Mastomys natalensis and Lassa fever, West Africa.PCR PCR polymerase chain reaction. PCR abbr. polymerase chain reaction Polymerase chain reaction (PCR) screening of 1,482 murid Murid (Arabic: مريد ) is a Sufi term meaning 'committed one'. It refers to a person who is committed to a teacher in the spiritual path of Sufism. It also means "willpower" or "self-esteem,". rodents from 13 genera caught in 18 different localities of Guinea, West Africa, showed Lassa virus infection only in molecularly typed Mastomys natalensis. Distribution of this rodent and relative abundance compared with M. erythroleucus correlates geographically with Lassa virus seroprevalence seroprevalence Immunology The proportion of a population that is seropositive–ie, has been exposed to a particular pathogen or immunogen; the seropositivity of a population is calculated as the number of individuals who produce a particular antibody divided in humans. ********** A renaviruses are emerging in the Americas and Africa and can cause hemorrhagic fevers with case fatalities of up to 15%. These viruses are mainly transmitted through contact with the excreta excreta /ex·cre·ta/ (eks-kret´ah) excretion (2). ex·cre·ta pl.n. Waste matter, such as sweat or feces, discharged from the body. of their natural hosts, rodents of the family Muridae. The Old World arenavirus arenavirus /are·na·vi·rus/ (ah-re´nah-vi?rus) any virus of the family Arenaviridae. Arenavirus /Are·na·vi·rus/ (ah-re´nah-vi?rus Lassa virus causes up to 300,000 cases of Lassa fever annually in endemic foci of 2 geographically disjunct dis·junct adj. 1. Characterized by separation. 2. Music Relating to progression by intervals larger than major seconds. 3. regions of West Africa (1). Most arenaviruses have been associated with 1 specific reservoir host species (2). Knowledge of the geographic distribution of the taxonomically defined host is therefore essential to understand the epidemiology of human infections. In the 1970s, the rodent host of Lassa virus was classified as Mastomys natalensis (3); later, when hemoglobin electrophoresis was used for species determination, M. erythroleucus and possibly M. huberti were also proposed as hosts (1). In addition, Lassa virus antigen was detected in Rattus and Mus genera, raising the possibility that other rodent genera could be involved in transmission (4). The taxonomy of Mastomys is considered unresolved, and species determination remains problematic; 8 distinct species are recognized, and several coexist in Lassa fever-endemic areas (5). The uncertainty about their precise natural host relationships with Lassa virus is considered a major obstacle for a better understanding of the restricted distribution of Lassa fever in West Africa (6). In this study, we molecularly typed >1,000 specimens of Mastomys spp. from Guinea with a recently established species-specific PCR (7). The rodents were then screened for Lassa virus infection with a reverse transcription--PCR (RT-PCR RT-PCR reverse transcriptase-polymerase chain reaction. See PCR1. ), which was shown to amplify Lassa virus strains from Sierra Leone, Liberia, Guinea, Cote d'Ivoire, and Nigeria, as well as the African arenaviruses Mobala and Ippy and 3 strains of the related lymphocytic choriomeningitis virus lymphocytic choriomeningitis virus n. A virus of the genus Arenavirus that is the causative agent of lymphocytic choriomeningitis. (8). The Study In a survey of rodentborne hemorrhagic fever viruses, 1,591 small mammals were trapped in Guinea from 2002 to 2005. Total RNA RNA: see nucleic acid. RNA in full ribonucleic acid One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic was extracted from rodent blood preserved in liquid nitrogen by using the Blood RNA kit (Peqlab, Erlangen, Germany). A 1-step RT-PCR targeting a highly conserved region of the RNA polymerase (L) gene was performed by using primers LVL LVL In currencies, this is the abbreviation for the Latvian Lats. Notes: The currency market, also known as the Foreign Exchange market, is the largest financial market in the world, with a daily average volume of over US $1 trillion. 3359A-plus (5'AGAATTAGTGAAAGGGAGAGCAATTC), LVL3359D-plus (5'-AGAATCAGTGAAAGGGAAAG CAATTC), LVL3359G-plus (5'-AGAATTAGTGAAAG GGAGAGTAACTC), LVL3754A-minus (5'-CACATC ATTGGTCCCCATTTACTATGATC), and LVL3754D minus (5'-CACATCATTGGTCCCCATTTACTGTGA TC) (Note: Underlined letters represent differences in nucleotides among plus and minus primers.). Because Lassa virus antigen should be frequently detectable in the natural host, and specific antibodies are known to be negatively correlated with its presence, they were not investigated in this study (9). The animals were caught in 18 different study sites representative of the principal geographic regions of Guinea Guinea is divided into 8 administrative regions which are further subdivided into 34 prefectures.
DNA or deoxyribonucleic acid One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes. from liver biopsies. In addition, we karyotyped 12 members of the genus Mastomys in the field by using standard procedures (14). [FIGURE 1 OMITTED] We obtained positive RT-PCR results from 98 (1.2%) of 1,482 murid rodents. Sequence analysis showed 96 Lassa virus strains with 96%-100% amino acid homology with the prototypic strain Josiah. Lassa virus--positive rodents were only captured in the prefectures of Faranah (villages of Gbetaya, Bantou, Tanganya) and Gueckedou (Denguddou), both situated along the border with Sierra Leone (Figure 1). We PCR-typed all Lassa virus-positive rodents unequivocally as M. natalensis, with 1 male (no. BA686) additionally confirmed by karyotyping Karyotyping A laboratory test used to study an individual's chromosome make-up. Chromosomes are separated from cells, stained, and arranged in order from largest to smallest so that their number and structure can be studied under a microscope. (2n = 32, autosomal Autosomal Relating to any chromosome besides the X and Y sex chromosomes. Human cells contain 22 pairs of autosomes and one pair of sex chromosomes. Mentioned in: Ataxia-Telangiectasia, Cutis Laxa, Hemochromatosis fundamental number = 53). Overall, 11.3% of M. natalensis were infected with Lassa virus (Table), with 0% in the low seroprevalence area and 5.4%-32.1% in the Lassa fever high seroprevalence area. In the coastal region, where the lowest human Lassa virus seroprevalence (0%-6%) has been reported, only M. erythroleucus was captured. In contrast, in the forest region, where the highest seroprevalence of up to 55% in selected villages has been found, only M. natalensis was trapped (11). Both species were captured in the savannah Savannah, city, United States Savannah, city (1990 pop. 137,560), seat of Chatham co., SE Ga., a port of entry on the Savannah River near its mouth; inc. 1789. regions, where seroprevalence was 2%-42%, but M. natalensis was captured more frequently (Figure 1). Lassa virus was isolated in cell culture from 32 rodents, and a 63l-bp fragment of the nucleoprotein nucleoprotein Macromolecular complex consisting of a protein linked to a nucleic acid, either DNA or RNA. The proteins that combine with DNA are generally of characteristic types called histones and protamines. gene previously used for phylogenetic phy·lo·ge·net·ic adj. 1. Of or relating to phylogeny or phylogenetics. 2. Relating to or based on evolutionary development or history. analysis was sequenced (GenBank accession nos. DQ832667-DQ832699) (15). The phylogenetic tree shows that all isolates belong to the lineage IV of Lassa virus and that strains from the prefecture of Faranah cluster with strains isolated previously from human patients of the same region (15) (Figure 2). We detected 2 novel L-gene sequences that shared 68%-74% homology with lymphocytic choriomeningitis virus in 2 rodents of the Mus subgenus subgenus /sub·ge·nus/ (sub´je-nus) a taxonomic category between a genus and a species. sub·ge·nus n. pl. sub·gen·e·ra A taxonomic category ranking between a genus and a species. Nannomys. [FIGURE 2 OMITTED] Conclusions Our results indicate that M. natalensis is very likely the only reservoir host of Lassa virus in Guinea. Previous studies that identified M. erythroleucus and M. huberti as reservoirs of Lassa virus in Sierra Leone may have confused the species, especially because M. natalensis and M. huberti have an identical number of chromosomes (5, 7). Despite a massive trapping effort, M. huberti was not detected in the regions of Guinea bordering Sierra Leone that had high human Lassa virus seroprevalence. Therefore, M. natalensis is likely also the only reservoir in Sierra Leone. Whether this is also the case for the genetically more remote lineage I-III strains of Lassa virus remains to be evaluated because M. kollmannspergeri is also present in Nigeria (7,16). While it is reassuring that the reservoir for Lassa virus is M. natalensis, as reported in the literature since the 1970s, our study demonstrates that proper taxonomic identification of the host is necessary before drawing inferences about the ecology of Lassa virus infection. The relative abundance of Mastomys correlated with human Lassa virus seroprevalence in Guinea: M. natalensis was absent from the region with the lowest seroprevalence and was the only Mastomys species caught in the highest seroprevalence region. However, if both M. natalensis and M. erythroleucus were present, human Lassa virus prevalence was either low, intermediate, or high (Figure 1). This is a novel finding, which confirms and expands on 2 previous studies conducted in Guinea that reported a correlation between the absence of Mastomys spp. and a low human Lassa virus seroprevalence (9,12). The results of this study have multiple implications for explaining the patchy occurrence of Lassa virus in Guinea and neighboring countries, as well as for Lassa fever control. First, assuming that M. natalensis is the only host of Lassa virus, natural nidality may occur in a similar fashion as that described for Bolivian hemorrhagic fever Bolivian hemorrhagic fever Virology An arenavirus infection similar to Argentine HF; BHF is endemic to the grain-producing province of Beni in Amazonian Bolivia Agent Machupo virus Vector Excreted in urine of the rodent vector, Calomys callosus caused by Machupo virus. The Machupo virus reservoir host, Callomys callosus, has been shown by genetic analysis to be paraphyletic paraphyletic Relating to a taxonomic group that includes some but not all of the descendants of a common ancestor. In the traditional taxonomy of vertebrates, where fish are a separate class from the classes of terrestrial vertebrates, the class of fish is . The populations of rodents responsible for the maintenance and transmission of Machupo virus were monophyletic monophyletic /mono·phy·let·ic/ (mon?o-fi-let´ik) descended from a common ancestor or stem cell. mon·o·phy·let·ic adj. 1. Descended or derived from one original stock or source. lineages different from C. callosus in nondisease-endemic regions of Bolivian hemorrhagic fever and coevolving with the virus (17). M. natalensis specimens from regions with high and low Lassa virus activity are being genetically investigated to determine lineages and population structure. Second, the geographic region of potential rodent-to-human transmission of lineage IV strains of Lassa virus is most likely defined by the occurrence of M. natalensis. Mastomys collections from Sierra Leone and Liberia could be molecularly retyped to reevaluate areas of potential Lassa fever reemergence. Third, our mass screening for arenaviruses found only Lassa virus in Mastomys and a novel lymphocytic choriomeningitislike virus in Mus spp. of the subgenus Nannomys, which are closely related to Mus musculus, the Eurasian host of lymphocytic choriomeningitis virus. These findings support the hypothesis of a species-specific association of arenaviruses with their rodent hosts, resulting in cophylogeny. Acknowledgments We thank Aboubakar Camara, Mohamed Camara, and Thomas Strecker for their help with the field work and C. Akoua-Koffi (Institut Pasteur, Abidjan) for her assistance. This study was supported by the European Community (INCO-DEV grant ICA Ica (ē`kä), city (1993 pop. 108,724), capital of Ica dept., SW Peru, on the Pan-American Highway. It is a commercial center for the cotton, wool, and wine produced in the region. There are several summer resorts nearby. 4-CT2002-10050), a Marie Curie Curie (kürē`), family of French scientists. Pierre Curie, 1859–1906, scientist, and his wife, Marie Sklodowska Curie, 1867–1934, chemist and physicist, b. Intra-European Fellowship within the 6tb European Community Framework Programme (no. MEIF-CT2003-506686), and the Howard Hughes Medical Institute Howard Hughes Medical Institute, (HHMI), nonprofit medical research organization founded in 1953 by Howard Hughes and largly funded from proceeds of the 1984–85 sale of Hughes Aircraft. Headquartered in Chevy Chase, Md. . Dr Lecompte is a postdoctoral fellow at the Institute of Virology virology, study of viruses and their role in disease. Many viruses, such as animal RNA viruses and viruses that infect bacteria, or bacteriophages, have become useful laboratory tools in genetic studies and in work on the cellular metabolic control of gene expression in Marburg, Germany. Her research interests include rodent systematics systematics: see classification. and molecular evolution of rodents and arenaviruses. References (1.) McCormick JB, Webb PA, Krebs JW, Johnson KM, Smith ES. A prospective study of the epidemiology and ecology of Lassa fever. J Infect Dis. 1987;155:437-44. (2.) Salazar-Bravo J, Ruedas LA, Yates TL. Mammalian reservoirs of arenaviruses. Curr Top Microbiol hnmunol. 2002;262:25-63. (3.) Monath TP, Newhouse VF, Kemp GE, Setzer HW, Cacciapuoti A. Lassa virus isolation from Mastomvs natalensis rodents during an epidemic in Sierra Leone. Science. 1974;185:263-5. (4.) Wulff 14, Fabiyi A, Monath TP. Recent isolations of Lassa virus from Nigerian rodents. Bull World Health Organ. 1975;52:609-12. (5.) Granjon L, Duplantier J-M J-M Jelinski-Moranda (reliability model) , Catalan J, Brinon-Davidian J. Systematics of the genus Mastomys (Thomas, 1915) (Rodentia: Muridae). A review. Belg J Zool. 1997; 127(Suppl. 1):7-18. (6.) Mills JN, Childs JE. Ecologic studies of rodents reservoirs: their relevance for human health. Emerg Infect Dis. 1998:4:529-37. (7.) Lecompte E, Brouat C, Duplantier JM, Galan M, Granjon L, Loiseau A, et al. Molecular identification of tour cryptic species of Mastomys (Rodentia, Murinae). Biochem Syst Ecol. 2005;33:681-9. (8.) Vieth S, Drosten C, Lenz O. Vincent M, Omilabu S, Hass M, et al. A reverse transcription PCR assay for detection of Lassa virus and related Old World arenaviruses targeting the L gene. Trans R Soc Trop Med Hyg. In press. (9.) Demby AH, lnapogui A, Kargbo K, Koninga J, Kourouma K, Kanu J, et al. Lassa fever in Guinea: II. Distribution and prevalence of Lassa virus infection in slnall mammals. Vector Borne Zoonotic Zoonotic A disease which can be spread from animals to humans. Mentioned in: Zoonosis Dis. 2001;1:283-96. (10.) White F. 1983. The vegetation of Africa; a descriptive memoir to accompany the UNESCO/AETFAT/UNSO vegetation map of Africa. Paris: UNESCO UNESCO: see United Nations Educational, Scientific, and Cultural Organization. UNESCO in full United Nations Educational, Scientific and Cultural Organization ; 1983. (11.) Lukashevich LS, Clegg JC, Sidibe K. Lassa virus activity in Guinea: distribution of human antiviral antibody defined using enzyme-linked immunosorbent assay enzyme-linked immunosorbent assay n. ELISA. Enzyme-linked immunosorbent assay (ELISA) A diagnostic blood test used to screen patients for AIDS or other viruses. with recombinant antigen. J Med Virol. 1993;40:210-7. (12.) Bausch DG, Demby AH, Coulibaly M, Kanu J, Goba A, Bah bah interj. Used to express impatient rejection or contempt. bah interj an expression of contempt or disgust A, et al. Lassa fcver in Guinea: I. Epidemiology of human disease and clinical observations. Vector Borne Zoonotic Dis. 2001;1:269-81. (13.) ter Mculen J, Lukashevich I, Sidibe K, Inapogui A, Marx M, Dorlemann A, et al. Hunting of peridomestic rodents and consumption of their meat as possible risk factors for rodent-to-human transmission of Lassa virus in the Republic of Guinea. Am J Trop Med Hyg. 1996;55:661-6. (14.) Ford CE, Hamerton JL. A colchicine colchicine (kŏl`chəsēn'), alkaloid extracted from plants of the genus Colchicum and especially from the corms of the autumn crocus, Colchicum autumnale (see meadow saffron). , hypotonic hypotonic /hy·po·ton·ic/ (-ton´ik) 1. denoting decreased tone or tension. 2. denoting a solution having less osmotic pressure than one with which it is compared. citrate citrate /cit·rate/ (sit´rat) a salt of citric acid. citrate phosphate dextrose (CPD) anticoagulant citrate phosphate dextrose solution. , squash sequence for mammalian chromosomes. Stain Technol. 1956:31:247-5l. (15.) Bowen MD, Rollin PE, Ksiazek TG, Hustad HL, Bausch DG, Demby AH, et al. Genetic diversity among Lassa virus strains. J Virol. 2000;74:6992-7004. (16.) Robbins CB, Van der Straeten E. Comments on the systematics of Mastomys Thomas 1915 with a description of a new west African species (Mammalia: Rodentia: Muridae). Senckenbergiania Biologica. 1989;69:1-14. (17.) Salazar-Bravo J, Dragoo JW, Bowen MD, Peters C J, Ksiazek TG, Yates TL. Natural nidality in Bolivian hemorrhagic fever and the systematics of the reservoir species. Infect Genet genet: see civet. Evol. 2002;1:191-9. Emilie Lecompte, * Elisabeth Fichet-Calvet, ([dagger]) Stephane Daffis, * ([double dagger]) Kekoura Koulemou, ([section]) Oumar Sylla, ([section]) Fode Kourouma, ([section]) Amadou Am´a`dou n. 1. A spongy, combustible substance, prepared from fungus (Boletus and Polyporus) which grows on old trees; German tinder; punk. Dore, ([section]) Barre Soropogui, ([section]) Vladimir Aniskin, ([paragraph]) Bernard Allali, # Stephane Kouassi Kan, # Aude Lalis, ([dagger]) Lamine Koivogui, ([section]) Stephan Gunther, ** Christiane Denys, ([dagger]) and Jan ter Meulen * ([dagger])([dagger]) * Philipps University Institute of Virology, Marburg, Germany; ([dagger]) Museum National d'Histoire Naturelle, Paris, France; ([double dagger]) Washington University School of Medicine Washington University School of Medicine, located in St. Louis, Missouri, is one of the most competitive and highly regarded medical schools and biomedical research institutes in the United States. , Saint Louis, Missouri, USA; ([section]) Projet de Recherches sur les Fievres Hemorragiques en Guinee, Conakry, Guinea; ([paragraph]) Severtsov Institute of Ecology and Evolution, Moscow, Russia; # Institut Pasteur d'Abidjan, Abidjan, Cote d'Ivoire; ** Bernhard Nocht Institute for Tropical Medicine Bernhard Nocht Institute for Tropical Medicine; (Bernhard-Nocht-Institut für Tropenmedizin) is a medical institution based in Hamburg, Germany which is dedicated to research, treatment, training and therapy of tropical and infectious diseases, (including HIV). , Hamburg, Germany; and ([dagger])([dagger]) Leiden University Medical Center The Leiden University Medical Center (Dutch: Leids Universitair Medisch Centrum) or LUMC, is the university hospital affiliated with Leiden University, of which it forms the medical faculty. , Leiden, the Netherlands Address for correspondence: Emilie Lecompte, LEGS, CNRS CNRS Centre National de la Recherche Scientifique (National Center for Scientific Research, France) CNRS Centro Nacional de Referencia Para El Sida (Argentinean National Reference Center for Aids) , Avenue de la Terrasse, Batiment 13, BP 1, 91 198 Gif-sur-Yvette, France; email: emilie.lecomptc@hotmail.fr
Table. Small mammal species examined for arenavirus infection by
reverse transcription PCR *
Lassa never high-prevalence areas
Species No. examined No. positive (%)
Mastomys natalensis 726 96 (13.2)
Mastomys erythroleucus 65 0
Mus (Nannomys) spp. 131 1 (0.7)
Praomys cf. rostratus 78 0
Myomys daltoni 24 0
Crocidura spp. 22 0
Lophuromys sikapusi 18 0
Lemniscomys spp. 19 0
Rattus rattus 8 0
Tatera cf. guinea 3 0
Uranomys ruddi 1 0
Hylomyscus simus 5 0
Malacomys edwardsi 2 0
Hybomys spp. 3 0
Mus musculus 0 0
Cricetomys gambianus 1 0
Graphiurus sp. 1 0
Paraxerus sp. 1 0
Sylvisorex sp. 1 0
Micropteropus sp. 0 0
Thamnomys sp. 0 0
Dasymys rufulus 0 0
Lepus sp. 0 0
Total/Lassa virus 1,271 96
Total/Arenaviruses 1,271 97
Lassa fever low-prevalence areas
Species No. examined No. positive (%)
Mastomys natalensis 121 0
Mastomys erythroleucus 137 0
Mus (Nannomys) spp. 34 1 (5.6)
Praomys cf. rostratus 42 0
Myomys daltoni 25 0
Crocidura spp. 18 0
Lophuromys sikapusi 21 0
Lemniscomys spp. 10 0
Rattus rattus 51 0
Tatera cf. guinea 12 0
Uranomys ruddi 6 0
Hylomyscus simus 0 0
Malacomys edwardsi 0 0
Hybomys spp. 0 0
Mus musculus 1 0
Cricetomys gambianus 0 0
Graphiurus sp. 0 0
Paraxerus sp. 0 0
Sylvisorex sp. 0 0
Micropteropus sp. 4 0
Thamnomys sp. 1 0
Dasymys rufulus 1 0
Lepus sp. 1 0
Total/Lassa virus 320 0
Total/Arenaviruses 320 1
Total
Species No. examined No. positive (%)
Mastomys natalensis 847 96 (11.3)
Mastomys erythroleucus 202 0
Mus (Nannomys) spp. 165 2 (1.2)
Praomys cf. rostratus 117 0
Myomys daltoni 49 0
Crocidura spp. 40 0
Lophuromys sikapusi 39 0
Lemniscomys spp. 29 0
Rattus rattus 59 0
Tatera cf. guinea 15 0
Uranomys ruddi 7 0
Hylomyscus simus 5 0
Malacomys edwardsi 2 0
Hybomys spp. 3 0
Mus musculus 1 0
Cricetomys gambianus 1 0
Graphiurus sp. 1 0
Paraxerus sp. 1 0
Sylvisorex sp. 1 0
Micropteropus sp. 4 0
Thamnomys sp. 1 0
Dasymys rufulus 1 0
Lepus sp. 1 0
Total/Lassa virus 1,591 96 (6)
Total/Arenaviruses 1,591 98 (6.2)
* The Lassa fever high-prevalence areas comprise the region of
Faranah and the forest region (Figure 1); the low-prevalence areas
comprise all other localities of the study.
|
|
||||||||||||||||
Printer friendly
Cite/link
Email
Feedback
Reader Opinion