Printer Friendly
The Free Library
19,122,084 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Molecular analysis of fluoroquinolone-resistant salmonella paratyphi a isolate, India.


Salmonella enterica serovar Paratyphi A is increasingly a cause of enteric fever. Sequence analysis of an Indian isolate showed a unique strain with high-level resistance to ciprofloxacin ciprofloxacin /cip·ro·flox·a·cin/ (sip?ro-flok´sah-sin) a synthetic antibacterial effective against many gram-positive and gram-negative bacteria; used as the hydrochloride salt.

cip·ro·flox·a·cin
n.
 associated with double mutations in the DNA gyrase subunit gyrA (Ser83 [right arrow] Phe and Asp87 [right arrow] Gly) and a mutation in topoisomerase IV subunit parC (Ser80 [right arrow] Arq).

**********

Salmonella enterica serovar Paratyphi A is the second most common cause of enteric fever after S. Typhi. Approximately 0.25 S. Paratyphi A infections (paratyphoid fever Paratyphoid Fever Definition

Paratyphoid fever, which is sometimes called Salmonella paratyphi infection, is a serious contagious disease caused by a gram-negative bacterium.
) occur for each S. Typhi infection (typhoid fever) (1). Given global estimates of >21 million cases of typhoid fever in the year 2000, >5 million cases per year of S. Paratyphi A probably occur. Paratyphoid fever is a major clinical problem in India, but large outbreaks were not reported until 1996 (2). Elsewhere, in southern China for example, extensive outbreaks are also occurring (3).

Since 1998, plasmid-mediated multidrug resistance in S. Paratyphi A, associated with chromosomally mediated reduced susceptibility to ciprofloxacin, has caused concern (4). Reduced susceptibility to fluoroquinolones results in a poor response of salmonellosis salmonellosis (săl'mənĕlō`sĭs), any of a group of infectious diseases caused by intestinal bacteria of the genus Salmonella,  patients to treatment and may allow prolonged bacterial shedding (5). Rising resistance to fluoroquinolones is likely to be driving an increase in cases of paratyphoid fever in regions where fluoroquinolones are used empirically to treat enteric fever. We must monitor the emergence of resistance in this enteric pathogen to differentiate between the acquisition of resistance during treatment (mutations occurring in different bacterial strains) or clonal expansion of a successful strain by person-to-person spread (identical mutations associated with a single strain). To do so, we need to describe the molecular basis of resistance and the genotype of the resistant strains. High-level ciprofloxacin-resistant S. Paratyphi A (MIC 8 [micro]g/mL) is present in India (6) and Japan (MIC [greater than or equal to] 128 [micro]g/mL) (7). However, because S. Typhi, the major cause of enteric fever in India, has not yet developed high-level resistance to fluoroquinolones, enteric fevers are often treated empirically with fluoroquinolones. If this trend continues, fluoroquinolone-resistant strains of S. Paratyphi A are almost certain to become a major cause of enteric fever in many areas.

We analyzed, by DNA sequencing, the DNA gyrase and topoisomerase IV genes of the first reported highly fluoroquinolone-resistant S. Paratyphi A isolate (6). We looked at the full coding sequence, including the quinolone resistance-determining region (QRDR QRDR Quinolone Resistance-Determining Regions ), of both subunits of DNA gyrase and topoisomerase IV for mutations associated with resistance to fluoroquinolones. We also used multilocus sequence typing Multilocus sequence typing (MLST) is a technique in molecular biology for the typing of multiple loci. The procedure characterizes isolates of bacterial species using the DNA sequences of internal fragments of multiple (usually seven) housekeeping genes.  (MLST MLST Multi Locus Sequence Typing
MLST Medical Logistics Support Team
MLST Mini Losi Super Truck (1/18th scale radio control vehicle) 
) to confirm the identity of the isolate.

The Study

The strain described here (Pond1) was first isolated in Pondicherry, India, in November 2002 from the blood of a 23-year-old man admitted with fever and with no history of having received antimicrobial chemotherapy (6). The isolate was resistant to ciprofloxacin and nalidixic acid, and the MIC of ciprofloxacin was 8 mg/L. It was sensitive to all other antimicrobial drugs tested by disk diffusion: ampicillin ampicillin (ăm'pĭsĭl`ĭn), a penicillin-type antibiotic that is effective against both gram-negative microorganisms and gram-positive microorganisms such as Escherichia coli. , chloramphenicol chloramphenicol (klōr'ămfĕn`əkŏl'), antibiotic effective against a wide range of gram-negative and gram-positive bacteria (see Gram's stain). It was originally isolated from a species of Streptomyces bacteria. , cotrimoxazole, gentamicin gentamicin /gen·ta·mi·cin/ (jen?tah-mi´sin) an aminoglycoside antibiotic complex isolated from bacteria of the genus Micromonospora, , and ceftriaxone ceftriaxone /cef·tri·ax·one/ (cef?tri-ak´son) a semisynthetic, ß–resistant, third-generation cephalosporin effective against a wide range of gram-positive and gram-negative bacteria, used as the sodium salt. . Repeat testing showed that zones of inhibition indicating susceptibility were seen around both ofloxacin (17 mm) and ciprofloxacin (21 mm) 5-[micro]g disks; however, in light of the ciprofloxacin MIC and resistance to nalidixic acid, Pondl was considered resistant to fluoroquinolones. No similar isolates have been seen in this area since the initial report, although the total number of paratyphoid fever cases has increased.

Polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is  (PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
) amplification (Table 1) and direct DNA sequencing of both strands of the full length of gyrase (gyrA and gyrB) and topoisomerase IV (parC andparE) subunit genes was performed with an ABI Abi (ā`bī) [short for Abijah], in the Bible, King Hezekiah's mother.


(Application Binary Interface) A specification for a specific hardware platform combined with the operating system.
 Prism dye terminator cycle sequencing kit (Perkin Elmer, Foster City, CA, USA) on an ABI 3730 automated sequencer See MIDI sequencer.

(music) sequencer - Any system for recording and/or playback of music via a programmable memory which stores music not as audio data, but as some representation of notes.
. Results showed 3 mutations: 2 in gyrA and 1 in parC. A comparison of these mutations with those previously described in fluoroquinolone-resistant S. Paratyphi A is shown in Table 2. A rise of fluoroquinolone fluoroquinolone /flu·o·ro·quin·o·lone/ (-kwin´o-lon) any of a subgroup of fluorine-substituted quinolones, having a broader spectrum of activity than nalidixic acid.

fluor·o·quin·o·lone
n.
 resistance over time is apparent, and although the point mutations do not fully explain the MIC data, we noted general associations: a single mutation in gyrA is always associated with resistance to nalidixic acid and reduced susceptibility to ciprofloxacin and ofloxaein, and a double mutation in gyrA is always accompanied by mutations in parC and is associated with high-level (>4 [micro]g/mL) resistance. Although this sample is limited, heterogeneity in mutations found at all sites suggests that this finding is not the result of a single successful strain's sequentially acquiring mutations but rather that resistance is arising in several different strains.

Conclusions

The QRDR within topoisomerases contains hotspots for mutations around the active site, which are associated with raised MIC values for fluoroquinolones (10). For gyrA from nalidixic acid-resistant Salmonella isolates, 2 mutations are most frequently observed in clinical isolates: Ser83[right arrow]Phe and Ser83[right arrow]Tyr (8,9,11). The association with resistance of mutations seen in parC, however, is less clear (12). Mutations in parC of gram-negative bacteria are usually within the QRDR at amino acids 80 and 84 (Set 80[right arrow]Ile, Glu 84[right arrow]Gly, Lys). The first reported mutation was Thr57[right arrow]Ser, and other mutations have been described: Asp 79[right arrow]Ala, Gly 78[right arrow]Asp (9). Each mutation, in gyrA or parC, can give rise to different MICs in different isolates, which means that other factors must also influence the resistance phenotype in S. Paratyphi A. The most likely cause is changes in expression levels of proteins involved with permeability barriers and efflux efflux Medtalk That which flows outward  pumps. These changes could be the result of either point mutations in transcription promoters and regulators or downstream effects of mutations in topoisomerases. Known mechanisms of fluoroquinolone resistance that we were able to screen for include transmissible transmissible /trans·mis·si·ble/ (trans-mis´i-b'l) capable of being transmitted.

trans·mis·si·ble
adj.
Capable of being conveyed from one person to another.
 plasmidborne resistance and efflux pumps. The qnr-containing plasmid was not detected with PCR using primers 5' GGG GGG German Goo Girls (pornography website)
GGG Giggle (email, USENET, chat slang)
GGG Gadolinium Gallium Garnet
GGG Gimme Gimme Gimme (TV show) 
 TAT GGA GGA Generalized Gradient Approximation
GGA Good Game All
ggA Geschützte Geographische Angabe (German: Protected Geographical Indication)
GGA Global Gecko Association
GGA Georgia Geocachers Association
 TAT TAT TGA See TARGA.

TGA - Targa Graphics Adaptor
 TAA TAA - Track Average Amplitude  3' and 5' CTA An abbreviation for cum testamento annexo, Latin for "with the will annexed."  ATC ATC Air Traffic Control
ATC Average Total Cost
ATC Certified Athletic Trainer
ATC At the Center (Hartford, Maine retreat center)
ATC Applied Technology Council
ATC All Things Considered
 CGG CGG Compagnie Generale de Geophysique
CGG Cytosine-Guanine-Guanine
CGG Canadian Grenadier Guards (Canadian reserve military unit)
CGG Cancer Genetics Group (Birmingham, UK) 
 CAG CAG 1 Chronic atrophic gastritis 2 Coronary angiography, see there  CAC See Consumer Advisory Council.  TAT TA 3' (13) in Pond1, and sensitivity testing gave the same zone size around both tetracycline tetracycline (tĕ'trəsī`klēn), any of a group of antibiotics produced by bacteria of the genus Streptomyces. They are effective against a wide range of Gram positive and Gram negative bacteria, interfering with protein  and chloramphenicol discs when compared with a nalidixic acid-susceptible isolate. This finding, combined with the ciprofloxacin MIC of 8 [micro]g/mL, argues against the presence of multiple antimicrobial drug resistance efflux pumps. Thus the high-level resistance seen in Pond1 appears to be associated directly with 3 point mutations in the topoisomerase topoisomerase

an enzyme involved in DNA replication that introduces a single-strand nick in the DNA enabling it to swivel and thereby relieve the accumulated winding strain generated during unwinding of the double helix.
 genes.

To confirm the identity of the isolate as S. Paratyphi A, we used MLST. The primer sequences and MLST data are available from the MLST database at the Max-Planck-Institut fur Infektionsbiologie (http://web.mpib-berlin. mpg.de/mlst/). Six of 7 sequenced loci matched exactly the previously described sequences, and 1 was a unique allele allele (əlēl`): see genetics.
allele

Any one of two or more alternative forms of a gene that may occur alternatively at a given site on a chromosome.
. This finding means that the isolate described here is within the clonal MLST group described as S. Paratyphi A but is a recognizable variant. This finding supports previous typing data that show very little variation (14); typing S. Paratyphi A is problematic because genomic restriction analyses (pulsed-field gel electrophoresis) of isolates from an outbreak are not always identical, and susceptible and resistant strains cannot be differentiated. For molecular epidemiologic studies to be carried out, several methods need to be used (15). A broader study of single base-pair differences between strains of S. Paratyphi A could provide a usable typing scheme.

Resistance in S. Paratyphi A populations must be monitored because the acquisition of resistance to fluoroquinolones, coupled with the reduction in S. Typhi by the use of typhoid-specific vaccination, may cause S. Paratyphi A to become the main cause of enteric fever. Disc susceptibility testing does not always detect resistance, and screening with nalidixic acid and MIC testing remains the method of choice. The isolate described here, Pond1, contains a unique combination of mutations that provides a way to track the spread of this strain of S. Paratyphi A.

Acknowledgments

We thank the diagnostic microbiologists who isolated and characterized the strains described in this manuscript.

Satheesh Nair, John Wain, and Keith Turner are funded by The Wellcome Trust of Great Britain.

Dr Nair is a research associate in tropical bacteriology bacteriology

Study of bacteria. Modern understanding of bacterial forms dates from Ferdinand Cohn's classifications. Other researchers, such as Louis Pasteur, established the connection between bacteria and fermentation and disease.
 at The Wellcome Trust Sanger Institute, The Wellcome Trust Genome Campus The Wellcome Trust Genome Campus is a scientific research campus located in the village of Hinxton, Cambridgeshire.

It is owned by the Wellcome Trust, and its largest component is the Wellcome Trust Sanger Institute.
, United Kingdom. His research includes the use of molecular tools to detect genomic diversity of drug-resistant/drug-susceptible Salmonella spp. from different geographic and epidemiologic backgrounds and effects of drug resistance on the biology of the organism.

References

(1.) Crump JA, Luby SP, Mintz ED. The global burden of typhoid fever. Bull World Health Organ. 2004;82:346-53.

(2.) Sood S, Kapil A, Dash N, Das BK, Goel V, Seth P. Paratyphoid fever in India: an emerging problem. Emerg Infect Dis. 1999;5:483-4.

(3.) Yang J, Dong B, Wang M, Tang Z, Gong J, Li C, et al. An analysis of S. Paratyphi A and S. Typhi prevalence in Guangxi autonomous region between 1994-2002 [article in Chinese]. China Trop Med. 2004;a:177-18.

(4.) Chandel DS, Chaudhry R, Dhawan B, Pandey A, Dey AB. Drug-resistant Salmonella enterica serotype serotype /se·ro·type/ (ser´o-tip) the type of a microorganism determined by its constituent antigens; a taxonomic subdivision based thereon.

se·ro·type
n.
See serovar.

v.
 Paratyphi A in India. Emerg Infect Dis. 2000;6:420-1.

(5.) Wain J, Hoa NT, Chinh NT, Vinh H, Everett MJ, Diep TS, et al. Quinolone-resistant Salmonella typhi in Viet Nam: molecular basis of resistance and clinical response to treatment. Clin Infect Dis. 1997;25:1404-10.

(6.) Harish BN, Madhulika U, Parija SC. Isolated high-level ciprofloxacin resistance in Salmonella enterica subsp, enterica serotype Paratyphi A. J Med Microbiol. 2004;53:819.

(7.) Adachi T, Sagara H, Hirose K, Watanabe H. Fluoroquinolone-resistant Salmonella Paratyphi A. Emerg Infect Dis. 2005; 11:172-4.

(8.) Walker RA, Skinner JA, Ward LR, Threlfall EJ. LightCycler gyrA mutation assay (GAMA Ga·ma   , Vasco da 1460?-1524.

Portuguese explorer and colonial administrator. The first European to sail to India (1497-1498), he opened the rich lands of the East to Portuguese trade and colonization.
) identifies heterogeneity in gyrA in Salmonella enterica serotypes Typhi and Paratyphi A with decreased susceptibility to ciprofloxacin. Int J Antimicrob Agents. 2003;22: 622-5.

(9.) Ling JM, Chan EW, Lam AW, Cheng AF. Mutations in topoisomerase genes of fluoroquinolone-resistant salmonellae in Hong Kong. Antimicrob Agents Chemother. 2003;47:3567-73.

(10.) Piddock LJ. Fluoroquinolone resistance in Salmonella serovars isolated from humans and food animals. FEMS Microbiol Rev. 2002;26:3-16.

(11.) Eaves DJ, Randall L, Gray DT, Buckley A, Woodward MJ, White AP, et al. Prevalence of mutations within the quinolone resistance-determining region of gyrA, gyrB, parC, and parE and association with antibiotic resistance in quinolone-resistant Salmonella enterica. Antimicrob Agents Chemother. 2004;48:4012-5.

(12.) Piddock LJ, Ricci V, McLaren I, Griggs DJ. Role of mutation in the gyrA and parC genes of nalidixic-acid-resistant salmonella serotypes isolated from animals in the United Kingdom. J Antimicrob Chemother. 1998;41:635-41.

(13.) Wang M, Sahm DF, Jacoby GA, Hooper DC. Emerging plasmid-mediated quinolone resistance associated with the qnr gene in Klebsiella pneumoniae clinical isolates in the United States. Antimicrob Agents Chemother. 2004;48:1295-9.

(14.) Selander RK, Beltran P, Smith NH, Helmuth R, Rubin FA, Kopecko DJ, et al. Evolutionary genetic relationships of clones of Salmonella serovars that cause human typhoid and other enteric fevers. Infect Immun. 1990;58:2262-75.

(15.) Chandel DS, Nisar N, Thong KL, Pang T, Chaudhry R. Role of molecular typing in an outbreak of Salmonella paratyphi A. Trop Gastroenterol. 2000;21:121-3.

Address for correspondence: Belgode Narasimha Harish, Department of Microbiology, JIPMER JIPMER Jawaharlal Nehru Institute of Postgraduate Medical Education and Research , Pondicherry 605006, India; fax: 91-413-2272067; email: drbnharish@yahoo.com

Satheesh Nair, * Madhulika Unnikrishnan, (dagger]) Keith Turner, * Subash Chandra Parija, ([dagger]) Carol Churcher, * John Wain, * and Belgode Narasimha Harish ([dagger])

* The Wellcome Trust Sanger Institute, Cambridgeshire, United Kingdom; and ([dagger]) Jawaharlal Institute of Postgraduate Medical Education and Research, Pondicherry, India
Table 1. Primer sequences for amplification of topoisomerases

                                                               Gene
                                                             (coding
                                                             sequence
Primer       Sequence 5'-3'                       Amplicon   length)

gyrA7 (F)    5' GGGTCGACTGATTATGGTTTATGCCTCC 3'     3199       2637
gyrA25 (R)   5' GAGACTTTCAGCGTAGTTCG 3'
gyrB1 (F)    5' TTGCCTCTGAACTTGACGATGC 3'           2762       2415
gyrB9 (R)    5' GAAGTCGCTGACCTGCTCAC 3'
parC3 (F)    5' CGATTTTCCGGTCTTCTTCCAG 3'           2616       2259
parC10 (R)   5' GCAATGCACGAATAAACAACGG 3'
parE3 (F)    5' CCTGATCTGGCTACTGCAACAG 3'           2183       1893
parE8 (R)    5' ATGCGCAAGTGTCGCCATCAG 3'

Table 2. Presence of gnr and mutations in DNA gyrase and topoisomerase
IV genes of Salmonella enterica serovar Paratyphi A strains associated
with decreased susceptibility or resistance to ciprofloxacin *

                                 MIC ([micro]g/mL)

Country       Year                  Cp                  Nal

India         1999                 0.38                 >256
Bangladesh    1999                 0.5                  >256
India         1999                 0.5                  >256
Hong Kong     2000                 0.5                  >256
Japan         2002    [greater than or equal to] 128    >256
India         2002                  8                   >256

Country       qnr              gyrA

India         ND     Ser83 [right arrow] Phe
Bangladesh    ND     Asp87 [right arrow] Gly
India         ND     Ser83 [right arrow] Phe
Hong Kong     ND     Ser83 [right arrow] Tyr
Japan         ND     Ser83 [right arrow] Phe,
                     Asp8  [right arrow] Asn
India         NP     Ser83 [right arrow] Phe,
                     Asp87 [right arrow] Gly

Country                      parC                   Reference

India                         ND                       (8)
Bangladesh                    ND                       (8)
India                         ND                       (8)
Hong Kong                     NM                       (9)
Japan              Glu84 [right arrow] Lys             (7)

India         Ser80 [right arrow] Arg ([dagger])    This study

* No mutations were detected in gyrB and parE. Cp, ciprofloxacin; Nal,
nalidixic acid, ND, not determined; NP, not present; NM, no mutation
within the quinolone resistance-determining region.

([dagger]) European Molecular Biology Laboratory accession no. AM050347.
COPYRIGHT 2006 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2006, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:DISPATCHES
Author:Harish, Belgode Narasimha
Publication:Emerging Infectious Diseases
Geographic Code:9INDI
Date:Mar 1, 2006
Words:2143
Previous Article:Lyssavirus surveillance in bats, Bangladesh.
Next Article:Canine coronavirus highly pathogenic for dogs.
Topics:



Related Articles
Paratyphoid Fever in India: An Emerging Problem.
Genotypic Analysis of Multidrug-Resistant Salmonella enterica Serovar Typhi, Kenya.
Presence of Class I Integrons in Multidrug-Resistant, Low-Prevalence Salmonella Serotypes, Italy.
Reduced fluoroquinolone susceptibility in salmonella enterica serotypes in travelers returning from Southeast Asia. (Research).
Salmonella enterica serotype Typhimurium DT 104 antibiotic resistance genomic Island I in serotype Paratyphi B.
Ciprofloxacin treatment failure in typhoid fever case, Pakistan.
Ciprofloxacin-resistant Salmonella enterica Typhimurium and Choleraesuis from pigs to humans, Taiwan.
Emergence of Multidrug-resistant Salmonella Paratyphi B [dT.sup.+], Canada.
Salmonella Paratyphi A rates, Asia.
Aquariums as reservoirs for multidrug-resistant Salmonella Paratyphi B.

Terms of use | Copyright © 2012 Farlex, Inc. | Feedback | For webmasters | Submit articles