Printer Friendly
The Free Library
6,673,760 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

MassTag polymerase chain reaction for differential diagnosis of viral hemorrhagic fevers.


Viral hemorrhagic fevers are associated with high rates of illness and death. Although therapeutic options are limited, early differential diagnosis has implications for containment and may aid in clinical management. We describe a diagnostic system for rapid, multiplex polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is  identification of 10 different causes of viral hemorrhagic fevers.

**********

Increasing international travel, trafficking in wildlife, political instability, and terrorism have made emerging infectious diseases a global concern. Viral hemorrhagic fevers (VHF (Very High Frequency) The range of electromagnetic frequencies from 30 MHz to 300 MHz. ) warrant specific emphasis because of their high rates of illness and death, and the potential for rapid dissemination by human-to-human transmission. The term "viral hemorrhagic fever" characterizes a severe multisystem syndrome associated with fever, shock, and bleeding diathesis caused by infection with any of several RNA viruses, including Ebola virus and Marburg virus (MARV MARV Mammoth Armed Reclamation Vehicle (Command & Conquer 3: Kane's Wrath; computer game)
MARV Marburg Virus
MARV Maneuverable Reentry Vehicle
MARV Mobile Armored Reconnaissance Vehicle
MARV Mars Aerial Research Vehicle
) (family Filoviridae); Lassa virus (LASV LASV Low Altitude Supersonic Vehicle
LASV Los Altos Solar Vehicle (Hacienda Heights, California) 
) and the South American hemorrhagic fever American hemorrhagic fever can refer to:
  • Argentine hemorrhagic fever
  • Bolivian hemorrhagic fever
External links
  • MeSH Hemorrhagic+Fever,+American
 viruses Guanarito virus, Junin virus, Machupo virus, and Sabifi virus (Arenaviridae); Rift Valley fever Rift Valley fever

An arthropod-borne (primarily mosquito), acute, febrile, viral disease of humans and numerous species of animals. Rift Valley fever is caused by a ribonucleic acid (RNA) virus in the genus Phlebovirus of the family Bunyaviridae.
 virus (RVFV RVFV Rift Valley Fever Virus ), Crimean-Congo hemorrhagic fever Crimean-Congo hemorrhagic fever

a zoonotic disease of humans, in central Asia through to eastern Europe, who are in contact with livestock. Caused by a bunyavirus, it is transmitted by ticks. The principal signs are fever, widespread hemorrhages and necrotizing hepatitis.
 virus (CCHFV), and hantaviruses (Bunyaviridae); and Kyasanur Forest disease Kyasanur Forest disease

a highly fatal flavivirus disease of monkeys in the Kyasanur Forest of India, communicable to humans, in whom it produces hemorrhagic symptoms. See also encephalitis.
 virus (KFDV KFDV Kyasanur Forest Disease Virus ), Omsk hemorrhagic fever Omsk hemorrhagic fever

see encephalitis.
 virus, yellow fever virus yellow fever virus
n.
An arbovirus of the genus Flavivirus that causes yellow fever and is transmitted by mosquitoes.
 (YFV YFV Yellow Fever Virus ), and dengue viruses (Flaviviridae) (1,2). Although clinical management of VHF is primarily supportive, early diagnosis is needed to contain the contagion Contagion

The likelihood of significant economic changes in one country spreading to other countries. This can refer to either economic booms or economic crises.

Notes:
An infamous example is the "Asian Contagion" that occurred in 1997 and started in Thailand.
 and implement public health measures, especially if agents are encountered out of their natural geographic context.

Vaccines have been developed for YFV, RVFV, Junin virus, KFDV, and hantaviruses (3-7), but only YFV vaccine is widely available. Early treatment with immune plasma was effective in Junin virus infection (8). The nucleoside analog ribavirin ribavirin /ri·ba·vi·rin/ (ri?bah-vi´rin) a broad-spectrum antiviral used in the treatment of severe viral pneumonia caused by respiratory syncytial virus, particularly in high-risk infants; also used in conjunction with interferon  may be helpful if given early in the course of Lassa fever (9), Crimean-Congo hemorrhagic fever (10), or hemorrhagic fever with renal syndrome hemorrhagic fever with renal syndrome
n.
See epidemic hemorrhagic fever.
 (11) and is recommended in postexposure prophylaxis and early treatment of arenavirus arenavirus /are·na·vi·rus/ (ah-re´nah-vi?rus) any virus of the family Arenaviridae.
Arenavirus /Are·na·vi·rus/ (ah-re´nah-vi?rus 
 and bunyavirus infections (12).

Methods for direct detection of nucleic acids of microbial microbial

pertaining to or emanating from a microbe.


microbial digestion
the breakdown of organic material, especially feedstuffs, by microbial organisms.
 pathogens in clinical specimens are rapid, sensitive, and obviate the need for high-level biocontainment. Numerous systems are described for nucleic acid detection of VHF agents; however, none are multiplex (13). Although geographic location or travel history of suspected patients usually restricts the number of agents to be considered, diagnosis of VHF may be difficult in case of an intentional release (12). Symptoms of VHF are initially nonspecific nonspecific /non·spe·cif·ic/ (non?spi-sif´ik)
1. not due to any single known cause.

2. not directed against a particular agent, but rather having a general effect.


nonspecific

1.
 and may include fever, headache, myalgia, and gastrointestinal or upper respiratory tract complaints (1); thus, assays that allow simultaneous consideration of multiple agents are needed.

We recently described the application of MassTag polymerase chain reaction (PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
) in the context of differential diagnosis of respiratory disease (14). MassTag PCR is a multiplex assay in which microbial gene targets are coded by a library of 64 distinct mass tags. Nucleic acids (RNA RNA: see nucleic acid.
RNA
 in full ribonucleic acid

One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic
 or DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
) are amplified by multiplex (reverse transcription-) PCR using up to 64 primers, each labeled by a photo-cleavable link with a different molecular weight tag. After separation of the amplification products from unincorporated primers and release of the mass tags from the amplicons by UV irradiation, tag identity is analyzed by mass spectrometry. The identity of the microbe microbe /mi·crobe/ (mi´krob) a microorganism, especially a pathogenic one such as a bacterium, protozoan, or fungus.micro´bialmicro´bic

mi·crobe
n.
 in the clinical sample is determined by the presence of its 2 cognate cognate

describes two biomolecules that normally interact such as an enzyme and its normal substrate or a receptor and its normal ligand.


cognate cooperation
 tags, 1 from each primer.

The Study

To facilitate rapid differential diagnosis of VHF agents, we established the Greene MassTag Panel VHF version 1.0, which comprises the following targets: Ebola Zaire virus (ZEBOV ZEBOV Zaire Ebola Virus ), Ebola Sudan virus (SEBOV), MARV, LASV, RVFV, CCHFV, Hantaan virus (HNTV), Seoul virus (SEOV), YFV, and KFDV. Oligonucleotide primers were designed in conserved genomic regions to detect the broadest number of members for a given pathogen species. We developed a software program that culls sequence information from GenBank, performs multiple alignments with ClustalW, and designs primers optimized for multiplex PCR. The program uses a greedy algorithm to identify conserved sequences and create the minimum set of primers for amplification of all sequences in the alignment. Primers are selected within standard design constraints whenever possible (melting temperature 55[degrees]C-65[degrees]C, guanine-cytosine content 40%-60%, no hairpins); degenerate positions are introduced in cases where template divergence requires more flexibility. Although degeneracy Degeneracy (quantum mechanics)

A term referring to the fact that two or more stationary states of the same quantum-mechanical system may have the same energy even though their wave functions are not the same.
 is not tolerated in the five 3' nucleotides, MassTag PCR allows up to 4 nonneighboring variable positions per primer. Primers are checked by the basic local alignment search tool for potential hybridization hybridization /hy·brid·iza·tion/ (hi?brid-i-za´shun)
1. crossbreeding; the act or process of producing hybrids.

2. molecular hybridization

3.
 to sequenced vertebrate genomes (Table 1).

Because only released mass tags are analyzed, staggering the size of amplification products created in multiplex reactions is unnecessary; thus, primers are selected for efficient and consistent performance irrespective of amplicon size (typically 80-200 bp). Before committing to synthesis of tagged primers, the functionality of candidate multiplex primer panels is examined in a series of amplification reactions that use prototype templates representing individual microbial targets. Primers that fail to yield a single, specific product band in agarose gel analysis are replaced. Target sequence standards for evaluation are cloned into pCR2.1-TOPO (Invitrogen, Carlsbad, CA, USA) by using PCR amplification of cDNA templates obtained by reverse transcription (RT) of extracts from infected, cultured cells or by assembly of overlapping synthetic polynucleotides.

The agents assayed in the VHF panel have RNA genomes; thus, assay sensitivity was determined by using synthetic RNA standards. Synthetic RNA standards were generated from linearized target sequence plasmids by using T7 polymerase (mMessage mMachine, Invitrogen). After quantitation by UV spectrometry, RNA was serially diluted in 2.5 [micro]g/mL yeast tRNA (Sigma, St. Louis, MO, USA), reverse transcribed with random hexamers by using Superscript II (Invitrogen), and analyzed by MassTag PCR as previously described (14). QIAquick 96 PCR purification cartridges (Qiagen, Hilden, Germany, with modified binding and wash buffers) were used to remove unincorporated primers before tags were decoupled from amplification products by UV photolysis photolysis

Breakdown of molecules into smaller units via absorption of light. Flash photolysis, an experimental technique developed by Manfred Eigen, Ronald George Weyford Norrish, and George Porter, studies short-lived chemical intermediates formed in many photochemical
 in a flow cell and analyzed in a quadrapole mass spectrometer by using positive-mode atmospheric pressure chemical ionization Atmospheric pressure chemical ionization (APCI) is an ionization method used in mass spectrometry. It is a form of chemical ionization which takes place at atmospheric pressure.  (APCI-MS, Agilent Technologies, Palo Alto, CA, USA). The sensitivity of the 10-plex VHF panel with synthetic RNA standards was [less than or equal to] 50 RNA copies per assay (Table 2). Sensitivity and specificity of multiplex primer panels is assessed empirically by using calibrated synthetic standards as well as tissue culture-derived viral nucleic acid for each assembled panel.

Tissue culture extracts were used to examine assay specificity. Random primed cDNA obtained from cultures of ZEBOV, SEBOV, MARV, YFV isolates from the Gambia and Cote d'Ivoire, RVFV, CCHFV, HTNV, SEOV, and LASV strains Josiah, NL, and AV were subjected to mass tag analysis. In all instances, only the appropriate cognate mass tags were detected (data not shown). No spurious signal was identified in assays with water or RNA controls.

Performance with clinical materials was tested by using blood, sera, or oral swabs from 24 human patients of VHF

previously diagnosed through virus isolation, RT-PCR RT-PCR

reverse transcriptase-polymerase chain reaction. See PCR1.
, or antigen detection enzyme-linked immunosorbent assay enzyme-linked immunosorbent assay
n.
ELISA.


Enzyme-linked immunosorbent assay (ELISA)
A diagnostic blood test used to screen patients for AIDS or other viruses.
. Differential diagnosis by blinded MassTag PCR analysis was accurate in all cases (Table 3). For the samples from the 2005 Angola Marburg outbreak the result of MassTag PCR was similar to that of diagnostic single-plex PCR. ZEBOV sample 5004, obtained on day 17 of illness when serologic test results were positive for immunoglobulin M (IgM) and IgG, was negative by viral culture but positive in MassTag PCR.

Conclusions

These results confirm earlier work in respiratory diseases that show that MassTag PCR offers a rapid, sensitive, specific, and economic approach to differential diagnosis of infectious diseases. Small, low-cost, or mobile APCI-MS units extend the applicability of this technique beyond selected reference laboratories. Given the capacity of the method to code for up to 32 genetic targets, we are expanding the hemorrhagic fever panel to include additional viruses (dengue dengue
 or breakbone fever or dandy fever

Infectious, disabling mosquito-borne fever. Other symptoms include extreme joint pain and stiffness, intense pain behind the eyes, a return of fever after brief pause, and a characteristic rash.
 and South American hemorrhagic fever viruses) and are exploring the inclusion of bacterial and parasitic agents that may result in similar clinical signs and symptoms and, thus, have to be considered in differential diagnosis.

References

(1.) Peters CJ, Zaki SR. Role of the endothelium endothelium /en·do·the·li·um/ (-the´le-um) pl. endothe´lia   the layer of epithelial cells that lines the cavities of the heart, the serous cavities, and the lumina of the blood and lymph vessels.  in viral hemorrhagic fevers. Crit Care Med. 2002;30(5 Suppl):S268-73.

(2.) Geisbert TW, Jahrling PB. Exotic emerging viral diseases: progress and challenges. Nat Med. 2004; 10(12 Suppl): S110-21.

(3.) Pugachev KV, Guirakhoo F, Monath TP. New developments in flavivirus vaccines with special attention to yellow fever. Curr Opin Infect Dis. 2005; 18:387-94.

(4.) Pittman PR, Liu CT, Cannon TL, Makuch RS, Mangiafico JA, Gibbs PH, et al. Immunogenicity immunogenicity /im·mu·no·ge·nic·i·ty/ (-je-nis´it-e) the property enabling a substance to provoke an immune response, or the degree to which a substance possesses this property.  of an inactivated inactivated

rendered inactive; the activity is destroyed.


inactivated viruses
treated so that they are no longer able to produce evidence of growth or damaging effect on tissue.
 Rift Valley fever vaccine in humans: a 12-year experience. Vaccine. 1999;18:181-9.

(5.) Enria DA, Barrera Oro JG. Junin virus vaccines. Curr Top Microbiol Immunol. 2002;263:239-61.

(6.) Hooper JW, Li D. Vaccines against hantaviruses. Curr Top Microbiol Immunol. 2001;256:171-91.

(7.) Dandawate CN, Desai GB, Achar TR, Banerjee K. Field evaluation of formalin formalin /for·ma·lin/ (for´mah-lin) formaldehyde solution.

for·ma·lin
n.
An aqueous solution of formaldehyde that is 37 percent by weight.
 inactivated Kyasanur forest disease virus tissue culture vaccine in three districts of Karnataka state. Indian J Med Res. 1994;99:152-8.

(8.) Enria DA, Maiztegui JI. Antiviral treatment of Argentine hemorrhagic fever Argentine hemorrhagic fever A viral illness caused by the Junin arenavirus Epidemiology Transmitted by contact with rodent urine; 23 outbreaks have been recorded, in the maize-producing region of Argentina Rodent vectors . Antiviral Res. 1994;23:23-31.

(9.) McCormick JB, King IJ, Webb PA, Scribner CL, Craven RB, Johnson KM, et al. Lassa fever. Effective therapy with ribavirin. N Engl J Med. 1986;314:20-6.

(10.) Ozkurt Z, Kiki I, Erol S, Erdem F, Yilmaz N, Parlak M, et al. Crimean-Congo hemorrhagic fever in eastern Turkey: clinical features, risk factors and efficacy of ribavirin therapy. J Infect. Epub 2005 Jun 13.

(11.) Huggins JW, Hsiang CM, Cosgriff TM, Guang MY, Smith JI, Wu ZO, et al. Prospective, double-blind, concurrent, placebo-controlled clinical trial of intravenous ribavirin therapy of hemorrhagic fever with renal syndrome. J Infect Dis. 1991;164:1119-27.

(12.) Borio L, Inglesby T, Peters CJ, Schmaljohn AL, Hughes JM, Jahrling PB, et al. Hemorrhagic fever viruses as biological weapons: medical and public health management. JAMA JAMA
abbr.
Journal of the American Medical Association
. 2002;287:2391-405.

(13.) Drosten C, Kummerer BM, Schmitz H, Gunther S. Molecular diagnostics of viral hemorrhagic fevers. Antiviral Res. 2003;57:61-87.

(14.) Briese T, Palacios G, Kokoris M, Jabado O, Liu Z, Renwick N, et al. Diagnostic system for rapid and sensitive differential detection of pathogens. Emerg Infect Dis. 2005;11:310-3.

(15.) Bowen MD, Rollin PE, Ksiazek TG, Hustad HL, Bausch DG, Demby AH, et al. Genetic diversity among Lassa virus strains. J Virol. 2000;74:6992-7004.

Gustavo Palacios, * (1) Thomas Briese, * (1) Vishal Kapoor, * Omar Jabado, * Zhiqiang Liu, * Marietjie Venter venter /ven·ter/ (ven´ter) pl. ven´tres   [L.]
1. a fleshy contractile part of a muscle.

2. abdomen.

3. a hollowed part or cavity.


ven·ter
n.
, ([dagger]) Junhui Zhai, * Neil Renwick, * Allen Grolla, ([double dagger]) Thomas W. Geisbert, ([section]) Christian Drosten, ([paragraph] Jonathan Towner, (#) Jingyue Ju, * Janusz Paweska, ** Stuart T. Nichol, ([double dagger]) ([dagger][dagger]) Robert Swanepoel, ** Heinz Feldmann, ([double dagger]) ([dagger][dagger]) Peter B. Jahrling, ([double dagger][double dagger]) and W. Ian Lipkin *

(1) These authors contributed equally to this article.

* Columbia University, New York, New York, USA; ([dagger]) University of Pretoria and National Health Laboratory Services, Pretoria, South Africa; ([double dagger]) Public Health Agency of Canada The Public Health Agency of Canada (French: Agence de la santé publique du Canada) is an agency of Health Canada a department of the Government of Canada that is responsible for public health, emergency preparedness, and response and infectious and chronic disease control , Winnipeg, Manitoba, Canada; ([section]) United States Army Medical Research Institute of Infectious Diseases The United States Army Medical Research Institute of Infectious Diseases (USAMRIID, pronounced you-SAM-rid) is a military research institute for medicine based at Fort Detrick, Frederick, Maryland used for research of infectious disease that may have defensive applications against , Fort Detrick, Frederick, Maryland, USA; ([paragraph]) Bernhard-Nocht-Institute of Tropical Medicine, Hamburg, Germany; (#) Centers for Disease Control and Prevention Centers for Disease Control and Prevention (CDC), agency of the U.S. Public Health Service since 1973, with headquarters in Atlanta; it was established in 1946 as the Communicable Disease Center. , Atlanta, Georgia, USA; ** National Institute for Communicable Diseases, Sandringham, South Africa; ([dagger][dagger]) University of Manitoba Location
The main Fort Garry campus is a complex on the Red River in south Winnipeg. It has an area of 2.74 square kilometres. More than 60 major buildings support the teaching and research programs of the university.
, Winnipeg, Manitoba, Canada; and ([double dagger][double dagger]) National Institutes of Allergy and Infectious Diseases Integrated Research Facility, Fort Detrick, Frederick, Maryland, USA

Address for correspondence: Thomas Briese, Jerome L. and Dawn Greene Infectious Disease Laboratory, Mailman School of Public Health, Columbia University, 722 W 168th St, Rm 1801, New York, NY 10032, USA; fax: 212-342-9044; email: thomas.briese@columbia.edu

Use of trade names is for identification only and does not imply endorsement by the Public Health Service or by the U.S. Department of Health and Human Services Noun 1. Department of Health and Human Services - the United States federal department that administers all federal programs dealing with health and welfare; created in 1979
Health and Human Services, HHS
.

This work was supported by National Institutes of Health awards AI51292, AI056118, AI55466, and U54AI57158 (Northeast Biodefense Center-Lipkin) and the Ellison Medical Foundation.

Dr Palacios is an associate research scientist in the Jerome L. and Dawn Greene Infectious Disease Laboratory at the Columbia University Mailman School of Public Health. His research focuses on the molecular epidemiology of viruses, virus interactions with their hosts, and innovative pathogen detection methods.
Table 1. Greene MassTaq panel VHF version 1.0 *

Target      MassTag         Name                  Sequence

ZEBOV      718 (fwd)     EboZA-U234      AACACCGGGTCTTAATTCTTATATCAA
           646 (rev)    EboZA-1_319     GGTGGTAAAATTCCCATAGTAGTTCTTT
SEBOV      503 (fwd)     EboSU-U416          CGAGCCTAACGTTTTGGGC
           630 (rev)     EboSU-L489         GCTCCAGGAATTGTTCGGGTA
MARV       654 (fwd)    MARV-U12816C    CCCTCCATATCTTAGACAACATATTGTG
           395 (rev)    MARV-L12994        CCCAACACTCCTGGTTCACAGC
LASVT      558 (fwd)      Las4-U92       ACTGCATTYTCATACTTYCTRGAATC
           686 (rev)     Las4-L257          CCRGGYTTGACCAGTGCTGT
RVFV       658 (fwd)      RVF-U578          GGATTGACCTGTGCCTGTTGC
           495 (rev)      RVF-L660       GCATTAGAAATGTCCTCTTTTGCTGC
CCHFV      499 (fwd)      CCHV-U4         AGAAACACGTGCCGCTTACGCCCA
           710 (rev)     CCHV-L120      CCATTTCCYTTYTTRAACTCYTCAAACCA
HNTV       479 (fwd)      HAN-U179         AYACAGCAGCAGTTAGCCTCCT
           702 (rev)      HAN-L245      GCT GCC GTA RGT AGT CCC TGTT
SEOV       455 (fwd)      SEO-U243          CAGGATTGCAGCAGGGAAGA
           602 (rev)     SEOUL-L309         ATGATCACCAGGYTCTACCCC
YFV        467 (fwd)      YF-U186             GCTGGGAGCGCGGTATC
           670 (rev)      YF-L249           GGAAGCCCAATGGTCCTCAT
KFDV       483 (fwd)      KYF-U170          TGGAAGCCTGGCTGAAAGAG
           614 (rev)      KYF-L233          TCATCCCCACTGACCAGCAT

Target     Gene

ZEBOV        L
SEBOV        L
MARV         L
LASVT       NP
RVFV         N
CCHFV        N
HNTV         N
SEOV         N
YFV         NS5
KFDV        NS5

* ZEBOV, Ebola Zaire virus, SEBOV, Ebola Sudan virus, MARV, Marburg
virus; LASV, Lassa virus, RVFV, Rift Valley fever virus; CCHV,
Crimean-Congo hemorrhagic fever virus; HNTV, Hantaan virus; SEOV, Seoul
virus; YFV, yellow fever virus; KFDV, Kyasanur Forest disease virus;
fwd, forward; rev, reverse.

([dagger]) Primers were designed on Lassa lineage IV sequences (15) and
the recently identified outlier sequence Lassa AV (AF256121).

Table 2. Sensitivity of detection with synthetic RNA standards

Pathogen *    Detection threshold (RNA copies) ([dagger])

ZEBOV                             20
SEBOV                             20
MARV                              20
LASV                              20
RVFV                              20
CCHFV                             50
HNTV                              20
SEOV                              50
YFV                               20
KFDV                              20

* ZEBOV, Ebola Zaire virus; SEBOV, Ebola Sudan virus; MARV, Marburg
virus; LASV, Lassa virus; RVFV, Rift Valley fever virus; CCHV,
Crimean-Congo hemorrhagic fever virus; HNTV, Hantaan virus; SEOV, Seoul
virus; YFV, yellow fever virus; KFDV, Kyasanur Forest disease virus.
tRNA copies refers to the number of molecules subjected to reverse
transcription; half of the reverse transcription reaction was then used
for polymerase chain reaction amplification.

Table 3. MassTag polymerase chain reaction analysis of clinical
specimens from viral hemorrhaqic fever patients *

Previous diagnosis    Sample identification         Sample type

ZEBOV                         5015                     Serum
ZEBOV                         5014                     Serum
ZEBOV                         5004                     Serum
ZEBOV                         6317                     Serum
ZEBOV                         6313                     Serum
MARV                        246-00-5           Hemolyzed whole blood
MARV                        226-00-4           Hemolyzed whole blood
MARV                        246-00-7           Hemolyzed whole blood
MARV                         98-00-2           Hemolyzed whole blood
MARV                           461                     Blood
MARV                           462                   Oral swab
MARV                           475                     Blood
MARV                           476                   Oral swab
LASV                         98-04-1                   Serum
LASV                          98-04                    Serum
LASV                         98-045                    Serum
LASV                         80-041                    Serum
RVFV                        98002009                   Serum
RVFV                        H6061989                   Serum
RVFV                        98002019                   Serum
RVFV                          77-04                    Serum
CCHFV                        187-86                    Serum
CCHFV                         30-93                    Serum
CCHFV                        465-88                    Serum
CCHFV                        407-89                    Serum
CCHFV                        215-90                    Serum

Previous diagnosis    Year/origin          MassTag result ([dagger])

ZEBOV                 1995/Kikwit, DRC            +++, ZEBOV
ZEBOV                 1995/Kikwit, DRC            +++, ZEBOV
ZEBOV                 1995/Kikwit, DRC            +++, ZEBOV
ZEBOV                 1995/Kikwit, DRC            +++, ZEBOV
ZEBOV                 1995/Kikwit, DRC            +++, ZEBOV
MARV                  2000/Durba, DRC               +, MARV
MARV                  2000/Durba, DRC              ++, MARV
MARV                  2000/Durba, DRC               +, MARV
MARV                  2000/Durba, DRC              +++, MARV
MARV                  2005/Uige, Angola            +++, MARV
MARV                  2005/Uige, Angola            +++, MARV
MARV                  2005/Uige, Angola            ++, MARV
MARV                  2005/Uige, Angola             +, MARV
LASV                  2004/Sierra Leone            +++, LASV
LASV                  2004/Sierra Leone            ++, LASV
LASV                  2004/Sierra Leone             +, LASV
LASV                  2004/Sierra Leone            +++, LASV
RVFV                  1998/Kenya                    +, RVFV
RVFV                  1998/Kenya                    +, RVFV
RVFV                  1998/Kenya                   ++, RVFV
RVFV                  2004/Namibia                 ++, RVFV
CCHFV                 1986/South Africa            +, CCHFV
CCHFV                 1993/South Africa           +++, CCHFV
CCHFV                 1988/South Africa           +++, CCHFV
CCHFV                 1989/South Africa           +++, CCHFV
CCHFV                 1990/South Africa            ++, CCHFV

* ZEBOV, Ebola Zaire virus; MARV, Marburg virus; LASV, Lassa virus;
RVFV, Rift Valley fever virus; CCHV, Crimean-Congo hemorrhagic fever
virus, DRC, Democratic Republic of Congo.

([dagger]) Relative ranking of results: +, signal-to-noise ratio
[less than or equal to] 4, ++, signal-to-noise ratio >4 and <8; +++,
signal-to-noise ratio [greater than or equal to] 8.
COPYRIGHT 2006 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2006, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Author:Lipkin, W. Ian
Publication:Emerging Infectious Diseases
Geographic Code:1USA
Date:Apr 1, 2006
Words:2550
Previous Article:Immune restoration disease in HIV patient.
Next Article:Atypical enteropathogenic Escherichia coli: typical pathogens?
Topics:



Related Articles
Preliminary Characterization and Natural History of Hantaviruses in Rodents in Northern Greece.(Statistical Data Included)
Hospital-based diagnosis of hemorrhagic fever, encephalitis, and hepatitis in Cambodian children. (Research).
First outbreak of dengue hemorrhagic fever, Bangladesh. (Dispatches).
Genetic detection and isolation of Crimean-Congo hemorrhagic fever virus, Kosovo, Yugoslavia. (Dispatches).
Crimean-Congo hemorrhagic fever in Turkey.(Research)
Crimean-Congo hemorrhagic fever in Bulgaria.(Dispatches)
Yellow fever outbreak, southern Sudan, 2003.
Crimean-Congo hemorrhagic fever, Mauritania.(Research)
Low diversity of Alkhurma hemorrhagic fever virus, Saudi Arabia, 1994-1999.(RESEARCH)
Lookback exercise with imported Crimean-Congo hemorrhagic fever, Senegal and France.

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles