Printer Friendly
The Free Library
14,573,512 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Molecular epidemiology of O139 vibrio cholerae: mutation, lateral gene transfer, and founder flush. (Research).


Vibrio cholerae Vibrio chol·er·ae
n.
A bacterium that causes Asiatic cholera in humans; Koch's bacillus.


Vibrio cholerae Infectious disease The Vibrio
 in O-group 139 was first isolated in 1992 and by 1993 had been found throughout the Indian subcontinent. This epidemic expansion probably resulted from a single source after a lateral gene transfer (LGT LGT Light
LGT Lateral Gene Transfer
LGT Lifeguard Training
LGT Locomotiv GT (Hungarian rock band)
LGT Lattice Gauge Theory (physics)
LGT Liechtenstein Global Trust (bank) 
) event that changed the serotype serotype /se·ro·type/ (ser´o-tip) the type of a microorganism determined by its constituent antigens; a taxonomic subdivision based thereon.

se·ro·type
n.
See serovar.

v.
 of an epidemic V. cholerae O1 El Tor strain to O139. However, some studies found substantial genetic diversity, perhaps caused by multiple origins. To further explore the relatedness of O139 strains, we analyzed nine sequenced loci from 96 isolates from patients at the Infectious Diseases Hospital, Calcutta, from 1992 to 2000. We found 64 novel alleles distributed among 51 sequence types. LGT events produced three times the number of nucleotide changes compared to mutation. In contrast to the traditional concept of epidemic spread of a homogeneous clone, the establishment of variant alleles generated by LGT during the rapid expansion of a clonal bacterial population may be a paradigm in infections and epidemics.

**********

An epidemic of cholera began in Madras, India, in 1992 and within a year had spread across the Indian subcontinent, with cases numbering in the millions (1,2). Vibrio cholerae isolates from this epidemic had a previously unidentified serotype, subsequently designated as O139 Bengal (1,2). This new serotype appears to have resulted when a lateral gene transfer (LGT) event occurred that replaced the 22 kb of the wbf region (encoding the O1 antigen) of a seventh pandemic pandemic /pan·dem·ic/ (pan-dem´ik)
1. a widespread epidemic of a disease.

2. widely epidemic.


pan·dem·ic
adj.
Epidemic over a wide geographic area.

n.
 V. cholerae O1 El Tor strain with a 37-kb region encoding the O139 polysaccharide polysaccharide: see carbohydrate.
polysaccharide

Any of a large class of long-chain sugars composed of monosaccharides. Because the chains may be unbranched or branched and the monosaccharides may be of one, two, or occasionally more kinds,
 (3-5). The epidemic spread rapidly through all age groups, as persons with previous exposure to V. cholerae O1 were not immune to O139 infection. Since 1992, O139 strains have established endemicity in this geographic region and account for a variable percentage of cholera cases every year (6).

Genetic variation observed in O139 isolates has been attributed to many causes. Variation in restriction fragment length polymorphism restriction fragment length polymorphism
n. Abbr. RFLP
Intraspecies variations in the length of DNA fragments generated by the action of restriction enzymes and caused by mutations that alter the sites at which these enzymes act, changing
 (RFLP RFLP
abbr.
restriction fragment length polymorphism



RFLP

restriction fragment length polymorphism.

RFLP 
) analysis of rDNA genes (7) and in recA sequence (8) has been interpreted as evidence for multiple origins. Genetic variability in RFLP of the CTX CTX Context (Management; Tandem)
CTX Centex Corporation (stock symbol)
CTX Centrex
CTX Cyclophosphamide
CTX Corporate Trade Exchange
CTX Cytoxan
CTX Cholera Toxin
CTX Clinical Trial Exemption
 element (6) has been attributed to phage-mediated recombination recombination, process of "shuffling" of genes by which new combinations can be generated. In recombination through sexual reproduction, the offspring's complete set of genes differs from that of either parent, being rather a combination of genes from both parents. . Variation in antimicrobial susceptibility (9) has been attributed to plasmid exchange in response to selective pressure from drug use. The variation in pulsed-field gel electrophoresis (PFGE PFGE Pulsed-Field Gel Electrophoresis ) analysis of genomic restriction fragments (6,10) has been attributed to point mutations. Multilocus sequence typing Multilocus sequence typing (MLST) is a technique in molecular biology for the typing of multiple loci. The procedure characterizes isolates of bacterial species using the DNA sequences of internal fragments of multiple (usually seven) housekeeping genes.  (MLST MLST Multi Locus Sequence Typing
MLST Medical Logistics Support Team
MLST Mini Losi Super Truck (1/18th scale radio control vehicle) 
), which has been used in the evaluation of a number of other bacterial species (11-14), provides an alternative method for measuring genetic relatedness and has provided data for identifying both point mutations and LGT events (14). MLST has improved discriminatory power over PFGE in some cases, e.g., Enterococcus enterococcus /en·tero·coc·cus/ (en?ter-o-kok´us) pl. enterococ´ci   an organism belonging to the genus Enterococcus.
Enterococcus /En·tero·coc·cus/ (
 (15) and Salmonella (16); however, in the case of Escherichia coil O157, it does not because of an absence of sequence variation in the clonally derived isolates (17). A small MLST study of O139 isolates of V. cholerae did not identify any LGT events (18).

To understand the evolutionary dynamics of V. cholerae O139, we sequenced segments from nine loci, including seven that may be classified as traditional housekeeping genes, one that carries the genes for cholera toxin cholera toxin Infectious disease A heat-sensitive multimeric enterotoxin produced by Vibrio cholera, which transfers ADP-ribose to a G protein, locking adenyl cyclase in an 'on' position by ADP ribosylation of a Gs protein , and another that is next to the insertion sequence insertion sequence
n.
Any of several discrete DNA sequences that repeat at various sites on a bacterial chromosome, on certain plasmids, and on bacteriophages and that can move from one site to another on the chromosome, to another plasmid in the same
 within the O139 wbf region (3-5). Thus, the last two loci might be expected to show LGT, because they are associated with known mobile elements, but the other seven loci would not be expected to show LGT. However, we found putative LGT alleles at all nine loci in the 96 clonally related O139 isolates.

Materials and Methods

We evaluated nine loci--dnaE, lap, recA pgm, gyrB. cat, chi, rstR, and gmd--from 96 V. cholerae O139 isolated from patients seen at the Infectious Diseases Hospital, Calcutta, from 1992 to 2000 (see Appendix, online only). DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 was prepared from overnight cultures by using PrepMan Ultra (Applied Biosystems Inc., Foster City, CA) at the University of Maryland University of Maryland can refer to:
  • University of Maryland, College Park, a research-extensive and flagship university; when the term "University of Maryland" is used without any qualification, it generally refers to this school
 School of Medicine. Each locus was amplified by using polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is  (PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
) with primers (Table 1) selected from a conserved region of the locus, as determined by aligning sequences from GenBank. Our primers selectively amplified the original 0139 rstR gene found in all isolates and not the additional one found in some recently inserted CTX elements (19). The presence of amplified products was confirmed on agarose agarose

more highly purified form of agar with similar uses to agar and widely used in the separation of nucleic acid fragments.
 gels. Purification of the products was performed by using Millipore filters. The purified PCR products were sequenced in both directions by using the same primers used for amplification and Big Dye cycle sequencing kit (ABI Abi (ā`bī) [short for Abijah], in the Bible, King Hezekiah's mother.


(Application Binary Interface) A specification for a specific hardware platform combined with the operating system.
) in accordance with manufacturer's instructions. The fluorescently labeled products were separated and detected by using either an ABI 377 or 3700 Automatic Sequencer See MIDI sequencer.

(music) sequencer - Any system for recording and/or playback of music via a programmable memory which stores music not as audio data, but as some representation of notes.
 (ABI). The trace files were read by using Phred (20,21 ) and Phrap (22). Low-quality sequence at the ends was trimmed, and the contigs from each individual isolate were aligned by using Clustal X (23). Variable nucleotides were identified manually. Isolates with identical alleles were identified from a distance matrix obtained from PAUP PAUP Phylogenetic Analysis Using Parsimony  (24). The alleles have been assigned GenBank accession numbers AY297845 to AY297921.

The expected number of alleles that were a result of point mutations was calculated. All point mutations were assumed to occur independently; thus, the expected number of alleles with [greater than or equal to] 2 nucleotides (nt) can be calculated, and the excess number of observed alleles was attributed to conspecific con·spe·cif·ic  
adj.
Of or belonging to the same species.

n.
An organism belonging to the same species as another.

Noun 1.
 LGT of homologous genes. If one assumes that p is the probability of seeing a single mutation in an allele allele (əlēl`): see genetics.
allele

Any one of two or more alternative forms of a gene that may occur alternatively at a given site on a chromosome.
, the chance of seeing two mutations on the same allele is [p.sup.2] the probability of seeing three or more mutations is [p.sup.3]. Probability can be calculated from the data by dividing the number of alleles with a single nucleotide difference, 34, by 785, the number of alleles in which observing a point mutation is possible (the 6-bp deletion; the recombinant gmd, recA alleles; and all duplicate novel alleles were excluded). Thus, p equals 0.043, [p.sup.2] equals 0.0018, and [p.sup.3] equals 8 x [10.sup.-5]. When these probabilities are multiplied by the total number of alleles, 785, the expected number of alleles containing two independent point mutations is 1.45, and the expected number containing three or more is 0.06 (Figure 1).

[FIGURE 1 OMITTED]

Results

Each of the loci examined had a variable number of observed alleles: 9 for dnaE, 20 for lap, 11 for rstR, 11 for gmd, 2 for recA, 8 for pgm, 4 for gyrB, 7 for cat, and 5 for chi. The most variable, lap with 20 alleles, was expected because it is a highly variable locus when analyzed with multilocus enzyme electrophoresis (25). The most common allele was present in 91% of isolates (n=87) for dnaE, 77% (n=86) for lap, 79% (n:90) for rstR, 82% (n=87) for gmd, 99% (n=96) for recA, 90% (n=94) for pgm, 97% (n=92) for gyrB, 93% (n=88) for cat, and 94% (n=89) for chi. Thus, the pattern for each locus consists of a common or ancestral allele and a series of rare alleles, as expected for the expansion of a clone.

Of the 64 less frequent alleles, some result from LGT and others from mutation. The three alleles with the largest changes are unlikely to be due to point mutations. First, a gmd allele that differed by 113 of the 360 bp sequenced, when compared with sequences in GenBank using BLAST (available from: URL URL
 in full Uniform Resource Locator

Address of a resource on the Internet. The resource can be any type of file stored on a server, such as a Web page, a text file, a graphics file, or an application program.
: www.ncbi.nlm.nih.gov/BLAST/) showed greater similarity to gmd from E. coli E. coli: see Escherichia coli.
E. coli
 in full Escherichia coli

Species of bacterium that inhabits the stomach and intestines. E. coli can be transmitted by water, milk, food, or flies and other insects.
 (AF061251) than gmd from V. cholerae, consistent with LGT of a homologous gene into the V. cholerae genome. Second, an alternative recA allele that differs by 24 nt is likely to be the result of LGT of a homologous gene. Although substantial, the number of nucleotide differences is not large enough for the allele to be clustered with sequences from V. mimicus, the closest sibling species to V. cholerae (8), a finding that suggests that recombination occurred within V. cholerae. Third, a lap allele had a 6-bp deletion and a single nucleotide difference that may be the result of a double-strand break repair.

We calculated that at least 26 putative conspecific LGT events occurred in the 96 isolates studied. Figure 1 shows the number of nucleotide differences between each novel allele and the ancestral allele. If all point mutations are assumed to occur independently, the expected number of alleles with two or more variable nucleotides can be calculated and the excess number of observed alleles attributed to conspecific LGT of homologous genes. The expected number of alleles containing two independent point mutations is 1.45, and the expected number containing three or more is 0.06. Since 11 alleles were observed with 2 nt differences, 9 more than expected, and 16 were observed with [greater than or equal to] 3 differences, 16 more than expected, all of these alleles probably did not occur through mutation; more likely, these alleles are the result of LGT. Thus, we would estimate that 26 alleles (9 + 16 + recA allele above) are putatively due to conspecific LGT of homologous genes.

The putative conspecific LGT alleles, although fewer in number (26 alleles) than the assumed number of mutation-derived alleles (34 alleles), provide most of the nucleotide differences between alleles. The 120 nt changes introduced by conspecific LGT events are approximately three times the 38 (34 single mutations + 4 2x2 double mutations) introduced by mutation. This calculation is conservative: The 26 conspecific LGT events may represent an underestimate of the number because some of the alleles differing by [less than or equal to] 1 nt may have resulted from LGT.

The analysis of all nine loci from each isolate was based on the sequence type (ST). Each isolate was defined by a 9-digit number composed of the assigned allele number at each of the nine loci in the following order: dnaE, lap, rstR, gmd, recA, pgm, gyrB, cat, and chi. The most common allele was arbitrarily assigned as number 1. Thus, the ST of all the most common alleles is ST 1,1,1,1,1,1,1,1,1. Missing data were assigned the most common allele. This assumption is conservative, minimizes the observed amount of variation, and is consistent with the preponderance of common alleles found at each locus.

Fifty-one unique STs were found in the 96 isolates tested, reflecting relatively extensive genetic diversity. The overall average of 0.53 unique STs per isolate examined is similar to that seen in every year including 1992 (Table 2). Six STs occur more than once. As expected, the ancestral ST: 1,1,1,1,1,1,1,1,1, found in 40 isolates, occurred in all years. Among the others, ST: 1,1,2,1,1,1,1,1,1 was found three times, once each in 1995, 1996, and 1997. ST:1,2,1,1,1,1,1,1,1 and ST:1,1,7,1,1,1,1,1,1 were found twice in 1992 and 1994, respectively. ST 1,1,1,6,1,1,1,1,1 was found once in 1998 and again in 1999. ST:1,1,1,1,1,4,1,1,1 was found in 1995 and 1998. Since the number of STs is large (51 types), and number of samples in a collection period is small (8-13 samples; Table 2), STs seen in multiple years must not only persist but also represent a substantial portion of the epidemic O139 V. cholerae population.

Five of the novel STs are related to other novel STs by allelic al·lele  
n.
One member of a pair or series of genes that occupy a specific position on a specific chromosome.



[German Allel, short for Allelomorph, allelomorph, from English
 change at another second or third locus. One sequence type evolved into three related types found in subsequent years (Figure 2a). The starred gmd allele is one related to the E. coli sequence, and its presence in two distinct related STs in two different years demonstrates its establishment in the population. That the pattern seen in Figure 2b of ancestral alleles rstR 1 and chi 1 and two variant alleles, rstR 7 and chi 5, was found in all combinations is indicative of an LGT event. Figure 2c-e shows three additional groups of related sequences. In Figure 2a, b, and d, the ST with the larger number of novel alleles occurred in later years. In contrast, in Figure 2c and e, the ST with the larger number of novel alleles occurred in the earlier years. The lack of an overall temporal relationship may result from the small sample size (8-13 isolates) in any year.

[FIGURE 2 OMITTED]

One isolate, CRC (Cyclical Redundancy Checking) An error checking technique used to ensure the accuracy of transmitting digital data. The transmitted messages are divided into predetermined lengths which, used as dividends, are divided by a fixed divisor. 5, is unusual because it has no sequenced alleles of the ancestral type. Nevertheless, the alleles from this isolate are closely related to those of the ancestral type. Each CRC5 allele differs from the ancestral allele by 7 nt for dnaE, 3 nt for lap, 4 nt for rstR, 24 nt for recA, 6 nt for pgm, 10 nt for gyrB, and 4nt for chi. A comprehensive survey of the genetic distances for these loci could determine the average distance between alleles for each of these loci. The data would provide insight into whether this isolate represents a second derivation of the O139 clinical type from an environmental strain or if it is a genetic outlier outlier /out·li·er/ (out´li-er) an observation so distant from the central mass of the data that it noticeably influences results.

outlier

an extremely high or low value lying beyond the range of the bulk of the data.
 within the clonally related, but diversified, O139 epidemic type.

Discussion

The emergence and pandemic spread of V.. cholerae O139 Bengal represented a chance to examine evolution of a bacterial strain in the midst Adv. 1. in the midst - the middle or central part or point; "in the midst of the forest"; "could he walk out in the midst of his piece?"
midmost
 of a clonal expansion. Our results are consistent with clonal expansion and subsequent divergence as described by Spratt and Maiden (26). Putative recombinant alleles were found at all nine loci among the 96 clonally related O139 isolates. One grad allele from V. cholerae was most similar to a gmd allele from E. coli. The number of base-pair differences among other alleles was higher than expected on the basis of a simple computation for the accumulation of independent mutations. This finding suggests that many of these events were due to LGT. When we applied our criteria to the novel alleles identified in a previous study (18), 11 of the 13 would be considered to have resulted from LGT, since the number of nucleotide differences to the ancestral allele varied from 4 to 19. Thus, for V. cholerae, like Neisseria, Streptococcus streptococcus (strĕp'təkŏk`əs), any of a group of gram-positive bacteria, genus Streptococcus, some of which cause disease. , and other bacterial species (11-14), conspecific recombination of homologous genes appears to be common and responsible for most of the alleles with multiple nucleotide differences and the majority of the nucleotide differences. The genetic variability at the nine loci alters our understanding of evolution in bacteria, showing that recombination in g cholerae occurs frequently and most nucleotide changes occur by means of a recombination that can alter any gene.

The proportion of recombinants from conspecific recombination, 3.5% (28/785) is greater than that from transgeneric recombination (0.01% from the acquisition of E. coli gmd by one isolate). One potential implication of a greater rate of conspecific recombination may be that, over time, it will maintain the species identity of each individual bacterium, despite the constant bombardment of homologous genes from other genera. Although at first glance the frequency of the novel sequence types appears to conflict between our study and an earlier study (18), the observations may be reconciled on the basis of both the observed frequencies and the timing of the observations. Both studies identified a common ancestral allele in from 77% to 99% of isolates in our study and a series of rare alleles with 1-19 variant alleles for each locus. These studies reported 10% novel sequence types in 29 isolates that were collected from "the first epidemic period epidemic period Epidemiology A timespan when the number of cases of a disease reported is greater than expected ," from 1992 to 1993 (18). Our data from 1992 showed 33% novel sequence types from a sample of nine. These data are not statistically different (chi-square test chi-square test: see statistics. =2.4, p=0.12). However, the researchers' estimate of frequency (18) is more likely to be correct because of the larger sample size. The dates of collection may also be important because our collection of isolates from 1993 began in March, when the number of O139 cases at the Infectious Diseases Hospital rose from < 10 to >80 per month, corresponding to a rapid population expansion or flush. Thus, we can predict that we would see substantial variation in our sample.

The genetic diversity was greater in the V. cholerae O139 isolates than in other clinically associated clones. In V. parahaemolyticus O3:K6, a pandemic strain, 94% of strains were identical at four loci (N. Chowdhury et al., unpub, data). In E. coli O157, all 77 isolates were identical at seven loci in spite of variation between isolates on PFGE (17). Although V. parahaemolyticus and E. coli are widespread pathogens, they differ from V. cholerae O139 because their population size has expanded much more slowly.

Among O139 isolates, the substantial genetic diversity found in the first year of the epidemic may reflect a "founder flush" phenomenon. During times of population expansion, i.e., a flush, any novel genotype with similar or even slightly deleterious fitness compared to the founder genotype will produce sufficient offspring to become established in the population (27). A founder flush appears to have occurred in the establishment of Helicobacter pylori Helicobacter pylori
A gramnegative rod-shaped bacterium that lives in the tissues of the stomach and causes inflammation of the stomach lining.

Mentioned in: Indigestion, Ulcers

Helicobacter pylori
 in a single person (28). Although other previous descriptions of this phenomenon have been limited to insects, specifically butterflies (29) and drosophilids (30), we believe that the founder flush phenomenon may become the paradigm for epidemic bacterial expansion in individual patients and populations. This founder flush phenomenon, in turn, has implications for our interpretation of "clonality" among epidemic isolates and for our understanding of factors that contribute to the emergence of new pathogenic strains.
Table 1. Primers used for multilocus sequence typing

Locus   Primer 1               Primer 2

dnaE    CGRATMACCGCTTTCGCCG    GAKATGTGTGAGCTGTTTGC
lap     GAAGAGGTCGGTTTGCGAGG   GTTTGAATGGTGAGCGGTTTGCT
rstR    CGTGTTAGAGCACAC        GAGTGAATCGTCGTG
gmd     CCTTATGCKGTGGCRAA      CTWGGATCACCTAACA
recA    GAAACCATTTCGACCGGTTC   CCGTTATAGCTGTACCAAGCGCCC
pgm     CCKTCSCAYAACCCGCC      TCRACRAACCATTTGAADCC
gyrB    GAAGGBGGTATTCAAGC      GAGTCACCCTCCACWATGTA
cat     ATGGCTTATGAATCGATGGG   TCCCATTGCCATGCACC
chi     CAYGAYCCRTGGGCWGC      ACRTCTTCAATCTTGTC

Table 2. Number of isolates tested and distinct sequence types, by year

No.                      1992   1993   1994   1995   1996   1997   1998

Isolates examined        9      9      12     10     13     11     12
Novel sequence types     3      6      6      7      8      6      7
Novel sequence types     0.33   0.66   0.5    0.7    0.62   0.55   0.58
  per isolate examined

No.                      1999   2000   Total

Isolates examined        12     8      96
Novel sequence types     4      7      51
Novel sequence types     0.33   0.88   0.53
  per isolate examined


This work was supported in part by an American Society for Microbiology The American Society for Microbiology (ASM) is a scientific organization, based in the United States although with over 43,000 members throughout the world. It is the largest single life science professional organization and its members include those whose interests encompass basic  travel fellowship to Dr. Garg.

References

(1.) Bhattacharya SK, Bhattacharya MK, Nair GB, Dutta D, Deb A, Ramamurthy T, et al. Clinical profile of acute diarrhoea cases infected with the new epidemic strain of Vibrio cholerae O139: designation of the disease as cholera. J Infect 1993;27:11-8.

(2.) Nair GB, Ramamurthy SK, Mukhopadhyay T, Garg S, Bhattacharya MK, Takeda T, et al. Spread of Vibrio cholerae O139 Bengal in India. J Infect Dis 1994;169:1029-34.

(3.) Comstock LE, Johnson JA, Michalski JM, Morris JG, Kaper JB. Cloning and sequence of a region encoding surface polysaccharide of Vibrio cholerae O139 and characterization of the insertion site in the chromosome of Vibrio cholerae O1. Mol Microbiol 1966; 19:815-26.

(4.) Stroeher UH, Parasivam G, Dredge BK, Manning PA. Novel Vibrio cholerae O139 genes involved in lipopolysaccharide lipopolysaccharide /lipo·poly·sac·cha·ride/ (-pol?e-sak´ah-rid)
1. a molecule in which lipids and polysaccharides are linked.

2.
 biosynthesis Biosynthesis

The synthesis of more complex molecules from simpler ones in cells by a series of reactions mediated by enzymes. The overall economy and survival of the cell is governed by the interplay between the energy gained from the breakdown of compounds
. J Bacteriol 1997; 179:2740-7.

(5.) Bik EM, Bunschoten AE, Willems RJL RJL Barndoor Skate (FAO fish species code)
RJL Remus John Lupin (fictional character) 
, Chang ACY ACY Atlantic City /Atlantic Cty, NJ, USA - Atlantic City International (Airport Code) , Mooi FR. Genetic organization and functional analysis of the otn DNA essential for cell-wall polysaccharide synthesis in Vibrio cholerae O139. Mol Microbiol 1996;20:799-811.

(6.) Basu A, Garg P, Datta S, Chakraborty S, Bhattacharya T, Yamasaki S, et al. Vibrio cholerae O139 in Calcutta, 1992-1998: incidence, antibiograms, and genotypes. Emerg Infect Dis 2000;6:139-47.

(7.) Faruque SM, Saha MN, Asadulghani, Bag PK, Bhadra RK, Bhattacharya SK, et al. Genomic diversity among Vibrio cholerae O139 strains isolated in Bangladesh and India between 1992 and 1998. FEMS Microbiol Lett 2000;184:279-84.

(8.) Stine OC, Sozhamannan S, Gou Q, Zheng S, Morris JG, Johnson JA. Phylogeny of Vibrio cholerae based on recA sequence. Infect Immun 2000;68:7180-5.

(9.) Garg P, Chakraborty S, Basu I, Datta S, Rajendran K, Bhattacharya T, et al. Expanding multiple antibiotic resistance antibiotic resistance,
n the ability of certain strains of microorganisms to develop resistance to antibiotics.

antibiotic resistance 
 among clinical strains of Vibrio cholerae isolated from 1992-7 in Calcutta, India. Epidemiol Infect 2000;124:393-9.

(10.) Kurazono H, Yamasaki S, Ratchtrachenchai O, Nair GB, Takeda Y. Analysis of Vibrio cholerae O139 Bengal isolated from different geographical areas using macrorestriction DNA analysis DNA analysis Any technique used to analyze genes and DNA. See Chromosome walking, DNA fingerprinting, Footprinting, In situ hybridization, Jeffries' probe, Jumping libraries, PCR, RFLP analysis, Southern blot hybridization. . Microbiol Immunol 1996;40:303-5.

(11.) Maiden MCJ MCJ Malattia Di Creutzfeldt-Jakob (Italian: Creutzfeldt-Jakob Disease)
MCJ Mississippi Center for Justice
MCJ Master Criminal Justice
MCJ Microcrystalline Cellulose, Jet Milled
MCJ Master of Laws in Comparative Jurisprudence Degree
, Bygraves JA, Fell E, Morelli G, Russell JE, Urwin R, et al. Multilocus sequence typing: a portable approach to the identification of clones within populations of pathogenic microorganisms. Proc Natl Acad Sci USA 1998;95:3140-5.

(12.) Dingle KE, Colles FM, Wareing DR, Ure R, Fox AJ, Bolton FE, et al. Multilocus sequence typing system for Campylobacter jejuni Campylobacter jejuni Vibrio jejuni, Campylobacter fetus ssp jejuni A curved or spiral gram-negative bacillus with a single polar flagellum Epidemiology Linked to contact with domestic and farm animals, unpasteurized milk, primates, day care . J Clin Microbiol 2001;39:14-23.

(13.) Enright MC, Day NP, Davies CE, Peacock S J, Spratt BG. Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus. J Clin Microbiol 2000;38:1008-15.

(14.) Fell EJ, Smith JM, Enright MC, Spratt BG. Estimating recombinational parameters in Streptococcus pneumoniae from multilocus sequence typing data. Genetics 2000;154:1439-50.

(15.) Nallapareddy SR, Duh duh  
interj.
Used to express disdain for something deemed stupid or obvious, especially a self-evident remark.



[Imitative of an utterance attributed to slow-witted people.]
 RW, Singh KV, Murray BE. Molecular typing of selected Enterococcus faecalis isolates: pilot study using multilocus sequence typing and pulsed-field gel electrophoresis. J Clin Microbiol 2002;40:868-76.

(16.) Kotetishvili M, Stine OC, Kreger A, Morris JG Jr., Sulakvelidze A. Multilocus sequence typing for characterization of clinical and environmental Salmonella strains. J Clin Microbiol 2002;40:1626-35.

(17.) Noller AC, McEllistrem MC, Stine OC, Morris JG, Boxrud DJ, Dixon B, et al. Lack of DNA sequence diversity among Escherichia coli O157:H7 isolates that are distinct by pulsed-field gel electrophoresis. J Clin Microbiol 2003;41:675-9.

(18.) Farfan M, Minana-Galbis D, Fuste MC, Loren JG. Allelic diversity and population structure in Vibrio cholerae O139 Bengal based on nucleotide sequence diversity. J Bacteriol 2002; 184:1304-13.

(19.) Mukhopadhyay AK, Chakraborty S, Takeda Y, Nair GB, Berg DE. Characterization of VPI VPI Voice Print International (Camarillo, CA)
VPI Virtual Path Identifier (used in Asynchronous Transfer Mode)
VPI Virginia Polytechnic Institute (aka Virginia Tech) 
 pathogenicity island and CTX[PHI] prophage prophage /pro·phage/ (pro´faj) the latent stage of a phage in a lysogenic bacterium, in which the viral genome becomes inserted into a specific portion of the host chromosome and is duplicated in each cell generation.  in environmental strains of Vibrio cholerae. J Bacteriol 2001; 183:4737-46.

(20.) Ewing B, Greene P. Base-calling of automated sequencer traces using Phred. II. Error probabilities. Genome Res 1998;8:186-94.

(21.) Ewing B, Hillier L, Wendl M, Greene P. Base-calling of automated sequencer traces using Phred. I. Accuracy assessment. Genome Res 1998;8:175-85.

(22.) Green P. 1998. Phrap, SWAT and CrossMatch Crossmatch
A laboratory test done to confirm that blood from a donor and blood from the recipient are compatible.

Mentioned in: Blood Typing and Crossmatching, Heart Transplantation

crossmatch 
. Available from: URL: http://www.washington.edu

(23.) Jeanmougin F, Thompson JD, Gouy M, Higgins DG, Gibson TJ. Multiple sequence alignment A multiple sequence alignment (MSA) is a sequence alignment of three or more biological sequences, generally protein, DNA, or RNA. In general, the input set of query sequences are assumed to have an evolutionary relationship by which they share a lineage and are descended from a  with Clustal X. Trends Biochem Sci 1998;23:403-5.

(24.) Swofford D. PAUP * beta version. Sunderland (MA): Sinauer Assoc; 2000.

(25.) Beltran P, Delgrado G, Navarro A, Trujillo F, Selander RK, Cravioto A. Genetic diversity and population structure of Vibrio cholerae. J Clin Microbiol 1999;37:581-90.

(26.) Spratt BG, Maiden MCJ. Bacterial population genetics, evolution and epidemiology. Philos Trans R Soc Lond Biol Sci 1999;354:701-10.

(27.) Wallace B. Basic populations genetics. New York: Columbia University Press Columbia University Press is an academic press based in New York City and affiliated with Columbia University. It is currently directed by James D. Jordan (2004-present) and publishes titles in the humanities and sciences, including the fields of literary and cultural studies, ; 1981. p. 429-32.

(28.) Israel DA, Salama N, Krishna U, Rieger UM, Atherton JC, Falkow S, et al. Helicobacter pylori genetic diversity within the gastric niche of a single host. Proc Natl Acad Sci USA 2001;98:14625-30.

(29.) Ford HD, Ford EB. Fluctuation in numbers, and its influence on variation, in Melitaea aurina, Rott. (Lepidoptera). Transactions of the Royal Entomological en·to·mol·o·gy  
n.
The scientific study of insects.



ento·mo·log
 Society London 1930;78:345-51.

(30.) Carson HL. The population flush and its genetic consequences. In: Lewontin RC, editor. Population biology and evolution. Syracuse (NY): Syracuse University Press Syracuse University Press, founded in 1943, is a university press that is part of Syracuse University. External link
  • Syracuse University Press
; 1968. p. 123-37.

Address for correspondence: O. Colin Stine, Department of Epidemiology and Preventive Medicine, University of Maryland School of Medicine, Baltimore, MD 21201, USA; fax: 410-706-1644; email: ostin001@umaryland.edu

Pallavi Garg, * ([dagger]) Antonia Aydanian, ([double dagger]) David Smith, ([double dagger]) J. Glenn Morris, Jr., ([double dagger]) G. Balakrish Nair G. Balakrish Nair is an Indian microbiologist who is currently the Director, Laboratory Sciences Division, at the International Center for Diarrhoeal Diseases Research, Bangladesh (ICDDR,B), Dhaka, Bangladesh. , * ([double dagger]) and O. Colin Stine ([double dagger])

* National Institute of Cholera and Enteric enteric /en·ter·ic/ (en-ter´ik) within or pertaining to the small intestine.

en·ter·ic
adj.
1. Of, relating to, or within the intestine.

2.
 Diseases, Calcutta, India; ([dagger]) International Centre for Diarrheal Diseases Research, Dacca, Bangladesh; and ([double dagger]) University of Maryland School of Medicine, Baltimore, Maryland, USA

Dr. Garg completed this work as part of her Ph.D. dissertation at University of Calcutta Formally established on the 24 January 1857, the University of Calcutta (also known as Calcutta University) (Bengali: কলকাতা বিশ্ববিদ্যালয়), located in . She is a postdoctoral fellow at the University of Maryland School of Medicine, pursuing studies of thrombospondin in human microvascular endothelial cells.
COPYRIGHT 2003 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2003, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Author:Stine, O. Colin
Publication:Emerging Infectious Diseases
Geographic Code:9INDI
Date:Jul 1, 2003
Words:4050
Previous Article:Emergence and global spread of a dengue serotype 3, subtype III virus. (Research).
Next Article:Amoeba-resisting bacteria and ventilator-associated pneumonia. (Research).
Topics:



Related Articles
Vibrio cholerae O139 in Calcutta, 1992-1998: incidence, antibiograms, and genotypes.
Genes of cholera germ deciphered.(Vibrio cholera)
Vibrio cholerae Outbreak in Italy.
Three cases of bacteremia caused by Vibrio cholerae O1 in Blantyre, Malawi. (Dispatches).
Class I integrons and SXT elements in El Tor strains isolated before and after 1992 Vibrio cholerae O139 outbreak, Calcutta, India. (Dispatches).
Study reveals sari cloth filtration reduces cholera. (Environmental Intelligence).
Reemergence of epidemic Vibrio cholerae O139, Bangladesh.(Research)
Vibrio cholerae SXT element, Laos.(Letters)(Letter to the Editor)
Enterotoxigenic Escherichia coli and Vibrio cholerae diarrhea, Bangladesh, 2004.(DISPATCHES)
Vibrio cholerae pathogenic clones.(DISPATCHES)

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles