coronavirus that causes severe acute respiratory syndrome. Lancet. 2004;363:99-104.

(5.) PangX, Zhu Z, Xu F, Guo J, Gong X, Liu D, et al. Evaluation of control measures implemented in the severe acute respiratory syndrome outbreak in Beijing, 2003. JAMA JAMA
abbr.
Journal of the American Medical Association
. 2003;290:3215-21.

(6.) Drosten C, Gunther S, Preiser W, van der Werf S, Brodt HR, Becker S, et al. Identification of a novel coronavirus in patients with severe acute respiratory syndrome. N Engl J Med. 2003;348:1967-76.

(7.) Rota PA, Oberste MS, Monroe SS, Nix WA, Campagnoli R, Icenogle JP, et al. Characterization of a novel coronavirus associated with severe acute respiratory syndrome. Science. 2003;300:1394-9.

(8.) Ksiazek TG, Erdman D, Goldsmith CS, Zaki SR, Peret T, Emery S, et al. A novel coronavirus associated with severe acute respiratory syndrome. N Engl J Med 2003;348:1953-66.

(9.) Marra MA, Jones S J, Astell CR, Holt RA, Brooks-Wilson A, Butterfield YS, et al. The genome sequence of the SARS-associated coronavirus. Science. 2003;300:1399-404.

(10.) The Chinese SARS Molecular Epidemiology Consortium. Molecular evolution of the SARS coronavirus The SARS coronavirus is the virus that causes severe acute respiratory syndrome (SARS).[1] On April 16 2003, following the outbreak of SARS in Asia and secondary cases elsewhere in the world, the World Health Organization (WHO) issued a press release stating that the  during the course of the SARS epidemic in China. Science. 2004;303:1666-9.

(11.) Zhong NS, Zheng BJ, Li YM, Pooh LLM LLM
abbr.
Latin Legum Magister (Master of Laws)


LLM Master of Laws [Latin Legum Magister]

Noun 1.
, Xie ZH, Chan KH, et al. Epidemiology and cause of severe acute respiratory syndrome (SARS) in Guangdong, People's Republic of China, in February, 2003. Lancet. 2003;362:1353-8.

(12.) Ruan YJ, Wei CL, Ee AL, Vega VB, Thoreau H, Su ST, et al. Comparative full-length genome sequence analysis of 14 SARS coronavirus isolates and common mutations associated with putative origins of infection. Lancet. 2003;361:1779-85.

13. Tsui SK, Chim SS, Lo YM. Chinese University of Hong Kong The motto of the university is "博文約禮" in Chinese, meaning "to broaden one's intellectual horizon and keep within the bounds of propriety".  Molecular SARS Research Group. Coronavirus genomic-sequence variations and the epidemiology of the severe acute respiratory syndrome. N Engl J Med. 2003;349:187-8.

(14.) World Health Organization. Case definitions for surveillance of severe acute respiratory syndrome (SARS). [cited 2003 Apr 29]. Available at: http://www.who.int/csr/sars/casedefinition/en.

(15.) Xu DP, Zhang Z, Chu Fl, Li Y, Jin L, Zhang L, et al. Genetic variation of SARS coronavirus in Beijing hospital. Emerg Infect Dis. 2004;10:789-94.

(16.) Yeh SH, Wang HY, Tsai CY, Kao CL, Yang JY, Liu HW, et al. Characterization of severe acute respiratory syndrome coronavirus genomes in Taiwan: molecular epidemiology and genome evolution. Proc Natl Acad Sci U S A. 2004; 101:2542-7.

(17.) Tsang KW, Ho PL, Ooi GC, Yee WK, Wang T, Chan-Yeung M, et al. A cluster of cases of severe acute respiratory syndrome in Hong Kong. N Engl J Med. 2003;348:1977-85.

(18.) Wang Z, Li L, Luo Y, Zhang J, Wang M, Cheng S, et al. Molecular biological analysis of genotyping Genotyping refers to the process of determining the genotype of an individual with a biological assay. Current methods of doing this include PCR, DNA sequencing, and hybridization to DNA microarrays or beads.  and phylogeny of severe acute respiratory syndrome associated coronavirus. Chin Med J. 2004; 117:42-8.

Wei Liu, * Fang Tang, * Arnaud Fontanet, ([dagger]) Lin Zhan, * Tian-Bao Wang, ([double dagger double dagger
n.
A reference mark () used in printing and writing. Also called diesis.

Noun 1.
]) Pan-He Zhang, * Yi-He Luan, ([double dagger]) Chao-Yang Cao, ([double dagger]) Qiu-Min Zhao, * Xiao-Ming Wu, * Zhong-Tao Xin, ([section]) Shu-Qing Zuo, * Laurence Baril, ([dagger]) Astrid Vabret, ([paragraph]) Yi-Ming Shao, # Hong Yang, * and Wu-Chun Cao *

* Beijing Institute of Microbiology and Epidemiology, Beijing, People's Republic of China; ([dagger]) Institut Pasteur, Paris, France; ([double dagger]) Beijing Armed Force Hospital, Beijing, People's Republic of China; ([section]) Beijing Institute of Basic Medical Sciences, Beijing, People's Republic of China; ([paragraph]) Caen University, Caen, France; and # Chinese Center for Disease Control and Prevention Noun 1. Center for Disease Control and Prevention - a federal agency in the Department of Health and Human Services; located in Atlanta; investigates and diagnoses and tries to control or prevent diseases (especially new and unusual diseases)
CDC
, Beijing, People's Republic of China

Address for correspondence: Wu-Chun Cao, Beijing Institute of Microbiology and Epidemiology, State Key Laboratory of Pathogen Pathogen

Any agent capable of causing disease. The term pathogen is usually restricted to living agents, which include viruses, rickettsia, bacteria, fungi, yeasts, protozoa, helminths, and certain insect larval stages.
 and Biosecurity, Beijing, People's Republic of China; fax: 86-10-63812060; email: caowc@nic.bmi.ac.cn
Table 1. Primers used for nested polymerase chain reaction and
sequencing

Position    Amplification region *

17564            17440-18281          Forward
                                      Reverse
21721            21585-22304          Forward
                                      Reverse
22222            22177-22874          Forward
                                      Reverse
23823            23455-24263          Forward
                                      Reverse
27827            27449-28270          Forward
                                      Reverse

                     Primer sets (starting from 5')

17564         ACGTCTATATTGGCGATCCTTGTGCAGACTTATGAAAACAATA
              GTTTTGCATTAACTCTGGTGGTTAGTACCCACAGCATCTCTAGT
21721       GATGATGTTCAAGCTCCTAATTACCTTAACAGAGCATTTGAGTTCAG
            CAACATACTTCATCTATGAGGGGTGTACCATTTTCATCATACTTGAG
22222       AGATGTAGTTCGTGATCTACCTTCTTAATGGCCAATAACAATTAAGA
            CAAATTTTAGAGCCATTCTTACAGGGAGAAAGGCACATTAGATATGTC
23823          CGACACTTCTTATGAGTGCGATGCAGTTGATGTTGTTGTAAG
            GCATTTGTGCTAGTTACCATACAGTGATGTTGTTGTAAGTGATTCTTG
27827           CCATCAGGAACATACGAGGGACCACTATTGGTGTTGATTG
              TAGCACACACTTTGCTTTTGCAGTATTATTGGGTAAACCTTGG

* The nucleotide position was given with TOR2 as the reference strain
(accession no. N0004718).

Table 2. Epidemiologic and phylogenetic data on 29 severe acute
respiratory syndrome patients, Beijing, 2003 *

                               Onset date    Sampling date, ([dagger])
Patent no. (sex, age [y])      ([dagger])         clinical sample

1 ([double dagger]) (M, 25)       3/10               4/28, Sp
2 ([double dagger])
  ([section]) (F, 48)             3/21               4/28, Sp
3 (M, 19)                         3/31           4/28, Sp; 5/5, Sp
4 ([double dagger]) (F, 34)       3/31           5/5, St; 4/28, Sp
5 ([double dagger])
  ([section)] (M, 21)             3/31           4/28, Sp; 5/5, Sp
6 ([double dagger]) (F, 34)       4/2                4/28, Sp
7 (F, 27)                         4/2                4/28, Sp
8 ([double dagger]) (M, 31)       4/3                4/28, Sp
9 ([double dagger]) (M, 20)       4/5            5/5, Sp; 4/28, Sp
10 (F, 23)                        4/8           5/22, St; 5/15, Sp
11 ([section]) (M, 47)            4/8             5/5-Sp; 5/5, St
12 (M, 73)                        4/9           4/28, Sp; 4/28, St
13 (M, 54)                        4/9           4/28, Sp; 4/28, St
14 ([double dagger]) (F, 21)      4/11      4/28, Sp, 4/28, St, 5/5, Sp
15 ([section]) (M, 61)            4/12               5/22, Sp
16 ([double dagger]) (F, 25)      4/15                5/5, Sp
17 (M, 25)                        4/17                5/5, Sp
18 (F, 20)                        4/18          4/28, Sp; 4/28, St
19 ([double dagger]) (F, 25)      4/20           5/5, Sp; 5/5, St
20 (F, 34)                        4/21           4/28, Sp; 5/5, Sp
21 (M, 33)                        4/23       5/5, Sp; 5/5 St; 4/28-Sp
22 (M, 28)                        4/24                5/5, Sp
23 (M, 61)                        5/1                5/15, Sp
24 ([double dagger]) (F, 31)      5/1                 5/5, Sp
25 (M, 25)                        5/2                 5/7, Sp
26 ([double dagger]) (M, 25)      5/4                5/22, Sp
27 (M, 19)                        5/6                5/22, Sp
28 (F, 28)                        5/7                5/22, Sp
29 (M,22)                         5/12           4/28, Sp; 5/5, Sp

                               5-loci genotype   Other variant loci

1 ([double dagger]) (M, 25)         GGCTC               22589
2 ([double dagger])
  ([section]) (F, 48)               GGCTC           22589,27749
3 (M, 19)                           GGCTC               22589
4 ([double dagger]) (F, 34)         TGTTT           17620,22589
5 ([double dagger])
  ([section)] (M, 21)               TGTTT               22589
6 ([double dagger]) (F, 34)         TGTTT               22077
7 (F, 27)                           GGCTC               22589
8 ([double dagger]) (M, 31)         TGTTT        22077, 22589, 27749
9 ([double dagger]) (M, 20)         TGTTT        17620, 22077, 22589
10 (F, 23)                          GGCTC               22589
11 ([section]) (M, 47)              GGCTC               22589
12 (M, 73)                          TGTTT           22589, 27749
13 (M, 54)                          GGCTC           22589, 27749
14 ([double dagger]) (F, 21)        TGTTT
15 ([section]) (M, 61)              GATTC               22589
16 ([double dagger]) (F, 25)        TGTTT        17620, 22589, 27749
17 (M, 25)                          TGTTT        22077,22589, 27749
18 (F, 20)                          TGTTT           22589, 27749
19 ([double dagger]) (F, 25)        TGTTT           22077, 22589
20 (F, 34)                          TGTTT               22077
21 (M, 33)                          TGTTT           17620, 22589
22 (M, 28)                          TGTTT           22589, 27749
23 (M, 61)                          GATTC               22589
24 ([double dagger]) (F, 31)        TGTTT         22077, 2589, 7749
25 (M, 25)                          TGTTT               22077
26 ([double dagger]) (M, 25)        TGTTT               22077
27 (M, 19)                          TGTTT           22589, 27749
28 (F, 28)                          TGTTT        17620, 22589, 27749
29 (M,22)                           TGTTT           22589, 27749

* F, female; M, male; Sp, sputum; St, stool.

([dagger]) All dates are in 2003.

([double dagger]) Patients were from the same cluster.

([section]) Patients with adverse clinical outcome.

Table 3. Characterization of nucleotide (nt) substitutions in 29 severe
acute respiratory syndrome patients, Beijing, China *

ORF or protein    Position ([dagger])     nt substitution

ORF 1b                   17620           C [right arrow] T
S protein                22077           G [right arrow] T
S protein                22589           C [right arrow] T
ORF 9                    27749           G [right arrow] A

                        as change          No. patients

ORF 1b            Leu [right arrow] Ser         5
S protein         Phe [right arrow] Tyr         9
S protein          Noncoding region            24
ORF 9             Lys [right arrow] Glu        12

* SARS, severe acute respiratory syndrome; ORF, open reading frame; aa,
amino acid.

([double dagger]) The nt positions are numbered with TOR2 as reference
strain (accession no. NC_004718).
COPYRIGHT 2005 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2005, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:RESEARCH
Author:Cao, Wu-Chun
Publication:Emerging Infectious Diseases
Geographic Code:9CHIN
Date:Sep 1, 2005
Words:3206
Previous Article:Malaria attributable to the HIV-1 epidemic, sub-Saharan Africa.(RESEARCH)
Next Article:Malaria in Kenya's western highlands.
Topics:



Related Articles
Role of China in the quest to define and control severe acute respiratory syndrome.(Perspectives)
Emerging infections: what have we learned from SARS?(Conference Summary)
SARS antibody test for serosurveillance.(Research)
Laboratory diagnosis of four recent sporadic cases of community-acquired SARS, Guangdong Province, China.(Research)
Long-term SARS coronavirus excretion from patient cohort, China.(Dispatches)(severe acute respiratory syndrome)
SARS molecular detection external quality assurance.(Dispatches)
SARS-associated coronavirus transmitted from human to pig.(Dispatches)
SARS vaccine development.(SYNOPSIS)(severe acute respiratory syndrome)
SARS-CoV infection in a restaurant from palm civet.(RESEARCH)(severe acute respiratory syndrome coronavirus infection)
Pulmonary tuberculosis and SARS, China.

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles