Printer Friendly
The Free Library
14,550,492 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Molecular Epidemiology of Serogroup A Meningitis in Moscow, 1969-1997.


Molecular analysis of 103 serogroup A Neisseria meningitidis Neisseria men·in·git·i·dis
n.
The bacteria that is the causative agent of cerebrospinal meningitis; meningococcus.


Neisseria meningitidis 
 strains isolated in Moscow from 1969 to 1997 showed that four independent clonal groupings were responsible for successive waves of meningococcal disease. An epidemic from 1969 to the mid-1970s was caused by genocloud 2 of subgroup III, possibly imported from China. Subsequent endemic disease Endemic disease
An infectious disease that occurs frequently in a specific geographical locale. The disease often occurs in cycles. Influenza is an example of an endemic disease.
 through the early 1990s was caused by subgroup X and then by subgroup VI, which has also caused endemic disease elsewhere in eastern Europe Eastern Europe

The countries of eastern Europe, especially those that were allied with the USSR in the Warsaw Pact, which was established in 1955 and dissolved in 1991.
. A 1996 epidemic was part of the pandemic pandemic /pan·dem·ic/ (pan-dem´ik)
1. a widespread epidemic of a disease.

2. widely epidemic.


pan·dem·ic
adj.
Epidemic over a wide geographic area.

n.
 spread from Asia of genocloud 8 of subgroup III. Recent genocloud 8 epidemic disease Noun 1. epidemic disease - any infectious disease that develops and spreads rapidly to many people
pest, pestilence, plague - any epidemic disease with a high death rate

infectious disease - a disease transmitted only by a specific kind of contact
 in Moscow may represent an early warning for spread of these bacteria to other countries in Europe.

Until the mid-1970s, Neisseria meningitidis expressing the serogroup A capsular cap·su·lar  
adj.
Of, relating to, or resembling a capsule.

Adj. 1. capsular - resembling a capsule; "the capsular ligament is a sac surrounding the articular cavity of a freely movable joint and attached to the bones"
 polysaccharide polysaccharide: see carbohydrate.
polysaccharide

Any of a large class of long-chain sugars composed of monosaccharides. Because the chains may be unbranched or branched and the monosaccharides may be of one, two, or occasionally more kinds,
 caused numerous epidemics of meningitis and septicemia septicemia (sĕptĭsē`mēə), invasion of the bloodstream by virulent bacteria that multiply and discharge their toxic products. The disorder, which is serious and sometimes fatal, is commonly known as blood poisoning. , with annual incidence rates [is greater than] 100/100,000 (1). During serogroup A epidemics, these bacteria can also be isolated from the nasopharynx nasopharynx /na·so·phar·ynx/ (-far´inks) the part of the pharynx above the soft palate.nasopharyn´geal

na·so·phar·ynx
n.
 of a considerable proportion of the healthy population (2). After the mid-1970s, large serogroup A epidemics became rare, except in the so-called Meningitis Belt meningitis belt A popular term for a region of sub-Saharan Africa where epidemics of group A meningococcal infection occur in cycles of
± 10 yrs
 in the Sahel region Sahel is one of Burkina Faso's 13 administrative regions. It was created on 2 July 2001 and had a population of 837,420 in 2002. The region's capital is Dori. Four provinces make up the region - Oudalan, Séno, Soum, and Yagha.  of Africa (3,4). In 1997, N. meningitidis caused approximately 500,000 cases of disease and 50,000 deaths worldwide, half of them in Africa (5). Serogroup A meningococci are currently isolated only rarely in western Europe Western Europe

The countries of western Europe, especially those that are allied with the United States and Canada in the North Atlantic Treaty Organization (established 1949 and usually known as NATO).
 and the United States United States, officially United States of America, republic (2005 est. pop. 295,734,000), 3,539,227 sq mi (9,166,598 sq km), North America. The United States is the world's third largest country in population and the fourth largest country in area. , and a rise in either the healthy carriage rate or the proportion of serogroup A cases would be cause for concern.

Epidemic isolates of N. meningitidis have been assigned to a limited number of clonal groupings, historically by multilocus enzyme electrophoresis (MLEE MLEE Multilocus Enzyme Electrophoresis ) (4) and currently by multilocus sequence typing Multilocus sequence typing (MLST) is a technique in molecular biology for the typing of multiple loci. The procedure characterizes isolates of bacterial species using the DNA sequences of internal fragments of multiple (usually seven) housekeeping genes.  (MLST MLST Multi Locus Sequence Typing
MLST Medical Logistics Support Team
MLST Mini Losi Super Truck (1/18th scale radio control vehicle) 
) (6). For MLST, sequences of housekeeping gene fragments are assigned different numeric allele allele (əlēl`): see genetics.
allele

Any one of two or more alternative forms of a gene that may occur alternatively at a given site on a chromosome.
 designations, even if they differ by only one nucleotide. The combination of alleles from seven housekeeping gene fragments is called the sequence type (ST). Serogroup A bacteria have also been assigned to clonal groupings by random amplification of polymorphic polymorphic - polymorphism  DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 (RAPD RAPD Randomly Amplified Polymorphic DNA
RAPD relative afferent pupillary defect (ophthalmology; aka Marcus-Gunn Pupil) 
) (7). These three methods yield largely concordant results, except that MLST is the most conservative and RAPD differentiates the largest number of isolates. The clonal groupings among serogroup A meningococci have been designated subgroups I through IX according to according to
prep.
1. As stated or indicated by; on the authority of: according to historians.

2. In keeping with: according to instructions.

3.
 MLEE (7,8). Some of these subgroups have not been differentiated by RAPD analysis (I vs. II, III vs. VIII) (7) or MLST.

Recent epidemic serogroup A disease in Europe has largely reflected the pandemic patterns of spread of subgroup III meningococci. After a large subgroup III epidemic in China in the mid-1960s (8), these bacteria caused an outbreak of meningococcal disease in 1969 in western Norway (9), followed in the mid-1970s by a major epidemic in Finland (10). During the 1970s, subgroup III meningococci were isolated throughout western and northern Europe (11). In 1987, serogroup A, subgroup III meningococci caused a meningitis epidemic during the Hajj hajj (häj), the pilgrimage to Mecca, Saudi Arabia, one of the five basic requirements (arkan or "pillars") of Islam. Its annual observance corresponds to the major holy day id al-adha,  pilgrimage to Mecca pilgrimage to Mecca

(hajj) journey every good Muslim tries to make at least once. [Islamic Religion: WB, 10: 374–376]

See : Journey
, Saudi Arabia Saudi Arabia (sä`dē ərā`bēə, sou`–, sô–), officially Kingdom of Saudi Arabia, kingdom (2005 est. pop.  (12), and healthy pilgrims carried these bacteria throughout the world. Localized serogroup A disease was associated with former pilgrims for several years in the United Kingdom (13) and France (14), but these meningococci have since largely disappeared from western Europe. Rare endemic serogroup A disease was associated with subgroup VI in East Germany East Germany: see Germany.  in the 1980s (8) and with subgroup IX in the Netherlands in the early 1990s (7).

Meningococci are naturally transformable and can import novel alleles from neisseriae that colonize col·o·nize  
v. col·o·nized, col·o·niz·ing, col·o·niz·es

v.tr.
1. To form or establish a colony or colonies in.

2. To migrate to and settle in; occupy as a colony.

3.
 the nasopharynx (15,16). However, these recombinant strains are usually lost during the bottlenecks caused by limited numbers of bacteria being transmitted during epidemic spread (17). Occasionally, variants pass through these bottlenecks first, and all subsequent progeny PROGENY - 1961. Report generator for UNIVAX SS90.  have a common genetic background different from that of the parental bacteria (17). Most subgroup III bacteria isolated from the mid-1960s to the mid-1980s ("pre-Mecca") had particular alleles of the hypervariable opaB and opaD loci loci

[L.] plural of locus.

loci Plural of locus, see there
 encoding Opa (opacity Refers to being "opaque," which means to prevent light from shining through. For example, in an image editing program, the opacity level for some function might range from completely transparent (0) to completely opaque (100). ) proteins and the iga locus encoding IgA1 protease protease /pro·te·ase/ (pro´te-as) endopeptidase.

pro·te·ase
n.
Any of various enzymes, including the proteinases and peptidases, that catalyze the hydrolytic breakdown of proteins.
. In contrast, subgroup III bacteria isolated after the 1987 Mecca epidemic ("post-Mecca") had other alleles at these three loci (17). Exceptional isolates with still other alleles at one or more of these loci were also found in several countries, but these variants all disappeared during subsequent epidemic spread (17).

Data in the English literature English literature, literature written in English since c.1450 by the inhabitants of the British Isles; it was during the 15th cent. that the English language acquired much of its modern form.  about meningococci from Russia and other areas of eastern Europe are scarce. In recent decades, most patients with meningitis in Moscow (population 8.6 million during 1990 to 1999) have been treated at the Second Moscow Hospital for Infectious Diseases infectious diseases: see communicable diseases. . Our review of their records shows that from 1980 to 1999, the annual incidence rates of meningitis caused by Haemophilus influenzae Haemophilus in·flu·en·zae
n.
A gram-negative, rod-shaped bacterium of the genus Haemophilus, especially Haemophilus influenzae type b, that occurs in the human respiratory tract and causes acute respiratory infections, acute conjunctivitis, and
 and Streptococcus pneumoniae Streptococcus pneu·mo·ni·ae
n.
Pneumococcus.


Streptococcus pneumoniae Microbiology A pathogenic streptococcus with 90 serotypes associated with pneumonia, bacteremia, meningitis Transmission Person to person Incidence
 were approximately 0.2/100,000 and 0.4/100,000, respectively. In contrast, several epidemics of meningococcal disease with much higher incidence rates occurred in Moscow from 1924 to 1998 (Figure 1). Large serogroup A epidemics occurred in 1931 and 1940, followed by a decline in disease incidence until the late 1960s. In 1968, a serogroup A epidemic began in Lipezk, Russia, where factory workers had recently arrived from Vietnam. These immigrants had traveled by rail through China, where subgroup III disease was prevalent (8). The incidence rate of meningococcal disease in Moscow and the proportion of serogroup A isolates remained high until the 1980s. In 1996, a new outbreak of serogroup A disease began, again initially associated with the Vietnamese community. During the outbreak peak in early 1996, 50 (34%) of 147 patients with meningococcal disease were Vietnamese, and all their disease isolates were serogroup A. During the rest of 1996, only 8 (6%) of 145 patients with meningococcal disease belonged to the Vietnamese community. During 1997 to 1999, hundreds of thousands of Muscovites Muscovites may refer to:
  • The inhabitants of Moscow
  • A historical term for the Grand Duchy of Moscow
See also
  • Muscovy (disambiguation)
 were immunized with A polysaccharide vaccine. The incidence rate and the proportion of serogroup A isolates decreased and have remained stable through 1999.

[Graph omitted]

We present data on the molecular epidemiology molecular epidemiology Molecular medicine An evolving field that combines the tools of standard epidemiology–case studies, questionnaires and monitoring of exposure to external factors with the tools of molecular biology–eg, restriction endonucleases,  and genetic relationships of serogroup A meningococci isolated in Moscow from 1969 to 1997. The data show that four clonal groupings have been responsible for successive waves of disease and that epidemic disease in Moscow since 1994 is associated with a new subgroup III pandemic.

Materials and Methods

Serogroup A Isolates from Moscow

One hundred three strains of N. meningitidis were isolated in Moscow from the cerebrospinal fluid cerebrospinal fluid (CSF)

Clear, colourless liquid that surrounds the brain and spinal cord and fills the spaces in them. It helps support the brain, acts as a lubricant, maintains pressure in the skull, and cushions shocks.
 or blood of patients with systemic meningococcal disease or from throat swabs of their close contacts (seven subgroup VI strains, 1988-89). Strains were serogrouped by immune precipitation with specific sera and lyophilized ly·oph·i·lize  
tr.v. ly·oph·i·lized, ly·oph·i·liz·ing, ly·oph·i·liz·es
To freeze-dry (blood plasma or other biological substances).



[lyophil(ic) + -ize.
. The bacteria we describe represent almost all the viable serogroup A bacteria still available in the laboratory collections at the Central Research Institute of Epidemiology and the Gamaleya Institute of Epidemiology and Microbiology, with the following exceptions: Only one third of the bacteria available from 1969 to 1972 and half the bacteria from 1996 were tested to avoid bias toward these two periods. The lyophilized bacteria were purified again by single colony isolation. These bacterial cultures were then serogrouped, serotyped, and subtyped by using whole-cell enzyme-linked immunosorbent assay enzyme-linked immunosorbent assay
n.
ELISA.


Enzyme-linked immunosorbent assay (ELISA)
A diagnostic blood test used to screen patients for AIDS or other viruses.
 (ELISA ELISA (e-li´sah) Enzyme-Linked Immuno-Sorbent Assay; any enzyme immunoassay using an enzyme-labeled immunoreactant and an immunosorbent.

ELISA
n.
) with monoclonal antibodies This is a list of monoclonal antibodies, antibodies which are clones of a single parent cell. When used as medications, the generic names end in -mab (see "Nomenclature of monoclonal antibodies").  (8). DNA was prepared as described (21) and used for molecular fine typing and MLST.

MLST

Both strands of fragments of abcZ, adk, aroE, gdh, pdhC, pgm, and fumC were sequenced as described (http:// www.mlst.net), except that primers 01101 (5'TCCGGCTTGCCGTTTGTCAG) and 01102 (5'TTGTAGGCGGTTTTGGCGAC) were used for fumC. At the beginning of this project, the MLST database inadequately represented the diversity of serogroup A meningococci because it contained data for only 36 strains, predominantly from MLEE subgroups I, III, and IV-1 (6). To enlarge the database, MLST was performed with 66 serogroup A isolates from diverse sources that had previously been assigned to subgroups II through IX by MLEE (7,8) and in some cases by RAPD analysis (7). MLST was also performed with 42 serogroup A isolates from Moscow chosen from the most diverse branches of the RAPD tree. Other laboratories had deposited data for eight serogroup A strains in six novel STs, resulting in 152 serogroup A strains in 31 STs (Table 1). The results, including strain description, source, and MLEE assignments, are publicly available (http:/ /www.mlst.net).
Table 1. Multilocus sequence typing
analysis of serogroup A meningococci

ST(a)   MLEE/RAPD          Sources          No.   fumC

21      other       UK (1941)                 1      1
1       I, II       Pandemic (1963-80)       15      1
75      X           Moscow (1983-94)          3      1
78      X           Moscow (1997)             1      1
76      X           Moscow (1983-85)          4     17
77      X           Moscow (1984-85)          3      1
69      VI          Moscow (1970)             1     28
2       VI          Moscow, GDR (1980-95)    17      7
68      VI          Moscow (1994-96)          2      7
70      VI          Moscow (1984-86)          2      7
73      VI          Moscow (1995)             1      7
58      VI          GDR (1986)                1      7
71      VI          Moscow (1985)             1      7
72      VI          Moscow (1987)             1      7
57      II          USA (1930-43)             2      1
4       IV-I,IV-2   Pandemic (1917-90)       37      1
80                  Gambia (1983)             1     31
203                 Gambia (1996)             1      1
5       III,VIII    Pandemic (1963-98)       24      1
6       III         China (1966)              1      1
7       III         Pandemic (1992-96)        9      1
3       V,VII       China (1963-87)          11      1
59      V           China (1980)              1     22
103                 Greece (1996)             1     17
60      IX          Holland (1989-92)         4     17
61      IX          Holland (1992)            1     17
79      other       Moscow (1995)             1     26
299                 Czechoslovakia (1972)     1     26
300                 Czechoslovakia (1972)     1     26
388                 Czechoslovakia (1972)     2     35
400                 Czechoslovakia (1972)     1     43

ST(a)   abcZ   adk   aroE   gdh   pdhC   pgm

21         1     5      1     2     16    17
1          1     3      1     1      1     3
75         2     3     25     1      1     3
78         2     3     25     1      1    17
76         2     3      1     1      1     3
77         2     3      1     1      1     3
69         1     3      4     1      1     3
2          1     3      4     1      1     3
68         1     3      4    21      1    17
70         1     3      4    22     21     3
73         1     3      4     1     21     3
58         1     3     21     1      1     3
71         1     3     10     1      1     3
72         1     3      7     1      1     3
57         1     3      1     1      2     3
4          1     3      3     4      2     3
80         1     3     15     4      2     3
203        1     3      2     3      2     3
5          1     1      2     3      2     3
6          1     1      2     3      2    11
7          1     1      2     3      2    19
3          1     3      1     1     23    13
59         1    14      1     1     23    13
103        8     4      6     5     18     2
60        17     5     19     3     26     2
61        17    10     19     3     26     2
79        12     5      6     9     22     8
299        2    29     36    26     18    20
300        2    29      9    26     18    20
388       57     2      2     6     68    12
400       12    16      2     3     37     7

(a) ST = sequence type; GDR = German Democratic Republic
(East Germany); MLEE = multilocus enzyme electrophoresis;
RAPD = random amplification of polymorphic DNA.


Molecular Fine Typing of Subgroup III

Alleles of the four chromosomal opa genes were determined by restriction analysis of polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is  (PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
) products generated by using one primer in the upstream conserved flanking DNA and a second HV2-specific primer, as described (17). The complete opa genes were also sequenced from selected representative strains.

A fragment of iga was amplified from chromosomal DNA by using primers O103 and O115 and tested for a BfaI site that is present in iga1 but not in iga2 or iga3 (17). A different fragment of iga was amplified with primers O113 and O151 and tested for a DdeI site that is present in iga3 but not iga2 or iga1 (17). In addition, the entire iga gene was amplified with primers O103 and O152 and sequenced from one ST5 and one ST7 strain.

The IS1106A locus near opcA was amplified by using primers in conserved DNA flanking this locus (22). Two sizes of PCR products (4.8 and 3.5 kb) were obtained among the subgroup III strains. (One strain yielded a 12-kb product that was not investigated further.) An internal, polymorphic 307-bp stretch was sequenced from one product of each size and found to differ by 19 bp, including four restriction sites Restriction sites, or restriction recognition sites, are particular sequences of nucleotides that are recognized by restriction enzymes as sites to cut the DNA molecule. The sites are generally palindromic, (because restriction enzymes usually bind as homodimers) and a particular  for HaeIII, ClaI, and BclI. The allele in the 4.8-kb fragment was named IS1106A10, and the allele in the 3.5-kb fragment was named IS1106A7. PCR products from all the subgroup III strains were tested for the four distinctive restriction sites, but no additional diversity was identified. Details on alleles at this locus in subgroup III bacteria from sources other than Moscow have been described (23).

The 2.1-kb tbpB gene was amplified by using an internal primer located near the ATG ATG antithymocyte globulin.
lymphocyte immune globulin (antithymocyte globulin equine, ATG, ATG equine, LIG)

Atgam

Pharmacologic class: Immunoglobulin

Therapeutic class: Immunosuppressant
 start codon start codon
n.
Either of two codons, AUG or GUG, that signal the initiation of translation and the first amino acid in a polypeptide chain. Also called chain initiation codon.
 (3'-Met2) and a primer located in the intergenic region An Intergenic region is a stretch of DNA sequences located between clusters of genes that comprise a large percentage of the human genome but contain few or no genes. Occasionally some intergenic DNA acts to control genes close by, but most of it has no currently known function.  between tbpB and tbpA (5'-Inter1), as described (16). Different alleles of tbpB were recognized by digesting the 2.1-kb fragment with HaeIII, MspI, and SspI and by sequencing the entire fragment from two ST5 strains and one ST7 strain. The tbpB allele designations are congruent con·gru·ent  
adj.
1. Corresponding; congruous.

2. Mathematics
a. Coinciding exactly when superimposed: congruent triangles.

b.
 with those described for a 600-bp 5'-terminal region that has been examined from numerous other strains (16).

To distinguish between pgm3 and pgm19 (6), the pgm locus was PCR-amplified by using primers O781 (5'-CGGCGATGCCGACCGCTTGG) and 0782 (5'GGTGATGATTTCGGTTGCGCC). The PCR products were tested for an HinfI site that is absent in pgm3 and present in pgm19.

Results

Genetic Relationships of Serogroup A Strains from Moscow

One hundred three serogroup A N. meningitidis strains isolated in Moscow during 1969 to 1998 were investigated by RAPD analysis to elucidate their genetic relationships. The data (Figure 2) revealed three primary clusters of isolates, two of which (subgroups III and VI) were assigned to known clonal groupings by comparison with previous data (7). The third cluster (24 isolates) differs from previously defined subgroups and was therefore tentatively designated subgroup X. Two singleton strains were labeled IV (a strain formerly assigned to subgroup IV-2 by MLEE) and ST79.

[Illustration omitted]

Forty-two strains that represent the diversity revealed by RAPD were analyzed by MLST. These data were combined with data from other strains as described in Materials and Methods, resulting in a database containing 152 serogroup A isolates (Table 1, Figure 3). MLST did not distinguish several subgroups defined by MLEE (I and II, IV-1 and IV-2, III and VIII, V and VII). Otherwise, the subgroup structure in a neighbor-joining (NJ) tree of the fraction of alleles differing between STs (Figure 3) was largely concordant with prior subgroup assignments from MLEE (8) or RAPD (7). Only STs I and 57 clustered inappropriately in the NJ tree (Figure 3).

[Illustration omitted]

The MLST results confirmed the assignments of isolates from Moscow to subgroups III and VI. They also demonstrated that subgroup X is distinct from previously defined subgroups and is closely related to subgroups I and II. Individual STs of these three subgroups share identical alleles for up to six of the seven gene fragments sequenced (Table 1).

Inconsistent Fine Typing by RAPD and MLST

Subgroup III isolates from Moscow were isolated during more than one epidemic wave, raising the question whether these isolates shared a common source. However, the concordance concordance /con·cor·dance/ (-kord´ins) in genetics, the occurrence of a given trait in both members of a twin pair.concor´dant

con·cor·dance
n.
 between RAPD and MLST did not extend below the subgroup level. The two major RAPD branches in subgroup III initially seemed to correspond to MLST ST5 and ST7. These STs are identical except for their pgm alleles (ST5, pgm3; ST7, pgm19,) which differ by 19 (4%) of 450 bp, including a distinctive restriction site restriction site
n.
A site in a DNA segment in which the bordering bases are vulnerable to restriction enzymes. Also called cleavage site.
. Genotyping Genotyping refers to the process of determining the genotype of an individual with a biological assay. Current methods of doing this include PCR, DNA sequencing, and hybridization to DNA microarrays or beads.  of pgm from all subgroup III isolates by PCR-restriction fragment length polymorphism polymorphism, of minerals, property of crystallizing in two or more distinct forms. Calcium carbonate is dimorphous (two forms), crystallizing as calcite or aragonite. Titanium dioxide is trimorphous; its three forms are brookite, anatase (or octahedrite), and rutile.  (PCR-RFLP PCR-RFLP Polymerase Chain Reaction–Restriction Fragment Length Polymorphism ) showed that both major RAPD branches contained both pgm alleles (Figure 2). Therefore, additional powerful fine typing methods, such as multilocus PCR-RFLP, were needed to resolve whether all bacteria within a subgroup originated from the same sources.

Serologic se·rol·o·gy  
n. pl. se·rol·o·gies
1. The science that deals with the properties and reactions of serums, especially blood serum.

2.
 Properties

In some cases, serologic serotyping and serosubtyping can be used to enable rapid recognition of clonal groupings. The serologic properties of all the serogroup A bacteria from Moscow were determined by ELISA with monoclonal typing antibodies. The results confirmed previous results for subgroups III and VI (8) and showed that subgroup X is 4,21:P1.10 or 21:P1.10 (Table 2). Subgroup X is therefore not distinguishable by serologic testing from serogroup A subgroups I, II, IV-2 and VI, which are also 4,21:P1.10. The subgroup III strains uniformly expressed the class I and IIa pilin epitopes (8); however, the pilin epitopes of subgroups VI and X were not uniform: half of each group of strains expressed class I and IIa epitopes and the other half the class IIb epitope epitope: see immunity. . Thus, except for subgroup III, serologic typing would not be useful for distinguishing these various subgroups.
Table 2. Serologic properties of serogroup A meningococci from Moscow

Subgroup   Proportion (%)   Serotype   Serosubtype

III          34/38 (89)         21       P1.20,9
VI            6/39 (15)         21       P1.10
VI           12/39 (31)       4,21       P1.10
VI           17/39 (44)       4,21       P1.5,10
X            17/24 (71)       4,21       P1.10
X             6/24 (25)         21       P1.10


Successive Waves Caused by Different Clonal Groupings

The three subgroups were isolated in Moscow during four successive waves of disease caused, respectively, by ST5 of subgroup III (1969 to 1977, 17 of 19 isolates), subgroup X (1983 to 1985; 21 of 27), subgroup VI (1986 to 1995; 32 of 36) and ST7 of subgroup III (1996-97; 19 of 21) (Table 3). The isolation of subgroup III bacteria correlated with epidemic peaks of disease in 1970 and 1996 (Figure 1); in both cases, subgroup III bacteria were also isolated in Moscow i to 2 years before the peak epidemic year (Table 3). In contrast, the isolation of subgroup X or subgroup VI did not correlate with an increase in the incidence rate for serogroup A disease. The slight increase in disease incidence in the mid-1980s was associated with serogroup B meningococci.
Table 3. Years of isolation of individual subgroups
of serogroup A Neisseria meningitidis in Moscow

                         Number of strains

Year    III (ST5(a))   X    VI   III (ST7)   other   Total

1969         1                                          1
1970         9               1                         10
1971         4                                 1        5
1973         1                                          1
1977         2                                          2
1983                    4                               4
1984                   14    3                         17
1985                    3    3                          6
1986                         3                          3
1987                         3                          3
1988                         8                          8
1991                         8                          8
1993                         2                          2
1994                    1    4       1                  6
1995                         4       1         1        6
1996                         1      17                 18
1997                    1            2                  3
Total        17        23   40      21         2      103

(a) ST = sequence type

Subgroup assignments are according to data from random amplification
of polymorphic DNA (Figure 2). For strains of subgroup III where a
complete multilocus sequence typing analysis was not performed,
bacteria were assigned to ST5 and ST7 on the basis of results with
pgm polymerase chain reaction/restriction analysis. Other: 1971,
subgroup IV-2; 1995, ST79.


Molecular Fine Typing of Subgroup III Isolates

Both pre-Mecca and post-Mecca isolates are ST5, while the subgroup III meningococci isolated in Moscow since the mid-1990s are ST7. PCR-RFLP of the opaB, opaD and iga loci distinguished pre-Mecca from post-Mecca bacteria (17) but did not allow unambiguous assignment of the isolates from Moscow to either of these two waves. To resolve the fine structure of subgroup III, we identified three additional distinctive molecular markers, tbpB, IS1106A, and pgm, which were tested by PCR-RFLP plus sequencing for numerous subgroup III isolates from other countries (23). PCR-RFLP of these six variable loci subdivides subgroup III bacteria into nine so-called genoclouds, each containing a spectrum of related genotypes, and shows that a third wave of pandemic disease caused by genocloud 8 began in eastern Asia in the early 1990s. Genocloud 8 bacteria differ from other subgroup III meningococci in having the tbpB55, pgm19, and IS1106A7 alleles (Table 4). All 21 subgroup III bacteria isolated in Moscow from 1994 to 1997 also have these alleles (Table 4) and thus represent an extension of the third pandemic
For more general information see Bubonic plague.


Third Pandemic is the designation of a major plague pandemic that began in the Yunan province in China in 1855.
 wave.
Table 4. Hypervariable alleles among subgroup
III meningococci isolated in Moscow

                                    Locus

Strains              No.   tbpB   iga   pgm   IS1106

(a)genocloud 1               1     2     3    A10
genocloud 3                  1     2     3    A4
genocloud 5                  1     3     3    A4
genocloud 8                 55     2    19    A7
Moscow genocloud 2
  1969-1973          14     38     2     3    A10
  1970                1     38     2     3    A10
  1977                1     38     2     3    A10
  1977                1     38     2     3    nd(b)
Moscow genocloud 8
  1994-1997          21     55     2    19    A7

                               Locus

Strains              opaA   opaB   opaD   opaJ

(a)genocloud 1       132     99    131    101
genocloud 3          132     92    131    101
genocloud 5          132     94    100    101
genocloud 8          132     92    131    101
Moscow genocloud 2
  1969-1973          132    140    131    101
  1970               132    113    131    101
  1977               132    140    110    101
  1977               132    140    109    101
Moscow genocloud 8
  1994-1997          132     92    131    101

(a) Data for the genoclouds at the top of the table are from a
separate manuscript (23). Sources of genoclouds: 1, China, 1966; 3,
pre-Mecca isolates (1969-1984) from Europe, Brazil and China 5,
post-Mecca isolates (1987-1998) from Africa and pilgrims returning
from Mecca in 1987 to various countries; and 8, China, Mongolia,
and Africa, 1993-2000. All serogroup A isolates from Moscow that were
assigned to subgroup III by random amplification of polymorphic DNA
are included in this table. The opaA and opaJ alleles have not been
tested in all bacteria from the various genoclouds because they are
otherwise so uniform.

(b) nd = not determined because this strain yields an unusual 12-kb
polymerase chain reaction product for the IS1106A region.


The subgroup III ST5 meningococci isolated in Moscow from 1969 to 1977 are distinct from all other subgroup III meningococci and define genocloud 2 (Table 4). The most closely related genocloud is genocloud 1, isolated in China in the mid-1960s, which contains the same IS1106A10 element but differs at tbpB and opaB. The genocloud 3 bacteria that caused outbreaks in northern Europe concurrently with the epidemic in Moscow differed in IS1106A (IS1106A4) as well as tbpB and opaB. Other subgroup III genoclouds, including genocloud 5 (post-Mecca), differed at even more loci (Table 4).

Phylogenetic phy·lo·ge·net·ic
adj.
1. Of or relating to phylogeny or phylogenetics.

2. Relating to or based on evolutionary development or history.
 Ancestry of Genocloud 2

The unique tbpB allele in ST5 subgroup III bacteria from Moscow is not informative for phylogenetic descent: It was not found in any other genocloud and was probably imported by DNA transformation (16) shortly before or after these bacteria arrived in Moscow. However, the phylogenetic history of the unique opaB alleles in the subgroup III bacteria from Moscow can be reconstructed from their sequences. Genocloud I bacteria from China have the opa132, opa92, opa131, and opal01 alleles at the opaA, B, D, and J loci, respectively. The novel alleles at the opaB and opaD loci in genocloud 2 bacteria from Moscow probably represent gene conversion with the opaJ101 and opaA132 alleles (Figure 4). The opaB140 allele, which was present in all but one strain from Moscow (Table 4), differs from opaJ101 by only one nucleotide (Figure 4). The opaB113 allele (one strain) can be explained by gene conversion of opaB140 with DNA from the opaA132 allele, opaD131 is present in genocloud 1 and was also found in all but two genocloud 2 strains from Moscow. The two exceptional strains contain the opaD109 and opaD110 alleles, which could easily have arisen by gene conversion of part of the opaD131 locus with DNA from the opaJ101 locus.

[Illustration omitted]

Discussion

Since the 1920s, serogroup A meningococci have been responsible for a large proportion of the bacterial meningitis bacterial meningitis Acute bacterial meningitis Neurology Meningeal inflammation caused by bacteria which, if untreated, is often fatal, or associated with significant sequelae Epidemiology 60% are community-acquired–CM, 40% nosocomial–NM Predisposing  in Moscow (Figure 1). Serogroup A meningococci isolated in Moscow from 1969 to 1997 (103 isolates) were analyzed by RAPD. Strains representing the diversity revealed by the RAPD data were analyzed by MLST (44 isolates), and all 38 subgroup III strains were subjected to molecular fine typing by multilocus PCR-RFLP. The results illustrate the limitations of these methods and yield important information about the phylogenetic relationships among serogroup A meningococci. They also demonstrate that serogroup A meningococcal disease in Moscow since 1969 has been caused by four successive, independent waves of bacterial colonization, most recently by the spread of a third subgroup III pandemic wave from East Asia East Asia

A region of Asia coextensive with the Far East.



East Asian adj. & n.
.

Typing Methods

RAPD analysis was used to provide a quick overview of the genetic diversity in the 103 strains investigated (Figure 2). This information was used to select a smaller group of bacteria to be tested by more expensive and labor-intensive methods such as MLST. As in previous comparisons between RAPD and MLEE (7), the subgroup assignments were concordant between MLST and RAPD. The RAPD data allowed the initial recognition of a new subgroup, subgroup X, and the MLST data confirmed that subgroup IX is not genetically related to the epidemic serogroup A subgroups as originally demonstrated by RAPD data (7). Thus, RAPD analysis can be a highly reliable, quick method for recognizing genetically related bacterial groups.

Finer subdivisions in subgroups III and X, suggested by the RAPD data, were contradicted by MLST results. ST76 was distributed among both primary RAPD subdivisions of the subgroup X cluster, and the two primary RAPD subdivisions of the subgroup III cluster did not correlate with presence of pgm3 versus pgm19 (Figure 2) or with epidemiologic data. Such random noise will probably be most extreme for bacteria such as N. meningitidis, which frequently import DNA from unrelated neisseriae (15). Thus, putative subdivisions within phylogenetically phy·lo·ge·net·ic  
adj.
1. Of or relating to phylogeny or phylogenetics.

2. Relating to or based on evolutionary development or history: a phylogenetic classification of species.
 related groups suggested by RAPD data should be confirmed by independent methods.

MLST is based on sequences of conserved housekeeping genes and sequence variants are rarer than with most other methods used in molecular epidemiology, thus facilitating global, long-term epidemiology (6). For subgroup III, the distinction between STs 5 and 7 based on pgm is a very useful molecular marker for recognizing bacteria from the third pandemic wave. However, the epidemiologic data do not suggest that other STs are useful markers for genetic variants that have spread extensively, and MLST does not necessarily provide the discrimination desired for fine typing.

Unfortunately, the fine structure of bacteria that frequently import foreign DNA is very difficult to resolve, and we know of no method that is eminently suitable for this task. Our data argue against the use of RAPD and MLST. Although pulsed-field gel electrophoresis gel electrophoresis
n.
Electrophoresis performed in a gel composed of agarose, polyacrylamide, or starch.
 is highly suitable for differentiating almost identical bacteria in limited numbers of strains (17,24,25), it is poorly suited for elucidating the relationships among large numbers of less strongly related bacteria. Fine typing was therefore attempted based on multilocus RFLP RFLP
abbr.
restriction fragment length polymorphism



RFLP

restriction fragment length polymorphism.

RFLP 
 of PCR fragments of pgm plus the variable genes opa, iga, and tbpB and the IS/106A element. Multilocus PCR-RFLP of variable genes allowed molecular fine typing within subgroup III meningococci, but the data are also limited by considerable random noise, resulting in genoclouds of related variants (23). Alternative strategies involving IS elements (26), amplified fragment-length polymorphism (27), or variable nucleotide repeat sequences (28) have been used successfully for fine typing of highly uniform microorganisms. Such methods have not yet been extensively tested with N. meningitidis but seem likely to be limited by at least as much random noise as the methods we used. Thus, reliable fine typing remains difficult to achieve.

Phylogeny of Serogroup A Meningococci

The MLST data on 152 serogroup A strains allow inferences about the evolution of these bacteria. The STs in subgroups I through VIII and X (the epidemic subgroups) probably stem from a common ancestor. They form a monophyletic monophyletic /mono·phy·let·ic/ (mon?o-fi-let´ik) descended from a common ancestor or stem cell.

mon·o·phy·let·ic
adj.
1. Descended or derived from one original stock or source.
 clade clade Cladus, subtype Genetics A branch of biological taxa or species that share features inherited from a common ancestor; a single phylogenetic group or line. See Inheritance, Species.  in phylogenetic trees (Figure 3), and many of these STs share the fumC1, abcZ1, adk3, gdh1, pdhC1, and pgm3 alleles (Table 1). The epidemic subgroups include meningococci isolated since the beginning of this century (ST4, subgroup IV-2, 1917; ST57, subgroup II, 1930) (8) and must have evolved before then.

Older isolates of subgroups III (1960s), IV-1 (1960s), and IV-2 (1917) had identical or nearly identical opa, iga, and tbpB alleles (16,17), whereas more recent isolates have imported novel alleles at these loci. These data indicate that the common ancestor of these three subgroups existed approximately 100 years ago (17).

The branch lengths (Figure 3) and common alleles indicate that the epidemic subgroups are probably not much older than the split between subgroups III, IV-l, and IV-2. The epidemic serogroup A subgroups may therefore have descended from a common ancestor that existed within the last few hundred years. Epidemic meningitis Noun 1. epidemic meningitis - meningitis caused by bacteria and often fatal
brain fever, cerebrospinal fever, cerebrospinal meningitis

meningitis - infectious disease characterized by inflammation of the meninges (the tissues that surround the brain or
 was first observed in Geneva Geneva, canton and city, Switzerland
Geneva (jənē`və), Fr. Genève, canton (1990 pop. 373,019), 109 sq mi (282 sq km), SW Switzerland, surrounding the southwest tip of the Lake of Geneva.
 in 1805 (29), and that epidemic may have marked the evolution of serogroup A after the import of the sacA-D genes encoding the A polysaccharide. Horizontal exchange between serogroups B and C of genes encoding capsular polysaccharides has been documented (30), and more than one capsular polysaccharide serogroup is present in several of the otherwise uniform STs in the complete MLST database. Furthermore, the sacA-D genes are characterized by an unusually low GC content (31), as if these genes were recently imported from an unrelated species. If this speculation is correct, the other serogroup A bacteria (Figure 3, bottom) may represent unrelated N. meningitidis that have imported sacA-D genes from the epidemic subgroups. Alternatively, the sacA-D genes may have been imported from an unrelated species more than once, or the epidemic subgroups may have imported the sacA-D from one of the nonepidemic STs (Figure 3, bottom). Analysis of the sequence diversity of the sacA-D genes in various STs might resolve these alternative explanations.

Molecular Epidemiology

Evaluation of the long-term molecular epidemiology of bacterial pathogens within a global context is complex, requiring large, representative strain collections and reliable, preferably phylogenetically based, typing schemes. Our results illustrate both strengths and weaknesses in our knowledge of serogroup A epidemiology.

The assignment of genocloud 8 bacteria isolated in the mid-1990s in Moscow to the third subgroup III pandemic wave is straightforward and indisputable. It rests on three unusual markers (pgm19, tbpB55, and IS1106A7), and no differences in these three markers were detected among recent subgroup III isolates from China, Mongolia, Africa, and Russia. The initial association of genocloud 8 disease in Moscow with the Vietnamese community remains unexplained.

The genocloud 2 subgroup III bacteria from the early 1970s differ at the opaB and tbpB loci from all known subgroup III meningococci. We argue that genocloud 2 is probably derived from genocloud 1 in China because of the shared IS1106A10 allele, which was not found in any other subgroup III bacteria. In support of this interpretation based on molecular data, this epidemic first broke out among Vietnamese immigrants who had traveled through China en route to Russia. However, few subgroup III strains exist that were isolated before 1969, and our knowledge about the diversity and patterns of serogroup A disease before 1969 is only fragmentary.

Subgroup VI bacteria of serogroups A, B, and C were occasionally isolated from endemic disease in East Germany in the 1980s (8). Our data show that most of the serogroup A meningococci isolated during 1986 to 1994 in Moscow were also subgroup VI, and these bacteria may have been widely distributed Adj. 1. widely distributed - growing or occurring in many parts of the world; "a cosmopolitan herb"; "cosmopolitan in distribution"
cosmopolitan

bionomics, environmental science, ecology - the branch of biology concerned with the relations between organisms
 in eastern Europe in the 1980s. In contrast, subgroup X, common in Moscow during 1983 to 1985, has not been described previously. Various STs (Figure 3, bottom) have also been isolated only from single countries (subgroup IX in the Netherlands during 1989 to 1993 [7]; STs 299, 300, 388, and 400 in Czechoslovakia in 1972 [K. Jolley and P. Kriz, pets. comm.]; ST79 in Moscow in 1995; and ST103 in Greece in 1996 [R. Urwin, pers. comm.]). These bacteria have apparently not spread extensively, unlike the epidemic subgroups. In this respect, they resemble most endemic serogroup B meningococci, such as those identified by MLEE among endemic disease isolates from the Netherlands (32) and carrier isolates from Norway (33). Additional serogroup A STs specific to certain countries or regions probably remain to be identified. Current meningococcal strain collections containing a few thousand isolates are probably one or two orders of magnitude too small to yield reliable epidemiologic data for unusual STs that have not caused larger disease outbreaks.

Subgroup III has caused large disease outbreaks, and its molecular epidemiology has been extensively investigated (11,17,23). As a result, the available information on genetic changes during pandemic spread of these bacteria is among the most extensive for any bacterial pathogen Pathogen

Any agent capable of causing disease. The term pathogen is usually restricted to living agents, which include viruses, rickettsia, bacteria, fungi, yeasts, protozoa, helminths, and certain insect larval stages.
. Our data show that the extensive pandemic spread of these bacteria is likely to continue. Although Moscow and western Europe differ somewhat in epidemiologic patterns, the recent extension of this third pandemic wave to Moscow warns us that we should be prepared for new, large serogroup A outbreaks in countries in both eastern and western Europe.

Acknowledgments

We gratefully acknowledge information on sources of strains in the MLST database and permission to cite these data from Keith Jolley and Rachel Urwin.

This work was partly supported by grants Ac 36/9-2 from the Deutsche Forschungsgemeinschaft The Deutsche Forschungsgemeinschaft (abbreviated DFG, German Research Foundation in English) is an important German research funding organization. The DFG supports research in science and the humanities through a large variety of grant programmes, prizes and by  and INTAS INTAS International Association for Cooperation with Scientists from the former Soviet Union
IntAS International Animation Sodality
.

Dr. Achtman is a scientific group leader at the Max-Planck Institut fur Infektionsbiologie, Berlin. His group investigates the population structures of bacterial pathogens, including N. meningitidis, Helicobacter pylori Helicobacter pylori
A gramnegative rod-shaped bacterium that lives in the tissues of the stomach and causes inflammation of the stomach lining.

Mentioned in: Indigestion, Ulcers

Helicobacter pylori
, and Yersinia pestis Yersinia pes·tis
n.
A bacterium that causes plague and is transmitted from rats to humans by the rat flea Xenopsylla cheopis. Also called Pasteurella pestis.
. These analyses integrate results from epidemiologic studies of global disease patterns.

References

(1.) Peltola H. Meningococcal disease: still with us. Rev Infect Dis 1983;5:71-91.

(2.) Crowe BA, Wall RA, Kusecek B, Neumann B, Olyhoek T, Abdillahi H, et al. Clonal and variable properties of Neisseria meningitidis isolated from cases and carriers during and after an epidemic in the Gambia, West Africa West Africa

A region of western Africa between the Sahara Desert and the Gulf of Guinea. It was largely controlled by colonial powers until the 20th century.



West African adj. & n.
. J Infect Dis 1989;159:686-700.

(3.) Achtman M. Molecular epidemiology of epidemic bacterial meningitis. Rev Med Microbiol 1990;1:29-38.

(4.) Achtman M. Global epidemiology of meningococcal disease. In: Cartwright K, editor. Meningococcal disease. Chichester, England: John Wiley John Wiley may refer to:
  • John Wiley & Sons, publishing company
  • John C. Wiley, American ambassador
  • John D. Wiley, Chancellor of the University of Wisconsin-Madison
  • John M. Wiley (1846–1912), U.S.
 & Sons, Ltd; 1995:159-75.

(5.) Tikhomirov E, Santamaria M, Esteves K. Meningococcal disease: public health burden and control. World Health Statistical Quarterly 1997;50:170-6.

(6.) Maiden MCJ MCJ Malattia Di Creutzfeldt-Jakob (Italian: Creutzfeldt-Jakob Disease)
MCJ Mississippi Center for Justice
MCJ Master Criminal Justice
MCJ Microcrystalline Cellulose, Jet Milled
MCJ Master of Laws in Comparative Jurisprudence Degree
, Bygraves JA, Feil E, Morelli G, Russell JE, Urwin R, et al. Multilocus sequence typing: a portable approach to the identification of clones within populations of pathogenic microorganisms. Proc Natl Acad Sci U S A 1998;95:3140-5.

(7.) Bart A, Schuurman IGA, Achtman M, Caugant DA, Dankert J, van der Ende A. Random amplified polymorphic DNA (RAPD) genotyping of serogroup A meningococci yields similar results to multilocus enzyme electrophoresis (MEE MEE Middle Ear Effusion
MEE Multistate Essay Exam (National Conference of Bar Examiners)
MEE Migration-Enhanced Epitaxy
MEE Master of Electrical Engineering
MEE Mise En Etat (French) 
) and reveals new genotypes. J Clin Microbiol 1998;36:1746-9.

(8.) Wang J-F, Caugant DA, Li X, Hu X, Poolman JT, Crowe BA, et al. Clonal and antigenic analysis of serogroup A Neisseria meningitidis with particular reference to epidemiological features of epidemic meningitis in China. Infect Immun 1992;60:5267-82.

(9.) Hjetland R, Caugant DA, Hofstad T, Froholm LO, Selander RK. Serogroup A Neisseria meningitidis of clone III-1 in western Norway, 1969-73. Scand J Infect Dis 1990;22:241-2.

(10.) Makela PH, Peltola H, Kayhty H, Jousimies H, Pettay O, Ruoslahti E, et al. Polysaccharide vaccines to group A Neisseria meningitidis and Haemophilus influenzae type b Haemophilus influenzae type b
n. Abbr. Hib
A gram-negative, rod-shaped bacterium of the genus Haemophilus that is found in the human respiratory tract and causes acute respiratory infections, such as pneumonia, and other diseases,
: a field trial in Finland. J Infect Dis 1977;136:43-50.

(11.) Achtman M, Kusecek B, Morelli G, Eickmann K, Wang J, Crowe B, et al. A comparison of the variable antigens expressed by clone IV-1 and subgroup III of Neisseria meningitidis serogroup A. J Infect Dis 1992;165:53-68.

(12.) Moore PS, Reeves MW, Schwartz B, Gellin BG, Broome CV. Intercontinental spread of an epidemic group A Neisseria meningitidis strain. Lancet 1989;ii:260-3.

(13.) Jones DM, Sutcliffe EM. Group A meningococcal disease in England associated with the Haj. J Infect 1990;21:21-5.

(14.) Riou JY, Caugant DA, Selander RK, Poolman JT, Guibourdenche M, Collatz E. Characterization of Neisseria meningitidis serogroup A strains from an outbreak in France by serotype serotype /se·ro·type/ (ser´o-tip) the type of a microorganism determined by its constituent antigens; a taxonomic subdivision based thereon.

se·ro·type
n.
See serovar.

v.
, serosubtype, multilocus enzyme genotype genotype (jēn`ətīp'): see genetics.
genotype

Genetic makeup of an organism. The genotype determines the hereditary potentials and limitations of an individual.
 and outer membrane The outer membrane refers to the outside membranes of Gram-negative bacteria, the chloroplast, or the mitochondria. It is used to maintain the shape of the organelle contained within its structure, and it acts as a barrier against certain dangers.  protein pattern. Eur J Clin Microbiol Infect Dis 1991;10:405-9.

(15.) Maiden MCJ, Malorny B, Achtman M. A global gene pool in the neisseriae. Mol Microbiol 1996;21:1297-8.

(16.) Linz B, Schenker M, Zhu P, Achtman M. Frequent interspecific in·ter·spe·cif·ic  
adj.
Arising or occurring between species.



interspecific also interspecies  

Arising or occurring between species.

Adj. 1.
 genetic exchange between commensal commensal /com·men·sal/ (kom-men´sil)
1. living on or within another organism, and deriving benefit without harming or benefiting the host.

2. a parasite that causes no harm to the host.
 neisseriae and Neisseria meningitidis. Mol Microbiol 2000;36:1049-58.

(17.) Morelli G, Malorny B, Muller K, Seiler A, Wang J, del Valle J, et al. Clonal descent and microevolution mi·cro·ev·o·lu·tion
n.
Evolution resulting from a succession of relatively small genetic variations that often cause the formation of new subspecies.
 of Neisseria meningitidis during 30 years of epidemic spread. Mol Microbiol 1997;25:1047-64.

(18.) Bolshakov KN. Epidemiological and geographical aspects of meningococcal infection [dissertation]. Moscow: Moscow Univ.; 1973.

(19.) Kostyukova NN, Mironova TK, Leschinskaya EV. Microbiological characteristics of meningococcus meningococcus

Neisseria meningitidis, the bacterium that causes meningococcal meningitis in humans, the only natural hosts in which it causes disease. Meningococci are spherical, frequently occur in pairs, and are strongly gram-negative (see gram stain).
 infection in Moscow during a periodic rise in morbidity (1968-1971). Zh Mikrobiol Epidemiol Immunobiol 1974;5:29-32.

(20.) Demina AA, Martinov JV. An analysis of the epidemic cycle of meningococcal infection in Russia (1969-1993). Zh Mikrobiol Epidemiol Immunobiol 1996;4:57-61.

(21.) Sarkari J, Pandit pan·dit   or pun·dit
n.
1. A Brahman scholar or learned man.

2. Used as a title of respect for a learned man in India.



[Hindi pa
 N, Moxon ER, Achtman M. Variable expression of the Opc outer membrane protein in Neisseria meningitidis is caused by size variation of a promoter containing poly-cytidine. Mol Microbiol 1994;13:207-17.

(22.) Zhu P, Morelli G, Achtman M. The opcA and opcB regions in Neisseria: genes, pseudogenes, deletions, insertion elements and DNA islands. Mol Microbiol 1999;33:635-50.

(23.) Zhu P, van der Ende A, Falush D, Brieske N, Morelli G, Linz B, et al. Fit genotypes and escape variants of subgroup III Neisseria meningitidis during three pandemics of epidemic meningitis. Proc Natl Acad Sci U S A. In press 2001.

(24.) Kwara A, Adegbola RA, Corrah PT, Weber M, Achtman M, Morelli G, et al. Meningitis caused by a serogroup W135 clone of the ET-37 complex of Neisseria meningitidis in West Africa. Trop Med Int Health 1998;3:742-6.

(25.) Vogel U, Morelli G, Zurth K, Claus H, Kriener E, Achtman M, et al. Necessity of molecular techniques to distinguish between Neisseria meningitidis isolated from meningococcal disease and from their healthy contacts. J Clin Microbiol 1998;36:2465-70.

(26.) Van Embden JDA JDA Japan Defense Agency
JDA Joint Development Agreement
JDA Janne da Arc (band)
JDA Joint Duty Assignment
JDA Jerusalem Development Authority
JDA Jovian Detention Authority (gaming) 
, Cave MD, Crawford JT, Dale JW, Eisenach KD, Gicquel B, et al. Strain identification of Mycobacterium tuberculosis Mycobacterium tuberculosis
n.
Tubercic bacillus.


Mycobacterium tuberculosis
 by DNA fingerprinting DNA fingerprinting or DNA profiling, any of several similar techniques for analyzing and comparing DNA from separate sources, used especially in law enforcement to identify suspects from hair, blood, semen, or other biological materials found at : recommendation for a standardized methodology. J Clin Microbiol 1993;31:406-9.

(27.) Keim P, Kalif A, Schupp J, Hill K, Travis SE, Richmond K, et al. Molecular evolution and diversity in Bacillus anthracis Bacillus anthracis Infectious disease A gram-positive organism which causes often fatal infections when its endospores–resistant to heat, drying, UV light, gamma radiation, and many disinfectants–enter the body and cause septicemia Military medicine  as detected by amplified fragment length polymorphism Amplified fragment length polymorphism PCR, or "AFLP-PCR" (often AFLP), is a tool used in the study of genetics and in the practice of genetic engineering.

Amplified Fragment Length Polymorphism (AFLP
 markers. J Bacteriol 1997;179:818-24.

(28.) Keim P, Klevytska AM, Price LB, Schupp JM, Zinser G, Smith KL, et al. Molecular diversity in Bacillus anthracis. J Appl Microbiol 1999;87:215-7.

(29.) Vieusseux M. Memoire sur le maladie qui a regne a Geneve au printemps de 1805. J Med Chirurg Pharm 1806;11:163-82.

(30.) Swartley JS, Marfin AA, Edupuganti S, Liu LJ, Cieslak P, Perkins B, et al. Capsule switching of Neisseria meningitidis. Proc Natl Acad Sci U S A 1997;94:271-6.

(31.) Parkhill J, Achtman M, James KD, Bentley SD, Churcher C, Klee SR, et al. Complete DNA sequence DNA sequence Genetics The precise order of bases–A,T,G,C–in a segment of DNA, gene, chromosome, or an entire genome. See Base pair, Base sequence analysis, Chromosome, Gene, Genome.  of a serogroup A strain of Neisseria meningitidis Z2491. Nature 2000;404:502-6.

(32.) Scholten RJPM, Bijlmer HA, Poolman JT, Kuipers B, Caugant DA, van Alphen L, et al. Meningococcal disease in the Netherlands, 1958-1990: a steady increase in the incidence since 1982 partially caused by new serotypes and subtypes of Neisseria meningitidis. J Infect Dis 1993;16:237-46.

(33.) Caugant DA, Hoiby EA, Magnus P, Scheel O, Hoel T, Bjune G, et al. Asymptomatic carriage of Neisseria meningitidis in a randomly sampled population. J Clin Microbiol 1994;32:323-30.

Mark Achtman,(*) Arie van der Ende,([dagger]) Peixuan Zhu,(*) Irina S. Koroleva,([double dagger double dagger
n.
A reference mark () used in printing and writing. Also called diesis.

Noun 1.
]) Barica Kusecek,(*) Giovanna Morelli,(*) Ilse G.A. Schuurman,([dagger]) Norbert Brieske,(*) Kerstin Zurth,(*) Natalya N. Kostyukova,([sections]) and Alexander E. Platonov([double dagger])

(*) Max-Planck Institut fur Molekulare Genetik, Berlin, Germany; ([dagger]) Academic Medical Center, Amsterdam, the Netherlands; ([double dagger]) Central Research Institute of Epidemiology, Moscow, Russia; and ([sections]) N.F. Gamaleya Institute of Epidemiology and Microbiology, Moscow, Russia

Address for correspondence: Mark Achtman, Max-Planck Institut fur Infektionsbiologie, Schumannstr. 21/22, 10117 Berlin, Germany; fax: +49 30 28460 750; e-mail: achtman@mpiib-berlin.mpg.de
COPYRIGHT 2001 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2001, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Author:Platonov, Alexander E.
Publication:Emerging Infectious Diseases
Geographic Code:4EXRU
Date:May 1, 2001
Words:6569
Previous Article:Goat-Associated Q Fever: A New Disease in Newfoundland.
Next Article:Melioidosis: An Emerging Infection in Taiwan?
Topics:



Related Articles
Neisseria meningitidis Serogroup W135 Isolates Associated with the ET-37 Complex.(Letter to the Editor)
Fulminant Meningococcal Supraglottitis: An Emerging Infectious Syndrome?
Clonal expansion of sequence type (ST-)5 and emergence of ST-7 in Serogroup A Meningococci, Africa. (Research).(Statistical Data Included)
Cluster of serogroup C meningococcal disease associated with attendance at a party.
Recent increase in meningitis caused by Neisseria meningitidis serogroups A and W135, Yaounde, Cameroon. (Dispatches).
Persistence of W135 Neisseria meningitidis carriage in returning Hajj pilgrims: risk for early and late transmission to household contacts....
Absence of Neisseria meningitidis W-135 electrophoretic type 37 during the Hajj, 2002. (Dispatches).
Neisseria meningitidis W135, Turkey.(Dispatches)
Disease susceptibility to ST11 complex meningococci bearing serogroup C or W135 polysaccharide capsules, North America (1).(Research)(serotypes)
Carriage of Neisseria meningitidis Serogroup W135 ST-2881.

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles