Printer Friendly
The Free Library
14,504,020 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Methicillin-resistant Staphylococcus aureus in horses and horse personnel, 2000-2002.


Methicillin-resistant Staphylococcus aureus methicillin-resistant Staphylococcus aureus Methicillin-aminoglycoside resistant Staphylococcus aureus, MRSA An organism with multiple antibiotic resistances–eg, aminoglycosides, chloramphenicol, clindamycin, erythromycin, rifampin, tetracycline,  (MRSA MRSA Methicillin-resistant Staphylococcus aureus. See MARSA. ) infection was identified in 2 horses treated at a veterinary hospital in 2000, prompting a study of colonization rates of horses and associated persons. Seventy-nine horses and 27 persons colonized Colonized
This occurs when a microorganism is found on or in a person without causing a disease.

Mentioned in: Isolation
 or infected with MRSA were identified from October 2000 to November 2002; most isolations occurred in a 3-month period in 2002. Twenty-seven (34%) of the equine isolates were from the veterinary hospital, while 41 (51%) were from 1 thoroughbred farm in Ontario. Seventeen (63%) of 27 human isolates were from the veterinary hospital, and 8 (30%) were from the thoroughbred farm. Thirteen (16%) horses and 1 (4%) person were clinically infected. Ninety-six percent of equine and 93% of human isolates were subtypes of Canadian epidemic MRSA-5, spa type 7 and possessed SCCmeclV. All tested isolates from clinical infections were negative for the Panton-Valentine leukocidin Panton-Valentine leukocidin

a nonhemolytic toxin produced by Staphylococcus aureus which kills segmented neutrophils and macrophages.
 genes. Equine MRSA infection may be an important emerging zoonotic Zoonotic
A disease which can be spread from animals to humans.

Mentioned in: Zoonosis
 and veterinary disease.

**********

Methicillin methicillin /meth·i·cil·lin/ (meth?i-sil´in) a semisynthetic penicillin highly resistant to inactivation by penicillinase; used as the sodium salt.

meth·i·cil·lin
n.
 was first introduced in human medicine in the 1950s for the treatment of penicillin-resistant staphylococci staph·y·lo·coc·cus  
n. pl. staph·y·lo·coc·ci
A spherical gram-positive parasitic bacterium of the genus Staphylococcus, usually occurring in grapelike clusters and causing boils, septicemia, and other infections.
, and within a few years, methicillin-resistant isolates of Staphylococcus aureus Staphylococcus au·re·us
n.
A bacterium that causes furunculosis, pyemia, osteomyelitis, suppuration of wounds, and food poisoning.


Staphylococcus aureus Staphylococcus pyogenes
 (MRSA) were identified (1). Since then, MRSA has emerged as an important problem in human medicine internationally, especially in the hospital setting (24). Methicillin resistance is mediated by production of an altered penicillin-binding protein (PBP2a), which confers resistance to all [beta]-lactam anti-microbial agents. The gene that encodes this altered PBP PBP picture by picture (TVs and monitors)
PBP Penicillin Binding Protein
PBP Play-By-Play
PBP Paris-Brest-Paris (bicycle race)
PBP Progressive Bulbar Palsy
PBP Pay Back Period
PBP Pay By Phone
, mecA, resides on a large, mobile genetic element called the staphylococcal staphylococcal

pertaining to Staphylococcus spp.


staphylococcal clumping test
used as a means of measuring the quantity of fibrinogen-split products in a sample of blood.
 chromosomal cassette mec (SCCmec). Three types of SCC SCC - strongly connected component  (types I, II, and III) were originally described in hospital-acquired MRSA strains, most of them isolated before 1990. A fourth type (type IV) was recently described, initially in community-acquired MRSA isolates (2-4). Although MRSA have been typically hospital acquired (5,6), reports of community-acquired MRSA in persons have increased (7-9). In Canada, 6 epidemic clones, designated CMRSA (Canadian epidemic MRSA) 1 through 6 based on pulsed-field gel electrophoresis (PFGE PFGE Pulsed-Field Gel Electrophoresis ), are recognized (10,11). In addition to PFGE, SCCmec typing and DNA sequencing of the X region of the protein A gene (spa typing) can be used to further differentiate strains for epidemiologic analysis (12).

The role of MRSA in veterinary medicine veterinary medicine, diagnosis and treatment of diseases of animals. An early interest in animal diseases is found in ancient Greek writings on medicine. Veterinary medicine began to achieve the stature of a science with the organization of the first school in the  has not been well characterized. Isolation of MRSA has been reported in horses, cattle, and dogs (13-20). In addition, MRSA infection in 2 horses treated at the Ontario Veterinary College The Ontario Veterinary College (OVC), in Canada, is Canada's oldest veterinary school located on the campus of the University of Guelph in Guelph, Ontario. History
The Ontario Veterinary College is one of the oldest veterinary schools in North America.
 Veterinary Teaching Hospital (OVC-VTH) was first documented in 2000. To evaluate the apparent emergence of MRSA infection and colonization in horses, nasal swabs from horses and persons at OVC-VTH and a select group of farms from southern Ontario were cultured.

Materials and Methods

Veterinary Hospital Facility

The Large Animal Clinic at OVC-VTH is a tertiary-care referral center with a caseload case·load  
n.
The number of cases handled in a given period, as by an attorney or by a clinic or social services agency.


caseload
Noun
 of [approximately equal to]2,000 horses per year. Hospital personnel that are in contact with horses include senior clinicians (internists, surgeons, other specialists), residents, interns, veterinary technicians, agricultural assistants, and veterinary students.

Sampling Procedures

A limited organized MRSA screening of horses at OVC-VTH was performed from October 1 to October 5, 2000, after the first 2 clinical cases were recognized. A more thorough screening program was performed from May 17 to November 16, 2002, after further cases were recognized. With this program, nasal swabs were collected from all horses at the time of admission, weekly during hospitalization, and at the time of discharge. Intermittent screening of horses on 1 Ontario breeding farm (farm A) was performed from May 11 to September 15, 2002, after infected horses were identified. Nasal swabs were collected from horses at 9 other Ontario farms after MRSA infection in a resident horse was identified at OVC-VTH. Nasal swabs were collected from all horses that were present on these farms on the day of sampling.

Voluntary screening of OVC-VTH Large Animal Clinic personnel was performed on 2 occasions in 2002 in response to identification of clusters of nosocomial nosocomial /noso·co·mi·al/ (nos?o-ko´me-il) pertaining to or originating in a hospital.

nos·o·co·mi·al
adj.
1. Of or relating to a hospital.

2.
 MRSA colonization in horses. Periodic nasal cultures of horses and personnel were initiated at farm A from May 11 to September 15, 2002.

For persons, cotton-tipped swabs were used to sample both anterior nares. For horses, the swab was inserted = 10 cm into 1 anterior nare and rubbed against the mucosa as the swab was removed. Swabs were placed in liquid Stuart's or Amies medium and stored at 4[degrees]C until processing. Colonization or infection identified within 72 h of admission was classified as community acquired.

MRSA Identification, Characterization, and Typing

Nasal swab samples were injected onto mannitol-salt agar with 2 [micro]g/mL oxacillin oxacillin /ox·a·cil·lin/ (ok?sah-sil´in) a semisynthetic penicillinase-resistant penicillin used as the sodium salt in infections due to penicillin-resistant, gram-positive organisms.  and incubated aerobically at 35[degrees]C for 48 h. Colonies were identified as S. aureus The aureus (pl. aurei) was a gold coin of ancient Rome valued at 25 silver denarii. The aureus was regularly issued from the 1st century BC to the beginning of the 4th century AD, when it was replaced by the solidus.  based on colony morphology, Gram stain gram stain

Staining technique for the initial identification of bacteria, devised in 1884 by the Danish physician Hans Christian Gram (1853–1938). The stain reveals basic differences in the biochemical and structural properties of a living cell.
 appearance, ability to ferment maltose, and positive tube coagulase coagulase /co·ag·u·lase/ (-las) an antigenic substance of bacterial origin, produced by staphylococci, which may be causally related to thrombus formation.

co·ag·u·lase
n.
 test or latex agglutination test latex agglutination test
n.
A passive agglutination test in which antigen is adsorbed onto latex particles.


latex agglutination test 
 (Pastorex Staph staph
n.
Staphylococcus.



staph adj.
 Plus, Bio-Rad Laboratories Ltd, Mississauga, Canada).

Screening for methicillin resistance in all S. aureus was by growth on Mueller-Hinton agar with 4% NaCl and 6 [micro]g/mL oxacillin. Confirmation of methicillin resistance was by detection of PBP 2a by using the MRSA SCREEN antibody kit (Denka Seiken Co. Ltd, Tokyo, Japan) (21).

Antimicrobial susceptibility testing was performed by broth microdilution as per NCCLS NCCLS National Committee for Clinical Laboratory Standards  guidelines (22). Detection of inducible erm gene-mediated clindamycin-resistance (MLSs phenotype) was performed by using the double disk diffusion method as described in M100-S14 NCCLS 2004 Informational Supplement (23).

Isolates were typed by using PFGE after DNA extraction and SmaI digestion (24). PFGE images were read manually by 1 investigator (B.W.), and related isolates were divided into subtypes by using an arbitrary naming system based on previously described principles (25). Further typing by DNA sequence DNA sequence Genetics The precise order of bases–A,T,G,C–in a segment of DNA, gene, chromosome, or an entire genome. See Base pair, Base sequence analysis, Chromosome, Gene, Genome.  analysis of the X region of the protein A gene (spa typing) and SCCmec typing were performed, as has been described, on isolates from those with clinical infections, atypical isolates from colonized horses, and a random sample of isolates from colonized horses (12,26).

Isolates from those with clinical infection were tested for the presence of the Panton-Valentine leukocidin (PVL PVL Periventricular Leukomalacia
PVL Prevail
PVL Parameter Value Language
PVL Pade Via Lanczos (circuit modeling)
PVL Physical Volume Library
PVL Pascack Valley Line (New Jersey Transit commuter rail line) 
) genes by polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is  (PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
) and by molecular beacon with the lukF component of pvl. Amplification of the pvl gene was performed by using the following primers: LukS-PV: GGCCTTTCCAATACAATATTGG; and LukF-PV: CCCAATCAACTTCATAAATTG.

Thermal cycling consisted of initial heating at 95[degrees]C for 5 min followed by 35 cycles of denaturation denaturation, term used to describe the loss of native, higher-order structure of protein molecules in solution. Most globular proteins exhibit complicated three-dimensional folding described as secondary, tertiary, and quarternary structures.  (1 min at 94[degrees]C), annealing annealing (ənēl`ĭng), process in which glass, metals, and other materials are treated to render them less brittle and more workable.  (30 s at 57[degrees]C), and extension (1 min at 72[degrees]C). The beacon experiment was carried out using the following beacon and primers: lukF beacon: 5' 6-FAM d (CGCGAAGAATTTATTGGTGTCCTATCTCGATCGCG) DABCYL 3', LukF F: 5'-GCCAGTGTTATCCAGAGG-3', LukF R: CTATCCAGTTGAAGTTGATCC-3'.

Quantitative real-time PCR mixture contained 1x I.Q. supermix (Bio-Rad Laboratories Ltd., Hercules, CA, USA), 0.1 [micro]mol/L each molecular beacon, 0.5 [micro]mol/L of each primer, and DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 template. The thermal cycling program consisted of 10 min on a spectrofluorometric thermal cycler at 95[degrees]C, followed by 45 cycles of 30 s at 95[degrees]C, 30 s at 50[degrees]C, and 30 s at 72[degrees]C.

Statistical Analysis

Duration of carriage by adult horses versus foals was compared by using the Mann-Whitney test. The incidence of intermittent MRSA shedding by adult horses and foals was compared by using Fisher exact test. A p value of <0.05 was considered significant for all comparisons.

Results

In total, MRSA was isolated from 79 horses and 27 persons. Two equine isolations occurred in 2000, 5 in 2001, and 72 in 2002. Of the 79 equine cases, 27 (34%) were in horses that had been hospitalized at OVC-VTH, 41 (52%) were from 1 thoroughbred farm (farm A), and 11 (14%) were from other Ontario farms. Twenty-four of the 79 (30%) horses were adults; the remaining 55 (70%) were <1 year of age.

Clinical infections developed in 13 (16%) horses at 1 or more body sites. Incision or wound infections (n = 6), infection from intravenous catheter (n = 2), bacteremia bacteremia: see septicemia.
bacteremia

Presence of bacteria in the blood. Short-term bacteremia follows dental or surgical procedures, especially if local infection or very high-risk surgery releases bacteria from isolated sites.
 (n = 2), pneumonia (n = 1), infection from surgical implant (n = 1), septic arthritis septic arthritis

Acute inflammation of one or more joints caused by infection. Suppurative arthritis may follow certain bacterial infections; joints become swollen, hot, sore, and filled with pus, which erodes their cartilage, causing permanent damage if not promptly treated
 (n = 1), omphalophlebitis (n = 1), gluteal gluteal /glu·te·al/ (gloo´te-al) pertaining to the buttocks.

glu·te·al
adj.
Of or relating to the buttocks.



gluteal

pertaining to the buttocks.
 abscess abscess, localized inflamation associated with tissue necrosis. Abscesses are characterized by inflamation, which is due to the accumulation of pus in the local tissues, and often painful swelling.  (n = 1), and osteomyelitis osteomyelitis (ŏs'tēōmī'əlī`tĭs), infection of the bone and bone marrow. Direct infection of bone usually occurs through open fractures, penetrating wounds, or surgical operations.  (n = 1) were identified. In 2 neonatal foals, MRSA was isolated from the nares, blood, and intravenous (jugular jugular /jug·u·lar/ (jug´u-lar)
1. cervical.

2. pertaining to a jugular vein.

3. a jugular vein.


jug·u·lar
adj.
) catheter; septic arthritis developed in 1 of the foals. The intravenous catheter was thought to be the original site of infection in both cases. Ten (85%) of 13 clinically affected horses had a history of contact with colonized persons; 2 of these also had contact with infected or colonized horses. No history of known contact with colonized humans or horses was present in 3 (15%) cases. Although many of the clinically infected horses were seriously ill and required prolonged hospitalization, MRSA was implicated im·pli·cate  
tr.v. im·pli·cat·ed, im·pli·cat·ing, im·pli·cates
1. To involve or connect intimately or incriminatingly: evidence that implicates others in the plot.

2.
 directly in the death of 1 horse as a result of severe osteomyelitis.

The clinical significance of 3 isolates was unclear. One was from a routine prebreeding uterine swab from a mare without any apparent clinical abnormalities or history of reproductive disease. Two were from uterine swabs from 2 mares following abortions. Whether MRSA was the cause of abortion in either case was unclear. The remaining 63 (80%) horses had subclinical infection subclinical infection An infection in which Sx are mild or inapparent, and may not be diagnosed other than by positive confirmation of the ability to transmit the infection or serologically  and were nasal carriers.

Typing was performed on all 27 OVC-VTH isolates, 37 (90%) of 41 farm A isolates, and all 11 isolates from other Ontario farms. The remaining 4 isolates, all from colonized horses, were lost before being typed. Of the 75 tested isolates, including all 13 isolates from clinical infections, 72 (96%) were identified as CMRSA 5. This strain is closely related to an international epidemic strain designated the "archaic clone" (ATCC ATCC American Type Culture Collection, see there  BAA-38) (11). Nine different subtypes of CMRSA-5 were identified from horses. All 12 tested isolates from horses with clinical infections contained SCCmecIV, were spa type 7, and did not contain PVL genes. The 2 isolates from postabortion uterine swab specimens also contained SCCmecIV and were negative for PVL genes; however, 1 was spa type 7 and the other spa type 235. Five isolates from colonized horses were tested, and all also contained SCCmecIV and were spa type 7. All 3 non-CMRSA-5 isolates were obtained from farm A and were similar to, but distinguishable from, CMRSA-2, spa type 2 and contained SCCmecIV.

MRSA infection or colonization was suspected of being nosocomial in 17 (63%) of 27 OVC-VTH cases and community-acquired in 3 (11%) cases. Origin of infection was unclear in the remaining 7 (26%) cases. In these cases, the nasal swab specimen was not collected on admission; MRSA was isolated from the first sample collected >72 hours after admission, and horses were admitted from farm A during a time when numerous colonized horses were on the farm.

Sixty-eight of the equine isolates were obtained during periods of organized screening at OVC-VTH or on horse farms. The remaining 11 isolates were from clinical specimens submitted directly by primary care veterinarians to a diagnostic laboratory and are excluded from prevalence calculations. In 2000, MRSA was isolated from the nasal passages of 2 (4%) of 57 horses, including the 2 initial clinical cases. In 2002, MRSA was isolated from 25 (8%) of 320 horses at OVC-VTH and 41 (13%) of 321 horses on farm A. Of the 9 other farms evaluated after identification of an infected or colonized horse at OVC-VTH, MRSA was only identified on 1 farm, where 3 (5%) of 64 of horses were colonized. MRSA was not isolated from any of 277 horses from 8 other Ontario farms.

MRSA was isolated from 27 persons; 17 (14%) of 125 of tested OVC-VTH personnel, 8 (12%) of 67 of farm A personnel, 1 owner of a horse with an MRSA wound infection and the spouse of a colonized OVC-VTH clinician. Three human isolates were obtained in 2000, and 24 were obtained in 2002. Only 1 (4%) was from a source with clinical infection, an OVC-VTH veterinarian veterinarian /vet·er·i·nar·i·an/ (vet?er-i-nar´e-an) a person trained and authorized to practice veterinary medicine and surgery; a doctor of veterinary medicine.

vet·er·i·nar·i·an
n.
 with a tattoo site infection. That person was infected with CMRSA-5 subtype (programming) subtype - If S is a subtype of T then an expression of type S may be used anywhere that one of type T can and an implicit type conversion will be applied to convert it to type T.  H12, a strain that contained SCCmecIV, was spa type 7, and was PVL negative, and that strain was isolated from 2 horses that had been under that person's care for a week before the wound infection developed. All but 1 colonized person (96%) had previous contact with 1 or more MRSA-positive horses; in 24 (89%) of 27 persons, recent contact with a horse infected with an indistinguishable subtype was documented. The colonized spouse of the colonized OVC-VTH clinician reported no contact with horses; however, isolates from both of these persons were indistinguishable from an isolate recovered from a horse under that clinician's care. CMRSA-5 was isolated from 26 (96%) of 27 persons. One person harbored both CMRSA-5 and the CMRSA-2--like isolate in his nose at the same time. This person was a veterinarian from farm A, which was the origin of the 3 horses colonized with this strain. Nine different subtypes of CMRSA-5 were identified among human isolates.

All but 2 of the human isolates were obtained during organized screening of personnel from OVC-VTH or selected Ontario horse farms. In 2000, MRSA was isolated from 2 (10%) of 21 humans at the OVC-VTH. In 2002, MRSA was isolated from 15 (12%) of 127 persons at OVC-VTH and 8 (12%) of 68 from farm A.

Antimicrobial susceptibility testing was performed on 67 of the 72 equine and all 26 human CMRSA-5 isolates, and the 5 CMRSA-2-related strains. Five of the equine CMRSA-5 isolates were unavailable for testing. All 101 MRSA isolates tested were susceptible to ciprofloxacin ciprofloxacin /cip·ro·flox·a·cin/ (sip?ro-flok´sah-sin) a synthetic antibacterial effective against many gram-positive and gram-negative bacteria; used as the hydrochloride salt.

cip·ro·flox·a·cin
n.
, clindamycin, fusidic acid fusidic acid

a lipophilic steroid antibioitic, the product of Fusidium coccineum; mainly active against gram-positive bacteria.
, linezolid, mupirocin, quinupristin-dalfopristin, and vancomycin vancomycin (văn'kōmī`sĭn), antibiotic resembling penicillin in the way it acts. It is derived from the bacterium Streptomyces orientalis, which was isolated from soil of India and Indonesia. . The range of oxacillin MIC was 1->32 [micro]g/mL, and although 21.8% of strains had oxacillin MIC of [less than or equal to] 2 [micro]g/mL at 24 h, all such strains grew on the NCCLS oxacillin screen agar and produced the PBP2a protein. Isolates of both CMRSA-5 and CMRSA-2--related strains that were erythromycin-resistant were found to be inducibly resistant to clindamycin when challenged by using the double disk approximation test. The remaining susceptibility test results are presented in the Table.

Discussion

This study has identified the largest number of reported cases of clinical MRSA infection in horses and horse personnel. It also identified extensive nasal colonization in horses and horse personnel from a veterinary hospital and horse farm, nosocomial infection Nosocomial infection
An infection that can be acquired in a hospital. ABPA is a nosocomial infection.

Mentioned in: Allergic Bronchopulmonary Aspergillosis, Hospital-Acquired Infections, Pseudomonas Infections

 in a veterinary hospital setting with clinical illness in horses, and for the first time, clinical infection in 1 person working with infected horses. The subtyping information and timing of isolation provide solid evidence supporting both human-to-horse and horse-to-human transmission.

The prevalence of MRSA colonization in horses at the OVC-VTH was 4% in 2000 and 8% in 2002; however, care must be taken when interpreting these data because screening was performed during 2 periods that followed identification of clinical MRSA infection in horses at the facility. Similar limitations are present with the prevalence data regarding MRSA colonization on breeding farms, which ranged from 0% to 13% and were based on screening after identification of MRSA infection or colonization at OVCVTH in horses from these farms. The prevalence of human colonization at OVC-VTH and 1 Ontario horse farm is of concern, particularly because of the likelihood of transmission between horses and humans on these farms. As with horses, the prevalence data in humans must be interpreted with care because of the nature of sampling. Further studies are required to determine the prevalence of MRSA infection and colonization in horses and humans at veterinary hospitals and equine farms. One well-recognized human S. aureus strain, CMRSA-5, a relatively uncommon isolate in Canada (11), has the ability to colonize col·o·nize  
v. col·o·nized, col·o·niz·ing, col·o·niz·es

v.tr.
1. To form or establish a colony or colonies in.

2. To migrate to and settle in; occupy as a colony.

3.
 the nose of horses and to spread between horses and between horses and persons on farms and within a veterinary hospital setting. The PFGE pattern of the CMRSA-5 isolates was similar to the PFGE patterns published in a previous report of MRSA infection in horses (13). This finding, along with the isolation of CMRSA-5 from horses in Prince Edward Island Prince Edward Island, province (2001 pop. 135,294), 2,184 sq mi (5,657 sq km), E Canada, off N.B. and N.S. Geography


One of the Maritime Provinces, Prince Edward Island lies in the Gulf of St.
, Canada (J.S. Weese et al., unpub, data) and Colorado, USA (P. Morley, pers. comm.) that did not have any contact with colonized Ontario horses or horse personnel, further suggests that CMRSA-5 may be more disseminated in the horse population beyond Ontario.

Why MRSA has emerged in the equine population is unclear. It may reflect increased exposure of horses to MRSA-infected persons, a unique ability of CMRSA-5 to colonize horses, the increasing use of certain antimicrobial drugs in veterinary medicine, or a combination of these factors. Several recent investigations in humans suggest that the fluoroquinolones themselves may actually predispose pre·dis·pose
v.
To make susceptible, as to a disease.
 patients to infection with or carriage of MRSA (27,28). Two case-control studies examining risk factors for MRSA found a significant association between fluoroquinolone fluoroquinolone /flu·o·ro·quin·o·lone/ (-kwin´o-lon) any of a subgroup of fluorine-substituted quinolones, having a broader spectrum of activity than nalidixic acid.

fluor·o·quin·o·lone
n.
 exposure and MRSA isolation or infection (4,29).

Whether fluoroquinolone use in horses has facilitated emergence of MRSA is not known, since no current data exist on fluoroquinolone use in veterinary medicine. Enrofloxacin is widely used in some sectors of the Ontario horse population, particularly racing horses; however, it is rarely prescribed at OVC-VTH and uncommonly used on breeding farms (J.S. Weese, unpub. data).

While MRSA has been considered primarily a hospital-associated pathogen in humans (10), the increasing incidence of community-acquired infection is concerning (8,9,30,31). Similar to the equine and equine-associated cases reported here, community-acquired infection with SCCmecIV strains has been reported in humans (32-34). Most reports of community-acquired-MRSA in humans involve skin and soft tissue infections, and production of PVL has been implicated as the possible virulence factor in community-associated MRSA infection in humans (31,35). None of the isolates from clinical equine or equine-associated infections in this study contained PVL genes; however, definitive conclusions regarding the role of PVL in equine-associated infection cannot be made with the reasonably small number of clinical isolates evaluated here. Isolates in this study were also multidrug resistant, in contrast to results of many reports of community-associated MRSA in humans (36,37). Therefore, determining the origin of these isolates (community versus hospital) is not straightforward and requires further study.

The lack of proven, safe, and acceptable options of eradication of nasal colonization in horses creates potential management problems. To date, isolation of infected horses and use of barrier precautions barrier precautions Infection control A general term referring to any method or device used to ↓ contact with potentially infectious body fluids, including facial masks, doubled gloves and fluid-resistant gowns. See Isolation, Reverse isolation, Universal precautions.  have been employed (J.S. Weese, unpub data). However, such methods may be difficult on farms, particularly if colonization is prolonged.

Our study has shown that MRSA infection may be an emerging disease in horses, which agrees with earlier reports (13,14). MRSA infection also may become an important nosocomial problem in the veterinary hospital setting and become endemic on horse farms, particularly in foals. Because of the extensive movement of horses, especially thoroughbreds and standardbreds, between and within Canada and the United States The United States and Canada share a unique legal relationship. U.S. law looks northward with a mixture of optimism and cooperation, viewing Canada as an integral part of U.S. economic and environmental policy. , MRSA colonization and infection may be more widespread than recognized. Emergence of MRSA as an equine pathogen is of additional concern because horses may be a community reservoir of MRSA and source of infection or reinfection reinfection /re·in·fec·tion/ (-in-fek´shun) a second infection by the same agent or a second infection of an organ with a different agent.

re·in·fec·tion
n.
 for persons. In view of the size of the North American North American

named after North America.


North American blastomycosis
see North American blastomycosis.

North American cattle tick
see boophilusannulatus.
 horse population and the frequent close contact between many persons and horses, this concern must not be dismissed. Further study is required to clarify the role of this pathogen in equine disease and transmission between horses and humans.
Table. In vitro antimicrobial susceptibilities of 101
methicillin-resistant Staphylococcus aureus isolates from humans and
horses *

                                    MIC in [micro]g/mL

Antimicrobial agent       50%           90%             Range

Tetracycline              >16           >16         [less than or
                                                    equal to] 4-
                                                    [greater than
                                                   or equal to] 16
Doxycycline                8             8          [less than or
                                                    equal to] 4-8
Minocycline            [less than
                        or equal     [less than
                         to] 4        or equal
                                       to] 4        [less than or
                                                    equal to] 4-8
Erythromycin               >8            >8         [less than or
                                                   equal to] 0.5->
                                                          8
Gentamicin                >16
                       ([dagger])       >16
                                     ([dagger])     [less than or
                                                    equal to] 2->
                                                    16([dagger])
Rifampicin                 >4            >4         [less than or
                                                   equal to] 1->4
TMP/SMX                  8/152         >8/152       [less than or
                                                   equal to] 2/38-
                                                        8/152

                             % of isolates

Antimicrobial agent    Intermediate    Resistant

Tetracycline                0            96
Doxycycline                78.2           0
Minocycline                14.8           0
Erythromycin                0            86.1
Gentamicin                  9.9          88.1
Rifampicin                 10.9          71.2
TMP/SMX                     NA           79.2

* MIC, minimum inhibitory concentration; TMP/SMX,
trimethoprim-sulfamethoxazole; NA, no intermediate MIC category in
NCCLS guidelines.

([dagger]) All strains were susceptible to gentamicin at a
concentration of 500 [micro]g/mL.


References

(1.) Barber M. Methicillin-resistant staphylococci. J Clin Pathol. 1961;14:385-93.

(2.) Ito T, Katayama Y, Asada K, Mori N, Tsutsumimoto K, Tiansasitorn C, et al. Structural composition of three types of staphylococcal chromosomal cassette chromosome mec integrated in the chromosome of methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother. 2001;45:1323-36.

(3.) Daum RS, Ito T, Hiramatsu K, Hussain F, Mongkolrattanothai K, Jamklang M, et al. A novel methicillin-resistance cassette in community-acquired methicillin-resistant Staphylococcus aureus isolates of diverse genetic backgrounds. J Infect Dis. 2002; 186:1344-7.

(4.) Graffunder EM, Venezia RA. Risk factors associated with nosocomial methicillin-resistant Staphylococcus aureus (MRSA) infection including previous use of antimicrobials. J Antimicrob Chemother. 2002;49:999-1005.

(5.) Hartstein AI, Mulligan mul·li·gan  
n.
A golf shot not tallied against the score, granted in informal play after a poor shot especially from the tee.



[Probably from the name Mulligan.]

Noun 1.
 ME. Methicillin-resistant Staphylococcus aureus In: Mayhall CG, editor. Hospital epidemiology and infection control. Baltimore: Williams and Wilkins, 1996. p. 290-306.

(6.) Casewell MW. New threats to the control of methicillin resistant S taphylococcus aureus. J Hosp Infect. 1995;30:465-71.

(7.) Baggett HC, Hennessy TW, Leman lem·an  
n. Archaic
1. A sweetheart; a lover.

2. A mistress.



[Middle English leofman, lemman : leof, dear (from Old English
 R, Hamlin C, Bruden D, Reasonover A, et al. An outbreak of community-onset methicillin-resistant Staphylococcus aureus skin infections in southwestern Alaska. Infect Control Hosp Epidemiol. 2003;24:397-402.

(8.) Centers for Disease Control and Prevention Centers for Disease Control and Prevention (CDC), agency of the U.S. Public Health Service since 1973, with headquarters in Atlanta; it was established in 1946 as the Communicable Disease Center. . Four pediatric pediatric /pe·di·at·ric/ (pe?de-at´rik) pertaining to the health of children.

pe·di·at·ric
adj.
Of or relating to pediatrics.
 deaths from community-acquired methicillin-resistant Staphylococcus staphylococcus (stăf'ələkŏk`əs), any of the pathogenic bacteria, parasitic to humans, that belong to the genus Staphylococcus. The spherical bacterial cells (cocci) typically occur in irregular clusters [Gr.  aureus--Minnesota and North Dakota. MMWR MMWR Morbidity & Mortality Weekly Report Epidemiology A news bulletin published by the CDC, which provides epidemiologic data–eg, statistics on the incidence of AIDS, rabies, rubella, STDs and other communicable diseases, causes of mortality–eg,  Morb Mortal Wkly Rep. 1999;48:707-10.

(9.) Centers for Disease Control and Prevention. Public Health Dispatch: outbreaks of community-associated methicillin-resistant Staphylococcus aureus skin infections--Los Angeles County, California, 2002-2003. MMWR Morb Mortal Wkly Rep. 2003;52:88.

(10.) Simor AE, Ofner-Agostini M, Bryce E, Green K, McGeer A, Mulvey MR, et al. The evolution of methicillin-resistant Staphylococcus aureus in Canadian hospitals. CMAJ CMAJ Canadian Medical Association Journal . 2001; 165:21-26.

(11.) Simor AE, Ofner-Agostini M, Bryce E, McGeer A, Paton S, Mulvey MR. Laboratory characterization of methicillin-resistant Staphylococcus aureus in Canadian hospitals: results of 5 years of national surveillance, 1995-1999. J Infect Dis. 2002;186:652-60.

(12.) Shopsin B, Gomez M, Montgomery SO, Smith DH, Waddington M, Dodge DE, et al. Evaluation of protein A gene polymorphic region DNA sequencing for typing of Staphylococcus aureus strains. J Clin Microbiol. 1999;37:3556-63.

(13.) Seguin JC, Walker RD, Caron JP, Kloos WE, George CG, Hollis RJ, et al. Methicillin-resistant Staphylococcus aureus outbreak in a veterinary teaching hospital: potential human-to-animal transmission. J Clin Microbiol. 1999;37:1459-63.

(14.) Hartmann FA, Trostle SS, Klohnen AAO AAO American Association of Orthodontists; American Academy of Ophthalmology; American Academy of Otolaryngology; American Academy of Osteopathy.
AAO 
. Isolation of methicillin-resistant Staphylococcus aureus from a post-operative wound infection in a horse. J Am Vet Med Assoc. 1997;211:590-2.

(15.) Cefai C, Ashurst S, Owens C. Human carriage of methicillin-resistant Staphylococcus aureus linked with pet dog. Lancet. 1994;344:539-40.

(16.) Devriese LA. Epidemiology of methicillin-resistant Staphylococcus aureus in dairy herds. Res Vet Sci. 1975;19:23-7.

(17.) Shimizu A, Kawano J, Yamamoto C, Kakutani O, Anzai T, Kamada M. Genetic analysis of equine methicillin-resistant Staphylococcus aureus by pulsed-field gel electrophoresis. J Vet Med Sci. 1997;59:935-7.

(18.) Pak SI, Han HR, Shimizu A. Characterization of methicillin-resistant Staphylococcus aureus isolated from dogs in Korea. J Vet Med Sci. 1999;61:1013-8.

(19.) Manian FA. Asymptomatic nasal carriage of mupirocin-resistant, methicillin-resistant Staphylococcus aureus (MRSA) in a pet dog associated with MRSA infection in household contacts. Clin Infect Dis. 2003;36:e26-8.

(20.) Tomlin J, Pead MJ, Lloyd DH, Howell S, Hartmann FA, Jackson HA, et al. Methicillin-resistant Staphylococcus aureus infections in 11 dogs. Vet Rec. 1999;144:60-4.

(21.) Gosbell IB, Neville SA, Mercer JL, Fernandes LA, Fernandes CJ. Evaluation of the MRSA-Screen Test in detecting oxacillin resistance in community and hospital isolates of Staphylococcus aureus. Pathology. 2001;33:493-5.

(22.) NCCLS. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. Approved standard M7-A5. Wayne (PA): NCCLS; 2000.

(23.) NCCLS. Fourteenth Informational Supplement M100-S14. Wayne (PA); NCCLS; 2004.

(24.) Mulvey MR, Chui L, Ismail J, Louie L, Murphy C, Chang N, et al. Development of a Canadian standardized protocol for subtyping methicillin-resistant Staphylococcus aureus isolates using pulsed-field gel electrophoresis. J Clin Microbiol. 2001;39:3481-5.

(25.) Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Persing DH, et al. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol. 1995;33:2233-9.

(26.) Oliveira DC, DeLencastre H. Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother. 2002;46:2155-61.

(27.) Weber SG, Gold HS, Hooper DC, Karchmer AW, Carmeli Y. Fluoroquinolones and the risk for methicillin-resistant Staphylococcus aureus in hospitalized patients. Emerg Infect Dis. 2003;9:1415-22.

(28.) Crowcroft NS, Ronveaux O, Monnet DL, Mertens R. Methicillin-resistant Staphylococcus aureus and antimicrobial use in Belgian hospitals. Infect Control Hosp Epidemiol. 1999;20:31-6.

(29.) Dziekan G, Hahn A, Thune K, Schwarzer G, Schafer K, Daschner FD, et al. Methicillin-resistant Staphylococcus aureus in a teaching hospital: investigation of nosocomial transmission using a matched case-control study. J Hosp Infect. 2000;46:263-70.

(30.) Hwang JH, Tsai HY, Liu TC. Community-acquired methicillin-resistant Staphylococcus aureus infections in discharging ears. Acta Oto-Laryngologica. 2002;122:827-30.

(31.) Dufour P, Gillet Y, Bes M. Community-acquired methicillin-resistant Staphylococcus aureus infections in France: emergence of a single clone that produces Panton-Valentine leukocidin. Clin Infect Dis. 2002;35:819-24.

(32.) Ma XX, Ito T, Tiensasitorn C, Jamklang M, Chongtrakool P, Boyle-Vavra S, et al. Novel type of staphylococcal cassette chromosome mec identified in community-acquired methicillin-resistant Staphylococcus aureus strains. Antimicrob Agents Chemother. 2002;46:1147-52.

(33.) Pan ES, Diep BA, Carleton HA, Charlebois ED, Sensabaugh GF, Hailer hail·er  
n.
1. One that greets, acclaims, or catches someone's attention.

2. A bullhorn.
 B J, et al. Increasing prevalence of methicillin-resistant Staphylococcus aureus infection in California jails. Clin Infect Dis. 2003;37:1384-8.

(34.) Baba T, Takeuchi F, Kuroda M, Yuzawa H, Aoki K, Oguchi A, et al. Genome and virulence determinants of high virulence community-acquired MRSA. Lancet. 2002;359:1819-27.

(35.) Lina G, Piemont Y, Godail-Gamot F, Bes M, Peter MO, Gauduchon V, et al. Involvement of Panton-Valentine leukocidin-producing Staphylococcus aureus in primary skin infections and pneumonia. Clin Infect Dis. 1999;29:1128-32.

(36.) Kenner J, O'Connor T, Piantanida N, Fishbain J, Eberly B, Viscount H, et al. Rates of carriage of methicillin-resistant and methicillin-susceptible Staphylococcus aureus in an outpatient population. Infect Control Hosp Epidemiol. 2003;24:439-44.

(37.) Hopital Propre II Study Group. Methicillin-resistant Staphylococcus aureus in French hospitals: a 2-month survey in 43 hospitals, 1995. Infect Control Hosp Epidemiol. 1999;20:478-86.

Dr. Weese is an associate professor in the Department of Clinical Studies, Ontario Veterinary College, University of Guelph The University of Guelph is a medium-sized university located in Guelph, Ontario, established in 1964. While the U of G offers degrees in many different disciplines, the university is best known for its focus on life sciences, based in part on a long-standing history of . His current research interests include multidrug-resistant bacteria multidrug-resistant bacteria Microbiology Bacteria that have acquired antibiotic-resistant genes. See Multidrug resistance.  (particularly interspecies transmission of such bacteria), zoonotic diseases Zoonotic diseases
Diseases caused by infectious agents that can be transmitted between (or are shared by) animals and humans. This can include transmission through the bite of an insect, such as a mosquito.

Mentioned in: West Nile Virus
, and veterinary infection control.

Address for correspondence: J. Scott Weese, Department of Clinical Studies, Ontario Veterinary College, University of Guelph, Guelph, Ontario N 1G 2W1; fax: 519-763-9544; email: jsweese@uoguelph.ca

All material published in Emerging Infectious Diseases is in the public domain and may be used and reprinted without special permission; proper citation, however, is appreciated.

J.S. Weese, * M. Archambault, * B.M. Willey, ([dagger]) H. Dick, ([double dagger]) P. Hearn, ([section]) B.N. Kreiswirth, ([section]) B. Said-Salim, ([paragraph]) A. McGeer, ([dagger]) Y. Likhoshvay, ([paragraph]) J.F. Prescott, * and D.E. Low ([dagger])

* University of Guelph, Guelph, Ontario, Canada; ([dagger]) Mount Sinai Hospital Mount Sinai Hospital can refer to:
  • Mount Sinai Hospital (Toronto)
  • Mount Sinai Hospital, New York
  • Mount Sinai Medical Center & Miami Heart Institute
  • Mount Sinai Hospital, Cleveland
  • Mount Sinai Hospital, Chicago
  • Mount Sinai Hospital, Milwaukee
, Toronto, Ontario, Canada; ([double dagger]) Vita-Tech Laboratories, Markham, Ontario, Canada; ([section]) Hearn Veterinary Services, Orangeville, Ontario, Canada; and ([paragraph]) New York University New York University, mainly in New York City; coeducational; chartered 1831, opened 1832 as the Univ. of the City of New York, renamed 1896. It comprises 13 schools and colleges, maintaining 4 main centers (including the Medical Center) in the city, as well as the  Medical Center, New York New York, state, United States
New York, Middle Atlantic state of the United States. It is bordered by Vermont, Massachusetts, Connecticut, and the Atlantic Ocean (E), New Jersey and Pennsylvania (S), Lakes Erie and Ontario and the Canadian province of
, New York, USA
COPYRIGHT 2005 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2005, Gale Group. All rights reserved.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Research
Author:Weese, J.S.; Archambault, M.; Willey, B.M.; Dick, H.; Hearn, P.; Kreiswirth, B.N.; Said-Salim, B.; M
Publication:Emerging Infectious Diseases
Geographic Code:1CANA
Date:Mar 1, 2005
Words:4565
Previous Article:West Nile virus risk assessment and the bridge vector paradigm.(Research)
Next Article:Malaria risk in travelers.(Research)
Topics:



Related Articles
Community-acquired methicillin-resistant Staphylococcus aureus, Finland. (Research).
Community-acquired methicillin-resistant Staphylococcus aureus among military recruits.(Dispatches)
Recurring methicillin-resistant Staphylococcus aureus infections in a football team.(Research)
Community-associated methicillin-resistant Staphylococcus aureus in hospital nursery and maternity units.(RESEARCH)
Pseudomonas aeruginosa, staphylococcus aureus, and fluoroquinolone use.(RESEARCH)
Methicillin-resistant Staphylococcus aureus, Hawaii, 2000-2002.(RESEARCH)
Community-associated methicillin-resistant Staphylococcus aureus, Minnesota, 2000-2003.
Methicillin-resistant Staphylococcus aureus, Western Australia.
Methicillin-resistant staphylococci in companion animals.(DISPATCHES)
Methicillin-resistant Staphylococcus aureus in pig farming.(DISPATCHES)

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles