Metabolism of low-dose inorganic arsenic in a central european population: influence of sex and genetic polymorphisms.BACKGROUND: There is a wide variation in susceptibility to health effects of arsenic, which, in part, may be due to differences in arsenic metabolism. Arsenic is metabolized by reduction and methylation methylation, n a phase-II detoxification pathway in the liver; methyl groups combine with toxins to rid the body of various substances. methylation (meth´ reactions, catalyzed by reductases and methyltransferases. OBJECTIVES: Our goal in this study was to elucidate the influence of various demographic and genetic factors on the metabolism of arsenic. METHODS: We studied 415 individuals from Hungary, Romania, and Slovakia by measuring arsenic metabolites Metabolites Substances produced by metabolism or by a metabolic process. Mentioned in: Interactions in urine using liquid chromatography with hydride generation and inductively coupled plasma mass spectrometry ICP-MS (Inductively coupled plasma mass spectrometry) is a type of mass spectrometry that is highly sensitive and capable of the determination of a range of metals and several non-metals at concentrations below one part in 1012. (HPLC-HG-ICPMS). We performed genotyping of arsenic (+III) methyltransferase (AS3MT), glutathione S-transferase omega 1 (GSTO1), and methylenetetrahydrofolate reductase (MTHFR MTHFR Methylenetetrahydrofolate Reductase (gene mutation) ). RESULTS: The results show that the M287T (T[right arrow]C) polymorphism in the AS3MT gene, the A222V (C[right arrow]T) polymorphism in the MTHFR gene, body mass index, and sex are major factors that influence arsenic metabolism in this population, with a median of 8.0 [micro]g/L arsenic in urine. Females < 60 years of age had, in general, higher methylation efficiency than males, indicating an influence of sex steroids. That might also explain the observed better methylation in overweight or obese women, compared with normal weight men. The influence of the M287T (T[right arrow]C) polymorphism in the AS3MT gene on the methylation capacity was much more pronounced in men than in women. CONCLUSIONS: The factors investigated explained almost 20% of the variation seen in the metabolism of arsenic among men and only around 4% of the variation among women. The rest of the variation is probably explained by other methyltransferases backing up the methylation of arsenic. KEY WORDS: arsenic, AS3MT, blood, GSTO1, methylation, MTHFR, polymorphisms, sex, urine. Environ Health Perspect 115:1081-1086 (2007). doi:10.1289/ehp.10026 available via http://dx.doi.org/ [Online 27 March 2007] Arsenic is a worldwide water contaminant contaminant /con·tam·i·nant/ (kon-tam´in-int) something that causes contamination. contaminant something that causes contamination. , and chronic exposure has been associated with a large number of health effects, such as different forms of cancer, skin lesions Skin Lesions Definition A skin lesion is a superficial growth or patch of the skin that does not resemble the area surrounding it. Description Skin lesions can be grouped into two categories: primary and secondary. , vascular diseases vascular diseases, n.pl diseases of the peripheral circulatory system. , liver-and neurotoxicity neurotoxicity /neu·ro·tox·ic·i·ty/ (noor?o-tok-sis´it-e) the quality of exerting a destructive or poisonous effect upon nerve tissue. , and diabetes mellitus diabetes mellitus Disorder of insufficient production of or reduced sensitivity to insulin. Insulin, synthesized in the islets of Langerhans (see Langerhans, islets of), is necessary to metabolize glucose. In diabetes, blood sugar levels increase (hyperglycemia). [Internal Agency for Research on Cancer 2004; World Health Organization (WHO) 2001]. A wide variation in susceptibility to various health effects has been reported (National Research Council 2001), which, in part, may be due to the marked variation in the metabolism of arsenic (Vahter 2002). The classical pathway for the metabolism of inorganic arsenic (iAs) involves alternating reduction and oxidative methylation with only one end product, dimethylarsinate [DMA (1) (Digital Media Adapter) See digital media hub. (2) (Document Management Alliance) A specification that provides a common interface for accessing and searching document databases. (V)] (Vahter 2002). Another--newly proposed--pathway suggests methylation of arsenic-glutathione complexes (Hayakawa et al. 2005) or arsenic bound to proteins (Naranmandura et al. 2006) with methylarsonate [MA(V)] and DMA(V) as end products. Both pathways involve methylation of arsenic via one-carbon metabolism with S-adenosyl methionine (SAM) as the methyl donor and requiring reduced glutathione re·duced glutathione n. The form of glutathione that acts as a hydrogen donor during cellular oxidation-reduction reactions. (GSH GSH reduced glutathione. GSH reduced glutathione. ) (Figure 1). GSH and probably other thiols serve as electron donors in the reduction reactions (Delnomdedieu et al. 1994a, 1994b; Scott et al. 1993), which are catalyzed by reductases. Following exposure to iAs by ingestion ingestion /in·ges·tion/ (-chun) the taking of food, drugs, etc., into the body by mouth. in·ges·tion n. 1. The act of taking food and drink into the body by the mouth. 2. or inhalation, DMA(V) is the major metabolite metabolite, organic compound that is a starting material in, an intermediate in, or an end product of metabolism. Starting materials are substances, usually small and of simple structure, absorbed by the organism as food. found in urine in most mammals, including humans, but MA(V) is found in human urine and very rarely in urine of other mammals (Vahter 2002). The metabolism of iAs involves both detoxification Detoxification Definition Detoxification is one of the more widely used treatments and concepts in alternative medicine. It is based on the principle that illnesses can be caused by the accumulation of toxic substances (toxins) in the body. (methylation) and activation (reduction). Although MA(V) and DMA(V) have a lower toxicity than inorganic arsenic species (Hughes and Kenyon 1998), the trivalent trivalent /tri·va·lent/ (tri-va´lent) having a valence of three. tri·va·lent adj. Having valence 3. tri·va methylated meth·yl·ate n. An organic compound in which the hydrogen of the hydroxyl group of methyl alcohol is replaced by a metal. tr.v. meth·yl·at·ed, meth·yl·at·ing, meth·yl·ates 1. metabolites are more reactive and toxic than the other arsenic metabolites (Kligerman and Tennant 2006; Petrick et al. 2000; Schwerdtle et al. 2003a, 2003b; Styblo et al. 2000; Vega et al. 2001). A series of studies reported the presence of methylarsonite [MA(III)] and dimethylarsinite [DMA(III)] in urine (Aposhian et al. 2000; Le et al. 2000; Mandal et al. 2001; Valenzuela et al. 2005), although high concentrations are not likely to be found in urine because the high reactivity renders them to bind in tissues (Vahter 2002). In contrast, it is reasonable to assume that the total amount of MA in urine reflects the formation of the highly toxic highly toxic Occupational medicine adjective Referring to a chemical that 1. Has a median lethal dose–LD50 of ≤ 50 mg/kg when administered orally to 200-300 g albino rats 2. MA(III) in the body. This might explain the observed increasing prevalence of arsenicrelated toxic effects (e.g., skin lesions, skin cancer, bladder cancer bladder cancer Malignant tumour of the bladder. The most significant risk factor associated with bladder cancer is smoking. Exposure to chemicals called arylamines, which are used in the leather, rubber, printing, and textiles industries, is another risk factor. , chromosome aberrations) with an increasing percentage of MA in urine (Chen et al. 2003a, 2003b, 2005; Del Razo et al. 1997; Hsueh et al. 1997; Maki-Paakkanen J 1998; Steinmaus et al. 2006; Yu et al. 2000). Furthermore, experimental animals, most of which methylate methylate /meth·yl·ate/ (meth´i-lat) 1. a compound of methyl alcohol and a base. 2. to add a methyl group to a substance. meth·yl·ate v. 1. arsenic efficiently to DMA with essentially no MA excretion, show a faster overall excretion of arsenic than humans (Vahter 2002). Also, people with a small percentage of urinary arsenic as MA show less retention of arsenic than those with a higher percentage of urinary MA (Vahter 1999). Thus, it is essential to determine the reasons for the marked variation in the metabolism of arsenic between individuals and population groups. One reason could be genetic polymorphisms in the regulation of enzymes involved in arsenic metabolism (Vahter 2000). One arsenic-reductase has been identified to be glutathione-S-transferase omega (GSTO1), which is able to reduce both MA(V) to MA(III) and arsenate ar·se·nate n. A salt of arsenic acid. arsenate an uncommon garden pesticide, as lead arsenate, or as antifungal spray on fruit trees or cattle tick dip as sodium arsenate. [As(V)] to arsenite [As(III)] (Zakharyan et al. 2001). Recently, a SAM-dependent arsenic methyltransferase isolated in rat was found to be a homolog hom·o·log n. Variant of homologue. of human arsenic (+III) methyltransferase (AS3MT; previously called Cyt19) (Lin et al. 2002). Enzymes involved in the one-carbon metabolism could also indirectly influence the metabolism of arsenic, for example, methylenetetrahydrofolate reductase (MTHFR) (Figure 1). Our aim in the present study was to elucidate the reasons for intraindividual variation in arsenic metabolism. Therefore, we studied the influence of age, sex, body mass index (BMI BMI body mass index. BMI abbr. body mass index Body mass index (BMI) A measurement that has replaced weight as the preferred determinant of obesity. ), genetic polymorphisms, and selenium selenium (səlē`nēəm), nonmetallic chemical element; symbol Se; at. no. 34; at. wt. 78.96; m.p. 217°C;; b.p. about 685°C;; sp. gr. 4.81 at 20°C;; valence −2, +4, or +6. status on the arsenic metabolite pattern in urine. Materials and Methods Study population. This study is part of a case-control study case-control study, n an investigation employing an epidemiologic approach in which previously existing incidents of a medical condition are used in lieu of gathering new information from a randomized population. concerning cancer risks in relation to low-level arsenic exposure via drinking water drinking water supply of water available to animals for drinking supplied via nipples, in troughs, dams, ponds and larger natural water sources; an insufficient supply leads to dehydration; it can be the source of infection, e.g. leptospirosis, salmonellosis, or of poisoning, e.g. in Central Europe: Arsenic Health Risk Assessment and Molecular Epidemiology molecular epidemiology Molecular medicine An evolving field that combines the tools of standard epidemiology–case studies, questionnaires and monitoring of exposure to external factors with the tools of molecular biology–eg, restriction endonucleases, (ASHRAM ashram or ashrama In Hinduism, any of the four stages of life through which a “twice-born” (see upanayana) Hindu ideally will pass. ). Study areas were defined as certain counties in Hungary (Bacs, Bekes, Csongrad, and Jazs-Nagykun-Szolnok), Romania (Bihor and Arad), and Slovakia (Banska Bystrica and Nitra) with known hotspots of arsenic in drinking water. The recruitment of skin, bladder, and kidney cancer Kidney Cancer Definition Kidney cancer is a disease in which the cells in certain tissues of the kidney start to grow uncontrollably and form tumors. cases and hospital-based controls with appendicitis Appendicitis Definition Appendicitis is an inflammation of the appendix, which is the worm-shaped pouch attached to the cecum, the beginning of the large intestine. The appendix has no known function in the body, but it can become diseased. , abdominal hernias, duodenal ulcer duodenal ulcer, n a peptic ulcer located in the duodenum. See also ulcer, peptic. duodenal ulcer An ulcer of the duodenum Epidemiology H pylori , cholelithiasis cholelithiasis /cho·le·li·thi·a·sis/ (ko?le-li-thi´ah-sis) the presence or formation of gallstones. cho·le·li·thi·a·sis n. , and fractures, as well as the methods for collecting urine and blood samples, are described elswhere (Lindberg et al. 2006; Thirumaran et al. 2006). In short, all spot urine samples and whole blood samples, in spite of country, were collected and stored at -20[degrees]C and -80[degrees]C, respectively, until analysis. Informed consent was obtained from all participants, and the study was approved by the ethics committee ethics committee A multidisciplinary hospital body composed of a broad spectrum of personnel–eg, physicians, nurses, social workers, priests, and others, which addresses the moral and ethical issues within the hospital. See DNR, Institutional review board. of each hospital. In order to eliminate any potential bias caused by cancer, we selected controls for evaluation of factors that influence the metabolism of iAs. There was a cluster of values close to 100% DMA at the lowest water arsenic concentrations. The intercept between the sum of urinary arsenic metabolites plotted against current water concentration was 2.5 [micro]g/L, indicating a significant contribution of arsenic from food at the low exposure levels (Lindberg et al. 2006). Also, when performing speciation speciation Formation of new and distinct species, whereby a single evolutionary line splits into two or more genetically independent ones. One of the fundamental processes of evolution, speciation may occur in many ways. analysis in urine samples with very low concentrations, it is often only the major species that is above the limit of detection, leading to nearly 100% DMA in this case. Because of the influence of food and analytical precision on the percentage of DMA (%DMA) in the low concentration range, we decided to evaluate factors that influence the metabolite pattern only at concentrations > 2 [micro]g/L, at which the influence from food was less obvious. Furthermore, 11 individuals were also excluded because they had high urinary arsenic concentrations and low water arsenic concentrations in combination with a high percentage of DMA in the urine, indicating a significant contribution to the exposure via food. The sample size after these exclusions was 415 individuals. Determination of arsenic compounds with HPLC-HG-ICPMS. The arsenic metabolites in urine were measured by an inductively coupled plasma An inductively coupled plasma (ICP) is a type of plasma source in which the energy is supplied by electrical currents which are produced by electromagnetic induction, that is, by time-varying magnetic fields. mass spectrometer (ICPMS ICPMS Inductively Coupled Plasma Mass Spectrometry ICPMS Inductively Coupled Plasma Mass Spectroscopy ; HP 4500 or Agilent 7500cs; Agilent Technologies, Waldbronn, Germany) equipped with an integrated sample introducion system and a hydride generation (HG) accessory together with an Agilent 1100 chromatographic chro·mat·o·graph n. An instrument that produces a chromatogram. tr.v. chro·mat·o·graphed, chro·mat·o·graph·ing, chro·mat·o·graphs To separate and analyze by chromatography. system equipped with solvent degasser, autosampler, and a thermostatted column. The method is described in more detail elswhere (Lindberg et al. 2006). We adjusted the arsenic concentrations in urine to the average specific gravity specific gravity, ratio of the weight of a given volume of a substance to the weight of an equal volume of some reference substance, or, equivalently, the ratio of the masses of equal volumes of the two substances. in the population (1.017 g/[cm.sup.3]) using a refractometer refractometer /re·frac·tom·e·ter/ (re?frak-tom´e-ter) 1. an instrument for measuring the refractive power of the eye. 2. (Leica TS 400 Refractometer; Leica Microsystems Inc., Buffalo, NY, USA) to compensate for variation in dilution. Determination of selenium in blood. Selenium in whole blood was analyzed at a commercial laboratory (Analytica AB, Lule[Angstrom angstrom (ăng`strəm), abbr. Å, unit of length equal to 10−10 meter (0.0000000001 meter); it is used to measure the wavelengths of visible light and of other forms of electromagnetic radiation, such as ultraviolet ], Sweden) with an inductively coupled plasma sector field mass spectrometer (ELEMENT, ThermoElectron ther·mo·e·lec·tron n. An electron emitted by a material at high temperatures. ; Finnigan MAT, Bremen, Germany) monitoring m/z 78 in high-resolution mode (delta m/m = 11,000). Samples were prepared by 25-fold dilution with ammonia:Triton X:EDTA EDTA: see chelating agents. :ethanol mixture (2%:0.0005%:0.0005%:4%) with addition of arsenic at 10 ng/mL for internal standardization. Calibration was performed externally with matrix-matched standards. Accuracy and Abbreviations: F, forward; R, reverse; Temp, temperature, precision of the method were controlled by analysis of a commercial reference material (Seronorm SN ok0336; SERO SERO Southeast Regional Office SERO Sekundaerrohstoffe (recycling, former GDR) SERO Syringe Exchange Resources Online SERO System Engineering/Engineer Release Order SERO Site Emergency Response Organisation (nuclear) AS, Billingstad, Norway). Genotyping. DNA DNA: see nucleic acid. DNA or deoxyribonucleic acid One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes. was isolated from blood samples from both cases and controls using Qiagen mini-preparation kits (Qiagen GmbH, Hilden, Germany) and genotyped for single nucleotide polymorphisms (SNPs) in the following genes: MTHFR (Unigene accession no. Hs.214142; National Center for Biotechnology Information The National Center for Biotechnology Information (NCBI) is part of the United States National Library of Medicine (NLM), a branch of the National Institutes of Health. The NCBI is located in Bethesda, Maryland and was founded in 1988. 2007), GSTO1 (Hs.190028), and AS3MT (Hs.34492). The SNPs selected for the analysis were nonsynonymous with a minor allele frequency of at least 10%. We performed genotyping using the 5' nuclease nuclease /nu·cle·ase/ (noo´kle-as) any of a group of enzymes that split nucleic acids into nucleotides and other products. nu·cle·ase n. allelic al·lele n. One member of a pair or series of genes that occupy a specific position on a specific chromosome. [German Allel, short for Allelomorph, allelomorph, from English discrimination assay (TaqMan) in 96-well format, as described previously (Thirumaran et al. 2006). TaqMan primers and probes were purchased from Applied Biosystems (Foster City, CA, USA) as "Assays-by-Design." Primer and probe sequences used for genotyping are shown in Table 1. Polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is (PCR PCR polymerase chain reaction. PCR abbr. polymerase chain reaction Polymerase chain reaction (PCR) ) was performed in a 5-10 [micro]L volume reaction using 5 ng DNA as template, premade master mix, and 0.5??probe-primer mix. The initial temperature conditions for PCR were set at 50[degrees]C for 2 min and 95[degrees]C for 10 min, followed by 35-40 cycles at 92[degrees]C for 15 sec and 60[degrees]C for 1 min. Genotyping on amplified PCR products was scored by differences in fluorescent levels of VIC VIC Victor VIC Victoria (State of Australia) VIC Victory VIC Victim (police slang) VIC Vicinity VIC Vicar VIC Vicarage VIC Virtual Information Center (APAN) and FAM FAM 5-FU, adriamycin/doxorubicin, mitomycin C Oncology A chemotherapeutic regimen used with varying degrees of failure for advanced gastric CA. See Stomach cancer. (both from Applied Biosystems) in plates read on an ABI Abi (ā`bī) [short for Abijah], in the Bible, King Hezekiah's mother. (Application Binary Interface) A specification for a specific hardware platform combined with the operating system. PRISM 7900HT sequence detection system using SDS 1. (company) SDS - Scientific Data Systems. 2. (tool) SDS - Schema Definition Set. 1.2 software (Applied Biosystems). Postoperation data were transferred as Microsoft Excel data (Microsoft Corporation, Redmond, WA, USA) and converted into genotype information.
Table 1. Primers and probes used for SNP genotyping, including primer sequences,
annealing temperatures, and fragment sizes of the amplified products used for
PCR amplification and direct DNA sequencing.
Gene Primers (5'[right arrow]3')
MTHFR A222V (C[right arrow]T) F: GCACTTGAAGGAGAAGGTGTCT
R: CCTCAAAGAAAAGCTGCGTGATG
MTHFR E429A (A[right arrow]C) F: GGAGGAGCTGCTGAAGATGTG
R: TGGTTCTCCCGAGAGGTAAAGA
GSTO1 A140D (C[right arrow]A) F: GCCATCCTTGGTAGGAAGCTTTATT
R: TCGTTTACTCTGATGATAGCTAGGAGAAA
AS3MT M287T (T[right arrow]C) F: AATGGAGGAATTACAGGACATGAAAAAGA
R: AGAAAGAATACCAGAAGTCATGGAAATTGT
Gene Probes (5'[right arrow]3')
MTHFR A222V (C[right arrow]T) VIC: ATGAAATCGGCTCCCGC
FAM: ATGAAATCGACTCCCG
MTHFR E429A (A?right arrow]C) VIC: ACCAGTGAAGAAAGTGT
FAM: CAGTGAAGCAAGTGT
GSTO1 A140D (C?right arrow]A) VIC: AGAAGACTATGCTGGCCTA
FAM: TAAAGAAGACTATGATGGCCTA
AS3MT M287T (T?right arrow]C) VIC: ATTGGCATCAAACGTTAGT
FAM' TGGCATCAAACATTAGT
Gene Primer sequence
MTHFR A222V (C?right arrow]T) F: 5'-GAGGCTGACCTGAAGCACTTG-3'
R' 5'-GTGGGGTGGAGGGAGCTTAT-3'
MTHFR E429A (A?right arrow]C) F: 5'-ATTCCTCTTCCCCTGCCTTTG-3'
R' 5'-TCCCCACTCCAGCATCACTC-3'
GSTO1 A140D (C?right arrow]A) F' 5'-GGGGGCCGATACAGTTAGC-3'
R' 5'-AGCAAGCCCATGACAAAGTCT-3'
AS3MT M287T (T?right arrow]C) F: 5'-GAGTGCTGGAGATGAACCGTGA-3'
R' 5'-GGGCAAGAGCAGAAAGAATACCAGA-3'
Gene Temp ([degrees]C) Size (bp)
MTHFR A222V (C?right arrow]T) 60 200
MTHFR E429A (A?right arrow]C) 59 98
GSTO1 A140D (C?right arrow]A) 55 379
AS3MT M287T (T?right arrow]C) 56 231
Direct DNA sequencing. We randomly verified 4% of genotyping results from allelic discrimination assays by direct DNA sequencing. The sequencing reactions were performed using the BigDyeR Terminator Cycle sequencing kit (Applied Biosystems) in a 10-mL volume containing PCR product pretreated with ExoSapIT (Amersham Biosciences, Uppsala, Sweden) and a sequencing primer (Table 1). The temperature conditions set for sequencing reactions were 96[degrees]C for 2 min followed by 27 cycles at 96[degrees]C for 30 sec, 54[degrees]C for 10 sec, and 60[degrees]C for 4 min. Sequencing reaction products were precipitated with 2-propanol, washed with 75% ethanol, resuspended in 25 mL water, and loaded onto an ABI Prism 3100 Genetic Analyzer (Applied Biosystems). Primary sequencing data were analyzed using a sequence analysis program (Applied Biosystems). Statistical analyses. To evaluate whether selection in favor of a specific genotype had occurred, we assessed the Hardy-Wienberg equilibrium using allele frequencies. Statistica 7.1 for Windows (StatSoft Inc., Tulsa, OK, USA) was used to perform the statistical analyses. In the multivariate analyses using linear regression Linear regression A statistical technique for fitting a straight line to a set of data points. , the variables were natural log (ln)-transformed as needed as needed prn. See prn order. to meet the requirement of equal variance and normal distribution of residuals. We used Spearman spear·man n. A man, especially a soldier, armed with a spear. correlation ([r.sub.s]) when testing for univariate associations between continuous variables. Nonparametric tests (Mann-Whitney U-test and Kruskal-Wallis test) were used in testing for univariate differences between groups. We used one-way analysis of variance when testing for univariate differences between genotypes and Pearson chi-square when testing for differences between categorical variables. The multiple regression Multiple regression The estimated relationship between a dependent variable and more than one explanatory variable. models, including all individuals, included variables that were significantly associated with any of the relative proportions of arsenic metabolites in the univariate tests. The multiple regression models stratified stratified /strat·i·fied/ (strat´i-fid) formed or arranged in layers. strat·i·fied adj. Arranged in the form of layers or strata. by sex included the variables that were significantly associated with any of the proportions of arsenic metabolites in the multiple regression models, including all individuals. Tests for collinearity collinearity very high correlation between variables. were performed using tolerance. We included BMI in the models instead of body surface area (BSA 1. BSA - Business Software Alliance. 2. BSA - Bidouilleurs Sans Argent. ) because BMI gave a higher coefficient of determination Coefficient of determination A measure of the goodness of fit of the relationship between the dependent and independent variables in a regression analysis; for instance, the percentage of variation in the return of an asset explained by the market portfolio return. Also known as R-square. ([R.sub.2]) compared with BSA. When testing for differences in subgroups (except sex), we used analysis of covariance Covariance A measure of the degree to which returns on two risky assets move in tandem. A positive covariance means that asset returns move together. A negative covariance means returns vary inversely. with dichotomized independent variables [age, above a mean of 60 years or < 60 years; BMI, > 25 kg/[m.sup.2] and < 25 kg/[m.sup.2], the limit of overweight defined by the WHO (2000)] adjusted for continuous covariates that were significant in the multiple regression analyses that included all individuals. We generally used p < 0.05 to indicate statistical significance, except p < 0.10 was used for some interactions. Results Descriptive. The characteristics of the participants are shown in Table 2. A total of 225 males and 190 females, 60 years of age on average, were included in the study. Twenty percent were current smokers (26% of the men and 14% of the women; p < 0.001). The current smokers were younger (mean age, 53 years) than ex-smokers and nonsmokers (mean age, 62 years and 65 years, respectively; p < 0.001). Of the participants, 83% had consumed any kind of alcohol (95% of the men and 70% of the women; p < 0.001). The average BMI and BSA were 27 kg/[m.sup.2] and 1.9 [m.sup.2], respectively. We found a positive correlation between selenium in whole blood and urinary arsenic (p < 0.001). The main reason for this correlation was that the individuals from Hungary had both higher urinary arsenic concentrations and higher blood selenium concentrations than individuals form Romania and Slovakia. Among the Hungarians, Romanians, or Slovakians, analyzed separately, we found no association between arsenic and selenium concentrations. The average proportions of iAs (%iAs), MA (%MA), and DMA (%DMA) in urine were 8.3%, 17%, and 73%, respectively (Table 2). However, there were wide variations. We were able to detect traces of MA(III) in only two samples (0.23 and 0.25 [micro]g/L, respectively) corresponding to 0.89 and 6.6% of the total arsenic metabolites. The allele allele (əlēl`): see genetics. allele Any one of two or more alternative forms of a gene that may occur alternatively at a given site on a chromosome. and genotype frequencies for the A222V (C[right arrow]T) MTHFR, E429A (A[right arrow]C) MTHFR, A140D (C[right arrow]A) GSTO1, and M287T (T[right arrow]C) AS3MT polymorphisms are shown in Table 2. The genotype distributions for all polymorphisms were in accordance with the Hardy-Weinberg distribution. Only three individuals were homozygous ho·mo·zy·gous adj. Having the same alleles at one or more gene loci on homologous chromosome segments. Homozygous Identical genes controlling a specified inherited trait. for the variant allele in the AS3MT gene and were therefore combined with the heterozygotes for further analyses. Genotype distributions were not associated with sex or country.
Table 2. Participant characteristics, data on exposure, proportions
of urinary arsenic species and genotype frequencies.
No. Percent Median 10-90th
percentile
Sex (male/female) 415 54/46
Smoking 415 48/31/20
(never/former/current)
Alcohol use (yes/no) 412 83/17
BMI
(normal/overweight/obese) 414 35/40/25 27 21-34
(a)
BSA (b) 414 1.9 1.6-2.1
Age (years) 415 61 44-75
Urinary arsenic (c) 415 8.0 2.7-38
([mu]g/L)
%DMA 415 73 59-86
%MA 415 17 8.2-27
%iAs 415 8.3 2.4-19
Selenium in blood ([mu]g/L) 377 99 74-126
MTHFR A222V (C[right
arrow]T)
CC 181 44
CT 190 46
TT 43 10
MTHFR E429A (A[right
arrow]C)
AA 176 43
AC 186 45
CC 52 13
GST01 A140D (C[right
arrow]A)
CC 182 44
CA 190 46
AA 42 10
As3MT M287T (T[right
arrow]C)
TT 324 79
TC 84 20
CC 3 1
(a) Calculated as body weight (kg)/height (m)2; normal,
18.5-25 kg/[m.sup.2]; overweight, 25-30 kg/m2; obese, >
30 kg/[m.sup.2]. (b) Calculated as body weight
(kg)0.425 x height (cm)0.725 x?0.007184
(DuBois and DuBois 1916). (c) Sum of iAs, MA, and DMA in urine.
Univariate analyses. Men had higher %iAs (p = 0.04) and %MA (p = 0.003), and lower %DMA (p = 0.008) than women. BMI was negatively associated with %MA (p = 0.001) and positively associated with %DMA (p = 0.003), but it was not associated with %iAs. Blood selenium was positively associated with %MA (p < 0.001) and negatively associated with %DMA (p = 0.007), but not with %iAs. Individuals homozygous for the variant allele for the A222V (C[right arrow]T) MTHFR polymorphisms had lower %DMA (p = 0.002) and higher %MA than individuals homozygous for the wild-type allele (p = 0.01; Figure 2). Individuals heterozygous het·er·o·zy·gous adj. 1. Having different alleles at one or more corresponding chromosomal loci. 2. Of or relating to a heterozygote. and homozygous for the variant allele in the M287T (T[right arrow]C) AS3MT polymorphism had lower %DMA (p = 0.003) and higher %MA (p < 0.001; Figure 2). The concentration of total urinary arsenic, smoking, or alcohol use were not associated with %iAs, %MA, or %DMA. Multivariate analyses. We designed one model for each arsenic metabolite. Table 3 shows the results of the multiple regression analyses to test whether the distributions of urinary arsenic metabolites were dependent on sex, age, BMI, selenium, and gene polymorphisms in MTHFR, GSTO1, and AS3MT. Similar to the univariate assessment, %DMA was associated with polymorphisms in AS3MT and MTHFR genes, selenium, BMI, and sex in decreasing order. The %MA was associated with a gene polymorphism in AS3MT, selenium, BMI, sex, and a gene polymorphism in MTHFR in decreasing order. However, for %iAs the multivariate analyses showed only an association with sex and an almost significant association with a polymorphism in the MTHFR gene. For %MA, we found a significant interaction between BMI (two categories: > 25 kg/[m.sup.2] and below < 25 kg/[m.sup.2]) and selenium (two categories: above the median of 99 [micro]g/L and > 99 [micro]g/L; p = 0.06). Also, the corresponding interaction for %DMA was near significance (p = 0.10).
Table 3. Multiple regression analyses to test whether %DMA, %MA,
and %iAs are dependent on sex, age, BMI, selenium, and some polymorphisms.
Sex (a) Age (years)
%DMA B (b) 2.7 * 0.021
No. = 374; [R.sup.2] = 0.10 Beta (c) 0.12 * 0.021
%MA B -2.2 ** 0.036
No. = 374; [R.sup.2] = 0.15 Beta -0.14 ** 0.051
ln %iAs B -0.15 * -0.0053
No. = 347; [R.sup.2] = 0.02 Beta -0.11 * -0.094
BMI (kg/[m.sup.2]) Selenium ([mu]g/L)
%DMA 0.36 ** -0.082 **
No. = 374; [R.sup.2] = 0.10 0.15 ** -0.15 **
%MA -0.27 ** 0.080 **
No. = 374; [R.sup.2] = 0.15 -0.16 ** 0.21 **
ln %iAs -0.011 -0.000081
No. = 347; [R.sup.2] = 0.02 -0.083 -0.0027
MTHFR (CT vs. CC) MTHFR (TT vs. CC)
%DMA -0.57 -5.8 **
No. = 374; [R.sup.2] = 0.10 -0.025 -0.16 **
%MA 1.3 3.4 *
No. = 374; [R.sup.2] = 0.15 0.079 0.13 *
ln %iAs -0.017 0.20
No. = 347; [R.sup.2] = 0.02 -0.013 0.10 (p = 0.08)
GSTO1 (CA vs. CC) GSTO1 (AA vs. CC)
%DMA -0.23 2.4
No. = 374; [R.sup.2] = 0.10 -0.010 0.063
%MA 0.061 -1.9
No. = 374; [R.sup.2] = 0.15 0.0037 -0.071
ln %iAs -0.0075 0.012
No. = 347; [R.sup.2] = 0.02 -0.0058 0.0057
As3MT (TC and CC vs. TT)
%DMA -4.7 **
No. = 374; [R.sup.2] = 0.10 -0.17 **
%MA 4.7 **
No. = 374; [R.sup.2] = 0.15 0.23 **
ln %iAs 0.061
No. = 347; [R.sup.2] = 0.02 0.038
(a) Male = 0; female = 1. (b) Unstandardized regression coefficient.
(c) Standardized regression coefficient. * p [IT] 0.05. ** p < 0.01.
To better understand the difference in methylation capacity between males and females, we repeated the multiple regression analyses stratified by sex (Table 4). The sex-specific models show that selenium, BMI, and AS3MT polymorphisms affect the distribution of urinary arsenic metabolites in males, but not in females. Also, in males, mutation in one allele in the MTHFR gene altered the pattern of urinary arsenic metabolites; however, for females, mutations of both alleles were required. Furthermore, to test whether the sex difference in methylation capacity was dependent on age or BMI, we used analysis of covariance. In those < 60 years of age, males had a higher %MA than females, but this was not the case for those > 60 years of age (Figure 3A). Furthermore, men of normal weight had a higher %MA than overweight or obese women (Figure 3B).
Table 4. Multiple regression analyses separated by sex to test whether
%DMA, %MA, and %iAs are dependent on sex, BMI, selenium, and some
polymorphisms. (a)
No. [R.sup.2] Age (b) BMI (c) Selenium ([mu]g/L)
% DMA
Females 170 0.04 -0.015 0.072 -0.11
Males 204 0.12 0.094 0.13 * -0.17 **
% MA
Females 170 0.04 0.12 -0.019 0.12
Males 204 0.20 -0.039 -0.15 ** 0.27**
ln %iAs
Females 158 0.008 -0.038 -0.098 0.046
Males 189 0.009 -0.14 * -0.10 -0.055
MTHFR (CT vs. CC) MTHFR (TT vs. CC)
% DMA
Females 0.098 -0.20 **
Males -0.13 * -0.14 *
% MA
Females -0.049 0.14 *
Males 0.17 ** 0.11 *
ln
Females -0.049 0.17 **
Males 0.037 0.070
AS3MT (TC and CC vs. TT)
%DMA
Females -0.065
Males -0.25**
%MA
Females 0.15*
Males 0.30**
ln
Females 0.0070
Males 0.082
(a) Standardized regression coefficients ([beta]).
(b) For age < 60 years, 0; for age ? < ?60 years, 1.
(c) For BMI < 25 kg/[m.sup.2], 0; for BMI ? < ?25 kg/[m.sup.2], 1.
* p < 0.10. ** p < 0.05.
Discussion The results of the present study show that the M287T (T[right arrow]C) polymorphism in the AS3MT gene, the A222V (C[right arrow]T) polymorphism in the MTHFR gene, BMI, and sex are major factors that influence arsenic metabolism in this Central European population. This is the first study to our knowledge to elucidate factors influencing the metabolism of iAs at these low concentrations, where the influence of arsenic exposure on the methylation reactions is negligible. It is also the first to study arsenic-related polymorphisms in Europe. We found the allele frequencies to be in accordance with those in other Caucasian populations, but different from those in several other populations (PharmGKB 2007a, 2007b, 2007c, 2007d). In contrast to our finding that carriers of the variant allele of the M287T (Cright arrow]T) polymorphism of the AS3MT gene had higher %MA, previous studies in Mexico (Meza et al. 2005) and Argentina (Schlawicke Engstrom et al. 2006) have shown other SNPs in AS3MT gene to be associated with lower %MA. However, we did not find those SNPs in the present study. Thus, different SNPs in this gene influence the metabolism of iAs in different directions. It is unlikely that AS3MT is the only methyltransferase that methylates arsenic, given that there are around 100 different methyltransferases identified in the human body (Martin and McMillan 2002). This is supported by a recent in vitro in vitro /in vi·tro/ (in ve´tro) [L.] within a glass; observable in a test tube; in an artificial environment. in vi·tro adj. In an artificial environment outside a living organism. study in which the %DMA was reduced from 53% in the normal cell line to 11% in the cell line with silenced AS3MT expression (Drobna et al. 2006). Interestingly, we found that the M287T (C[right arrow]T) polymorphism in AS3MT was not as important in women as it was in men, who also had higher %MA than women. Also, the A222V (C[right arrow]T) polymorphism in the MTHFR gene was associated with higher %MA. MTHFR reduces methylenetetrahydrofolate to methyltetrahydrofolate, which regenerates methionine methionine (mĕthī`ənēn), organic compound, one of the 20 amino acids commonly found in animal proteins. Only the L-stereoisomer appears in mammalian protein. from homocysteine Homocysteine Definition Homocysteine is a naturally occurring amino acid found in blood plasma. High levels of homocysteine in the blood are believed to increase the chance of heart disease, stroke, Alzheimer's disease, and osteoporosis. in the one-carbon metabolism with methylated vitamin [B.sub.12] as co-factor (Figure 1). The A222V (C[right arrow]T) polymorphism has been associated with reduced enzyme activity Enzyme activity A measure of the ability of an enzyme to catalyze a specific reaction. Mentioned in: Glucose-6-Phosphate Dehydrogenase Deficiency and elevated levels of homocysteine (Baum et al. 2004), which in turn could lead to lower SAM-dependent methylation via feedback inhibition feedback inhibition Suppression of the activity of an enzyme by a product of the sequence of reactions in which the enzyme is participating. When the product accumulates in a cell beyond an optimal amount, it decreases its own production by inhibiting an enzyme involved in , possibly explaining our results. An interesting finding in the present study was that mutation on only one allele was needed to alter the arsenic metabolite pattern in males, whereas females needed mutations on both alleles. This discrepancy could be because females have a generally higher rate of remethylation of methionine from homocysteine than do males (Fukagawa et al. 2000). Furthermore, the influence of the A222V polymorphism on the metabolite pattern was more pronounced in individuals > 60 years of age (data not shown). The elderly are known to have poorer nutrition, especially lower vitamin B vitamin B n. 1. Vitamin B complex. 2. A member of the vitamin B complex, especially thiamine. vitamin B, vitamin B complex a group of water-soluble substances described separately. 12 levels, than younger people (Martin 2006), which could make them more susceptible to the reduced enzyme activity that might result from the polymorphism. Marnell et al. (2003) observed that two individuals with an uncommon genotype of GSTO1 had an altered distribution of iAs metabolites in urine. However, studies with GSTO1 knockout mice showed that they still reduced arsenic(V) species, but to a lesser extent (~ 20% of that found in wild-type mice) (Chowdhury et al. 2006). This animal study supports our finding that polymorphisms in GSTO1 are not associated with an altered arsenic metabolite pattern, indicating nonenzymatic reduction and/or the presence of alternative enzymes for these reduction reactions. Several studies have shown associations between malnourishment mal·nour·ish·ment n. Malnutrition. and increased risk for different arsenic induced health effects, partly due to less antioxidant antioxidant, substance that prevents or slows the breakdown of another substance by oxygen. Synthetic and natural antioxidants are used to slow the deterioration of gasoline and rubber, and such antioxidants as vitamin C (ascorbic acid), butylated hydroxytoluene defense and partly due to alterations in the metabolism of arsenic (Gamble et al. 2005; Milton et al. 2004; Mitra et al. 2004; Steinmaus et al. 2005). In the present study, we observed an increase in %DMA and a decrease in %MA and %iAs with increasing BMI. However, this association was probably not due to nutritional factors because most individuals were overweight (median BMI, 27 kg/[m.sup.2]). The BMIrelated difference in methylation was mainly between normal-weight men and overweight and obese women, and we found a difference between the sexes in arsenic methylation only in individuals < 60 years of age; therefore, the results may suggest that sex steroids influence the methylation of arsenic. Estrogen is produced in adipose tissue in both males and females, leading to higher levels of estrogen in overweight individuals (Nelson and Bulun 2001). Furthermore, sex hormone-binding globulin globulin, any of a large family of proteins of a spherical or globular shape that are widely distributed throughout the plant and animal kingdoms. Many of them have been prepared in pure crystalline form. is reduced with increasing body weight, leading to the release of free estrogen and progesterone progesterone (prōjĕs`tərōn'), female sex hormone that induces secretory changes in the lining of the uterus essential for successful implantation of a fertilized egg. (Pugeat et al. 1995). However, more studies are needed on differences between the sexes and the influence of sex steroids on the metabolism of arsenic. Our hypothesis was that selenium would increase the methylation capacity, as shown in previous reports (Christian et al. 2006; Hsueh et al. 2003). However, the present study indicated the opposite association with selenium. When further evaluation of the interaction between selenium and BMI was performed, it appeared that Romanians and Slovakians had lower blood selenium but higher fractions of methylated metabolites of arsenic in urine compared with the Hungarians. Therefore, the association between %DMA or %MA and selenium was probably not a causal association, but rather an effect of, for example, different food habits in the different countries. The selenium concentrations (mean [+ or -] SD, 100 [+ or -] 22 [micro]g/L) do not indicate deficiency, and the concentrations were in the same range as reported in several other European populations (Batariova et al. 2005; Van Cauwenbergh et al. 1990). We were not able to confirm previous findings that smoking and alcohol consumption negatively influence the metabolism of iAs (Hopenhayn-Rich et al. 1996; Hsueh et al. 2003). However, this was probably because of the low arsenic exposure in the present study. Because previous reports have shown the presence of appreciable amounts of MA(III) in human urine and have claimed that improper sampling and storage conditions are likely reasons for the absence of MA(III) in urine (Feldmann et al. 1999), we also analyzed urine samples from patients treated with high levels of arsenic trioxide [30 mg arsenic/week (unpublished data)]. Spot urine samples were collected from four plasmacytoma patients both before and after treatment and immediately frozen in liquid nitrogen until analysis (~ 3 days after collection). A trace amount of MA(III), too low to be quantifiable, was found in one patient. The results of the present study indicate that MA(III) is not a significant metabolite in human urine, in contrast to previous reports (Aposhian et al. 2000; Le et al. 2000; Mandal et al. 2001; Valenzuela et al. 2005). Our interpretation is that the high reactivity renders them to bind in tissue (Vahter 2002). In conclusion, the present study shows that polymorphisms in genes coding for enzymes involved in the metabolism of iAs explains a part of the large interindividual variation seen in the metabolism of iAs, especially in males, although not as much as we hypothesized. Other methyltransferases are probably backing up the methylation of arsenic. Genes coding for enzymes involved in the metabolism of iAs, as well as the influence of polymorphisms in these genes on metabolism, have only recently been investigated in epidemiologic studies. More large-scale studies are needed for complete understanding of arsenic metabolism. REFERENCES Aposhian HV, Zheng B, Aposhian MM, Le XC, Cebrian ME, Cullen W, et al. 2000. DMPS-arsenic challenge test. II. Modulation of arsenic species, including monomethylarsonous acid (MMAIII), excreted in human urine. Toxicol Appl Pharmacol 165:74-83. Batariova A, Cerna M, Spevackova V, Cejchanova M, Benes B, Smid J. 2005. Whole blood selenium content in healthy adults in the Czech Republic. Sci Total Environ 338:183-188. Baum L, Wong KS, Ng HK, Tomlinson B, Rainer TH, Chan DK, et al. 2004. Methylenetetrahydrofolate reductase gene A222V polymorphism and risk of ischemic stroke. Clin Chem Lab Med 42:1370-1376. Chen YC, Guo YL, Su HJ, Hsueh YM, Smith TJ, Ryan LM, et al. 2003a. Arsenic methylation and skin cancer risk in southwestern Taiwan. J Occup Environ Med 45:241-248. Chen YC, Su HJ, Guo YL Houseman EA, Christiani DC. 2005. Interaction between environmental tobacco smoke environmental tobacco smoke (ETS/passive smoke), n the gaseous by-product of burning tobacco products, including but not limited to commercially manufactured cigarettes and cigars; contains toxic elements harmful to the health of adults and children and arsenic methylation ability on the risk of bladder cancer. Cancer Causes Control 16:75-81. Chen YC, Su HJ, Guo YL, Hsueh YM, Smith TJ, Ryan LM, et al. 2003b. Arsenic methylation and bladder cancer risk in Taiwan. Cancer Causes Control 14:303-310. Chowdhury UK, Zakharyan RA, Hernandez A, Avram MD, Kopplin MJ, Aposhian HV. 2006. Glutathione-S-transferase-omega [MMA (Microcomputer Managers Association, Inc.) A membership organization with chapters throughout the U.S. that was devoted to educating personnel responsible for personal computers. It disbanded in 1996. Mma - A fast Mathematica-like system, in Allegro CL by R. Fateman, 1991. (V) reductase reductase /re·duc·tase/ (-tas) a term used in the names of some of the oxidoreductases, usually specifically those catalyzing reactions important solely for reduction of a metabolite. ] knockout mice: enzyme and arsenic species concentrations in tissues after arsenate administration. Toxicol Appl Pharmacol 216:446-457. Christian WJ, Hopenhayn C, Centeno JA, Todorov T. 2006. Distribution of urinary selenium and arsenic among pregnant women exposed to arsenic in drinking water. Environ Res 100:115-122. Delnomdedieu M, Basti MM, Otvos JD, Thomas DJ. 1994a. Reduction and binding of arsenate and dimethylarsinate by glutathione glutathione: see coenzyme. : a magnetic resonance study. Chem Biol Interact 90:139-155. Delnomdedieu M, Basti MM, Styblo M, Otvos JD, Thomas DJ. 1994b. Complexation of arsenic species in rabbit erythrocytes Erythrocytes Red blood cells. Mentioned in: Bartonellosis erythrocytes (ē·rithˑ·rō·sīts), n.pl red blood cells. . Chem Res Toxicol 7:621-627. Del Razo LM, Garcia-Vargas GG, Vargas H, Albores A, Gonsebatt ME, Montero R, et al. 1997. Altered profile of urinary arsenic metabolites in adults with chronic arsenicism. A pilot study. Arch Toxicol 71:211-217. Drobna Z, Xing W, Thomas DJ, Styblo M. 2006. shRNA silencing of AS3MT expression minimizes arsenic methylation capacity of HepG2 cells. Chem Res Toxicol 19:894-898. DuBois D, DuBois EF. 1916. A formula to estimate the approximate surface area if height and weight be known. Arch Intern Med 17:863-871. Feldmann J, Lai VWM VWM Visual Working Memory VWM Vineyard and Winery Management (magazine) VWM Leukoencephalopathy with Vanishing White Matter VWM Valley West Mall VWM Virtual Warehouse Manager VWM Vesa Wall Mount VWM Virtual Window Manager , Cullen WR, Ma M, Lu X, Le XC. 1999. Sample preparation and storage can change arsenic speciation in human urine. Clin Chem 45:1988-1997. Fukagawa NK, Martin JM, Wurthmann A, Prue, AH Ebenstein D, O'Rourke B. 2000. Sex-related differences in methionine metabolism and plasma homocysteine concentrations. Am J Clin Nutr 72:22-29. Gamble MV, Liu X, Ahsan H, Pilsner R, Ilievski V, Slavkovich V, et al. 2005. Folate folate /fo·late/ (fo´lat) 1. the anionic form of folic acid. 2. more generally, any of a group of substances containing a form of pteroic acid conjugated with l-glutamic acid and having a variety of substitutions. , homocysteine, and arsenic metabolism in arsenic-exposed individuals in Bangladesh. Environ Health Perspect 113:1683-1688. Hayakawa T, Kobayashi Y, Cui X, Hirano S. 2005. A new metabolic pathway of arsenite: arsenic-glutathione complexes are substrates for human arsenic methyltransferase Cyt19. Arch Toxicol 79:183-191. Hopenhayn-Rich C, Biggs ML, Smith AH, Kalman DA, Moore LE. 1996. Methylation study of a population environmentally exposed to arsenic in drinking water. Environ Health Perspect 104:620-628. Hsueh YM, Chiou HY, Huang YL, Wu WL, Huang CC, Yang MH, et al. 1997. Serum beta-carotene level, arsenic methylation capability, and incidence of skin cancer. Cancer Epidemiol Biomarkers Prev 6:589-596. Hsueh YM, Ko YF, Huang YK, Chen HW, Chiou HY, Huang YL, et al. 2003. Determinants of inorganic arsenic methylation capability among residents of the Lanyang Basin, Taiwan: arsenic and selenium exposure and alcohol consumption. Toxicol Lett 137:49-63. Hughes MF, Kenyon EM. 1998. Dose-dependent effects on the disposition of monomethylarsonic acid and dimethylarsinic acid in the mouse after intravenous administration. J Toxicol Environ Health A 53:95-112. Internal Agency for Research on Cancer. 2004. Some Drinking-Water Disinfectants and Contaminants, including Arsenic. IARC Monogr Eval Carcinog Risk Hum 84:1-512. Kligerman AD, Tennant A. 2006. Insights into the carcinogenic carcinogenic having a capacity for carcinogenesis. mode of action of arsenic. Toxicol Appl Pharmacol doi:10.1016/j.taap.2006.10.006 [Online 13 October 2006]. Le XC, Ma M, Cullen WR, Aposhian HV, Lu X, Zheng B. 2000. Determination of monomethylarsonous acid, a key arsenic methylation intermediate, in human urine. Environ Health Perspect 108:1015-1018. Lin S, Shi Q, Nix FB, Styblo M, Beck MA, Herbin-Davis KM, et al. 2002. A novel S-adenosyl-L-methionine:arsenic(III) methyltransferase from rat liver cytosol cytosol /cy·to·sol/ (sit´ah-sol) the liquid medium of the cytoplasm, i.e., cytoplasm minus organelles and nonmembranous insoluble components.cytosol´ic cy·to·sol n. . J Biol Chem 277:10795-10803. Lindberg AL, Goessler W, Gurzau E, Koppova K, Rudnai P, Kumar R, et al. 2006. Arsenic exposure in Hungary, Romania and Slovakia. J Environ Monit 8:203-208. Maki-Paakkanen J, Kurttio P, Paldy A, Pekkanen J. 1998. Association between the clastogenic effect in peripheral lymphocytes and human exposure to arsenic through drinking water. Environ Mol Mutagen mutagen: see mutation. mutagen Any agent capable of altering a cell's genetic makeup by changing the structure of the hereditary material, DNA. Many forms of electromagnetic radiation (e.g. 32:301-313. Mandal BK, Ogra Y, Suzuki KT. 2001. Identification of dimethylarsinous and monomethylarsonous acids in human urine of the arsenic-affected areas in West Bengal, India. Chem Res Toxicol 14:371-378. Marnell LL, Garcia-Vargas GG, Chowdhury UK, Zakharyan RA, Walsh B, Avram MD, et al. 2003. Polymorphisms in the human monomethylarsonic acid (MMAV) reductase/hGSTO1 gene and changes in urinary arsenic profiles. Chem Res Toxicol 16:1507-1513. Martin CM. 2006. Vitamins for the elderly: from A to zinc. Consult Pharm 21:450-64. Martin JL, McMillan FM. 2002. SAM (dependent) I AM: the S-adenosylmethionine-dependent methyltransferase fold. Curr Opin Struct Biol 12:783-793. Meza MM, Yu L, Rodriguez YY, Guild M, Thompson D, Gandolf AJ, et al. 2005. Developmentally restricted genetic determinants of human arsenic metabolism: association between urinary methylated arsenic and CYT19 polymorphisms in children. Environ Health Perspect 113:775-781. Milton AH, Hasan Z, Shahidullah SM, Sharmin S, Jakariya MD, Rahman M, et al. 2004. Association between nutritional status and arsenicosis due to chronic arsenic exposure in Bangladesh. Int J Environ Health Res 14:99-108. Mitra SR, Mazumder DN, Basu A, Block G, Haque R, Samanta S, et al. 2004. Nutritional factors and susceptibility to arsenic-caused skin lesions in West Bengal, India. Environ Health Perspect 112:1104-1109. Naranmandura H, Suzuki N, Suzuki KT. 2006. Trivalent arsenicals are bound to proteins during reductive re·duc·tive adj. 1. Of or relating to reduction. 2. Relating to, being an instance of, or exhibiting reductionism. 3. Relating to or being an instance of reductivism. methylation. Chem Res Toxicol 19:1010-1018. National Center for Biotechnology Information. 2007. Unigene. Available: http://www.ncbi.nlm.nih.gov/entrez/query. fcgi?db=unigene [accessed 27 February 2007]. National Research Council. 2001. Arsenic in Drinking Water, 2001 Update. Washington DC:National Academy Press. Nelson LR, Bulun SE. 2001. Estrogen production and action. J Am Acad Dermatol 45:S116-124. Petrick JS, Ayala-Fierro F, Cullen WR, Carter DE, Aposhian HV. 2000. Monomethylarsonous acid (MMAIII) is more toxic than arsenite in Chang human hepatocytes. Toxicol Appl Pharmacol 163:203-207. PharmGKB. 2007a. Frequency of Variants at chr10:104628713 on AS3MT. Available: http://www.pharmgkb.org/views/reports/loadFrequencyInSampleSets.action?varRptId=126209365 [accessed 4 June 2007]. PharmGKB. 2007b. Frequency of Variants at chr10:106012779 on GSTO1. Available: http://www.pharmgkb.org/views/reports/loadFrequencyInSampleSets.action?varRptId=145825560 [accessed 4 June 2007]. PharmGKB. 2007c. Frequency of Variants at chr1:11790644 on MTHFR. Available: http://www.pharmgkb.org/views/reports/loadFrequencyInSampleSets.action?varRptId=127931865 [accessed 4 June 2007]. PharmGKB. 2007d. Frequency of Variants at chr1:11788742 on MTHFR. Available: http://www.pharmgkb.org/views/reports/loadFrequencyInSampleSets.action?varRptId=127932508 [accessed 4 June 2007]. Pugeat M, Moulin moulin (m lăN`): see pothole. P, Cousin P, Fimbel S, Nicolas MH, Crave JC, et
al. 1995. Interrelations between sex hormone-binding globulin (SHBG SHBG sex hormone. SHBG sex hormone-binding globulin. SHBG Sex hormone binding globulin, see there ), plasma lipoproteins Lipoproteins The packages in which cholesterol and triglycerides travel throughout the body. Mentioned in: Lipoproteins Test lipoproteins (lip´ōprō´tēns), n. and cardiovascular risk. J Steroid Biochem Mol Biol 53:567-572. Schlawicke Engstrom K, Broberg K, Concha concha /con·cha/ (kong´kah) pl. con´chae [L.] a shell-shaped structure. concha of auricle G, Nermell B, Warholm M, Vahter M. 2006. Genetic polymorphisms influencing arsenic metabolism: evidence from Argentina. Environ Health Perspect 115:599-605; doi:10.1289/ehp.9734 [Online 8 January 2007]. Schwerdtle T, Walter I, Hartwig A. 2003a. Arsenite and its biomethylated metabolites interfere with the formation and repair of stable BPDE-induced DNA adducts in human cells and impair XPAzf and Fpg. DNA Repair (Amst) 2:1449-1463. Schwerdtle T, Walter I, Mackiw I, Hartwig A. 2003b. Induction of oxidative DNA damage by arsenite and its trivalent and pentavalent pentavalent having a valence of five. pentavalent antimony compounds see antimony. pentavalent organic arsenicals includes the pharmaceuticals arsanilic acid, roxarsone, nitarsone. See also organic arsenical. methylated metabolites in cultured human cells and isolated DNA. Carcinogenesis car·ci·no·gen·e·sis n. The production of cancer. carcinogenesis production of cancer. biological carcinogenesis viruses and some parasites are capable of initiating neoplasia. 24:967-974. Scott N, Hatlelid KM, MacKenzie NE, Carter DE. 1993. Reactions of arsenic(III) and arsenic(V) species with glutathione. Chem Res Toxicol 6:102-106. Steinmaus C, Bates Bates , Katherine Lee 1859-1929. American educator and writer best known for her poem "America the Beautiful," written in 1893 and revised in 1904 and 1911. MN, Yuan Y, Kalman D, Atallah R, Rey OA, et al. 2006. Arsenic methylation and bladder cancer risk in case-control studies in Argentina and the United States. J Occup Environ Med 48:478-488. Steinmaus C, Carrigan K, Kalman D, Atallah R, Yuan Y, Smith AH. 2005. Dietary intake and arsenic methylation in a U.S. population. Environ Health Perspect 113:1153-1159. Styblo M, Del Razo LM, Vega L, Germolec DR, LeCluyse EL, Hamilton GA, et al. 2000. Comparative toxicity of trivalent and pentavalent inorganic and methylated arsenicals in rat and human cells. Arch Toxicol 74:289-299. Thirumaran RK, Bermejo JL, Rudnai P, Gurzau E, Koppova K, Goessler W, et al. 2006. Single nucleotide polymorphisms in DNA repair genes and basal cell carcinoma basal cell carcinoma n. A slow-growing, locally invasive, but rarely metastasizing neoplasm of the skin derived from basal cells of the epidermis or hair follicles. Also called basal cell epithelioma. of skin. Carcinogenesis 27:1676-1681. Vahter M. 1999. Variation in human metabolism of arsenic. In: Arsenic Exposure and Health Effects III (Chappell WR, Abernathy CO, Calderon RL, eds). Oxford, UK:Elsevier Science Ltd., 267-279. Vahter M. 2000. Genetic polymorphism in the biotransformation biotransformation /bio·trans·for·ma·tion/ (-trans?for-ma´shun) the series of chemical alterations of a compound (e.g., a drug) occurring within the body, as by enzymatic activity. of inorganic arsenic and its role in toxicity. Toxicol Lett 112-113:209-217. Vahter M. 2002. Mechanisms of arsenic biotransformation. Toxicology 181-182:211-217. Valenzuela OL, Borja-Aburto VH, Garcia-Vargas GG, Cruz-Gonzalez MB, Garcia-Montalvo EA, Calderon-Aranda ES, et al. 2005. Urinary trivalent methylated arsenic species in a population chronically exposed to inorganic arsenic. Environ Health Perspect 113:250-254. Van Cauwenbergh R, Robberecht H, Deelstra H. 1990. Selenium concentration levels in whole blood of Belgian blood bank donors, as determined by direct graphite furnace atomic absorption Graphite furnace atomic absorption spectrometry (GFAAS) (also known as Electrothermal Atomic Absorption Spectrometry (ETAAS)) is a type of spectrometry that uses a graphite-coated furnace to vaporize the sample. spectrometry. J Trace Elem Electrolytes Health Dis 4:215-224. Vega L, Styblo M, Patterson R, Cullen W, Wang C, Germolec D. 2001. Differential effects of trivalent and pentavalent arsenicals on cell proliferation and cytokine Cytokine Any of a group of soluble proteins that are released by a cell to send messages which are delivered to the same cell (autocrine), an adjacent cell (paracrine), or a distant cell (endocrine). secretion in normal human epidermal Epidermal Referring to the thin outermost layer of the skin, itself made up of several layers, that covers and protects the underlying dermis (skin). Mentioned in: Antiangiogenic Therapy, Histiocytosis X epidermal keratinocytes Keratinocytes Cells found in the epidermis. The keratinocytes at the outer surface of the epidermis are dead and form a tough protective layer. The cells underneath divide to replenish the supply. . Toxicol Appl Pharmacol 172:225-232. WHO. 2000. Obesity: Preventing and Managing the Global Epidemic. WHO Technical Report Series 894. Geneva Geneva, canton and city, Switzerland Geneva (jənē`və), Fr. Genève, canton (1990 pop. 373,019), 109 sq mi (282 sq km), SW Switzerland, surrounding the southwest tip of the Lake of Geneva. :World Health Organization. WHO. 2001. Arsenic and Arsenic Compounds. Environmental Health Criteria 224. Geneva:World Health Organization. Yu RC, Hsu KH, Chen CJ, Froines JR. 2000. Arsenic methylation capacity and skin cancer. Cancer Epidemiol Biomarkers Prev 9:1259-1262. Zakharyan RA, Sampayo-Reyes A, Healy SM, Tsaprailis G, Board PG, Liebler DC, et al. 2001. Human monomethylarsonic acid (MMAV) reductase is a member of the glutathione-Stransferase superfamily superfamily /su·per·fam·i·ly/ (soo´per-fam?i-le) 1. a taxonomic category between an order and a family. 2. . Chem Res Toxicol 14:1051-1257. (1)Institute of Environmental Medicine, Karolinska Institute, Stockholm, Sweden; (2)DKFZ DKFZ Deutsches Krebsforschungszentrum (German Cancer Research Center, Heidelberg, Germany) (German Cancer Research Centre), Heidelberg, Germany; (3)Institut fur Chemie-Analytische Chemie, Karl-Franzens-Universitat, Graz, Austria; (4)Environmental Health Centre, Cluj-Napoca, Romania; 5State Health Institute, Banska Bystrica, Slovakia; (6)'Jozef Fodor' National Centre of Public Health, Budapest, Hungary; (7)London School of Hygiene & Tropical Medicine, London, United Kingdom Anna-Lena Lindberg (1), Rajiv Kumar (2), Walter Goessler (3), Ranjit Thirumaran (2), Eugen Gurzau (4), Kvetoslava Koppova (5), Peter Rudnai (6), Giovanni Leonardi (7), Tony Fletcher (7), and Marie Vahter (1) Address correspondence to M. Vahter, Division of Metals and Health, Institute of Environmental Medicine, Karolinska Institutet, Box 210, SE-171 77, Stockholm, Sweden. Telephone: 46 8 728 75 40. Fax: 46 8 33 70 39. E-mail: Marie.Vahter@ imm.ki.se Financial support was provided by EC project QLK4-CT-2001-00264 (ASHRAM). The authors declare they have no competing financial interests. Received 21 December 2006; accepted 27 March 2007. |
|
||||||||||||||||

lăN`)
Printer friendly
Cite/link
Email
Feedback
Reader Opinion