Low diversity of Alkhurma hemorrhagic fever virus, Saudi Arabia, 1994-1999.Alkhurma hemorrhagic fever hemorrhagic fever (hĕm'ərăj`ĭk), any of a group of viral diseases characterized by sudden onset, muscle and joint pain, fever, bleeding, and shock from loss of blood. virus (genus Flavivirus, AHFV) was recently identified as the agent of a viral hemorrhagic fever Noun 1. viral hemorrhagic fever - a group of illnesses caused by a viral infection (usually restricted to a specific geographic area); fever and gastrointestinal symptoms are followed by capillary hemorrhage in Saudi Arabia and characterized serologically and genetically as a variant genotype of Kyasanur Forest disease Kyasanur Forest disease a highly fatal flavivirus disease of monkeys in the Kyasanur Forest of India, communicable to humans, in whom it produces hemorrhagic symptoms. See also encephalitis. virus (KFDV KFDV Kyasanur Forest Disease Virus ). Since viral diagnosis and vaccine development may be hindered by genetic diversity, this study was intended to address AHFV genetic heterogeneity. Eleven strains isolated from hospitalized patients from 1994 to 1999 in Saudi Arabia were sequenced in the envelope, NS3, and NS5 genes. Homologous sequences were compared and used to look for patterns reflecting specific evolution associated with spatiality, temporality tem·po·ral·i·ty n. pl. tem·po·ral·i·ties 1. The condition of being temporal or bounded in time. 2. temporalities Temporal possessions, especially of the Church or clergy. Noun 1. , infection pathway, and disease prognosis. Genetic analyses showed low diversity, which suggests a slow microevolution mi·cro·ev·o·lu·tion n. Evolution resulting from a succession of relatively small genetic variations that often cause the formation of new subspecies. . Evaluation of divergence times showed that AHFV and KFDV ancestral lineage diverged 66-177 years ago, and the diversity observed within the studied AHFV strains reflected a 4- to 72-year period of evolution. ********** Alkhurma hemorrhagic fever virus (AHFV) was first isolated in Jeddah, Saudi Arabia, in the 1990s from the blood of a butcher admitted to the hospital with a severe infectious syndrome. To date, 24 cases have been recorded in a 10-year period. Clinical manifestations include fever, headache, retroorbital pain, joint pain, generalized muscle pain, anorexia and vomiting associated with leukopenia leukopenia /leu·ko·pe·nia/ (-pe´ne-ah) reduction of the number of leukocytes in the blood below about 5000 per cubic mm.leukope´nic basophilic leukopenia basophilopenia. , thrombocytopenia Thrombocytopenia Definition Thrombocytopenia is an abnormal drop in the number of blood cells involved in forming blood clots. These cells are called platelets. , and elevated levels of liver enzymes. In addition, some patients had clinical symptoms of hemorrhagic fever or encephalitis encephalitis (ĕnsĕf'əlī`təs), general term used to describe a diffuse inflammation of the brain and spinal cord, usually of viral origin, often transmitted by mosquitoes, in contrast to a bacterial infection of the meninges ; overall, 5 patients, of 24 infected, died, for a 25% fatality rate fa·tal·i·ty rate n. See death rate. fatality rate see case fatality rate. (1-4). AHFV was identified as a flavivirus on the basis of immunofluorescence Immunofluorescence A technique that uses a fluorochrome to indicate the occurrence of a specific antigen-antibody reaction. The fluorochrome labels either an antigen or an antibody. assay performed with the flavivirus-specific monoclonal antibody monoclonal antibody, an antibody that is mass produced in the laboratory from a single clone and that recognizes only one antigen. Monoclonal antibodies are typically made by fusing a normally short-lived, antibody-producing B cell (see immunity) to a fast-growing 4G2 and polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is (PCR PCR polymerase chain reaction. PCR abbr. polymerase chain reaction Polymerase chain reaction (PCR) ) amplification of a 220-bp genome fragment that exhibited 89% nucleotide (nt) sequence homology with the Kyasanur Forest disease virus (KFDV) NS5 gene. Recently, the complete coding sequence cod·ing sequence n. See exon. of AHFV was determined; comparative analysis with other tickborne flaviviruses confirmed that AHFV was most closely related to KFDV, and genetic distances suggested that AHFV was a subtype (programming) subtype - If S is a subtype of T then an expression of type S may be used anywhere that one of type T can and an implicit type conversion will be applied to convert it to type T. of KFDV (5). In this study, 11 human isolates of AHFV, obtained in a 5-year period, were studied. Partial envelope and NS3 and NS5 genes were sequenced for each isolate and used to conduct detailed genetic analyses. The results of these analyses are presented and discussed. Materials and Methods Samples Virus isolation was performed from 1994 to 1999 at the virology virology, study of viruses and their role in disease. Many viruses, such as animal RNA viruses and viruses that infect bacteria, or bacteriophages, have become useful laboratory tools in genetic studies and in work on the cellular metabolic control of gene expression laboratory of Dr. Suliman Fakeeh Hospital in Jeddah from blood samples from 11 patients. After centrifugation Centrifugation A mechanical method of separating immiscible liquids or solids from liquids by the application of centrifugal force. This force can be very great, and separations which proceed slowly by gravity can be speeded up enormously in centrifugal , serum was injected into suckling suckling In mammals, the drawing of milk into the mouth from the nipple of a mammary gland. In human beings, it is referred to as nursing or breast-feeding. The word also denotes an animal that has not yet been weaned—that is, whose access to milk has not yet been mice both intracerebrally or intraperitoneally, and mice were observed twice daily to detect death or signs of illness. Mice showing symptoms were killed, and their brains were harvested, suspended in 10% Hanks balanced salt solution with 20% fetal bovine serum Fetal bovine serum ( or foetal bovine serum) is serum taken from the fetuses of cows. Fetal Bovine Serum (or FBS) is the most widely used serum in the culturing of cells. In some papers the expression foetal calf serum is used. , and centrifuged at 3,000 rpm for 30 min. The supernatant supernatant /su·per·na·tant/ (-na´tant) the liquid lying above a layer of precipitated insoluble material. supernatant the liquid lying above a layer of precipitated insoluble material. was used to inject tissue culture and for passage in another litter of mice. All isolates included in this study have been passaged twice in mice, except isolate 1176, which was passaged twice in mice, 3 times in Vero cells, once in sheep, and finally once in mice. One hundred microliters of mouse brain suspension was mixed with 900 mL of RNA RNA: see nucleic acid. RNA in full ribonucleic acid One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic NOWTM TC-Kit (Biogentex. Inc., Seabrook, TX, USA) and shipped to the Unite des Virus Emergents laboratory in Marseille, France. RNA Purification, Amplification, and Sequencing RNA was purified in a BSL-3 laboratory according to the manufacturer's instructions. Reverse transcription reverse transcription n. The process by which DNA is synthesized from an RNA template. (RT) of virus-specific RNA was carried out at 42[degrees]C in a 20-mL reaction that included 11 mL of RNA extract, 200 U of Superscript Any letter, digit or symbol that appears above the line. For example, 10 to the 9th power is written with the 9 in superscript (109). Contrast with subscript. IITM IITM Indian Institute of Technology Madras (India) IITM Indian Institute of Tropical Meteorology IITM International Institute of Trading Mastery RNase H-Reverse Transcriptase transcriptase /trans·crip·tase/ (-krip´tas) a DNA-directed RNA polymerase; an enzyme that catalyzes the synthesis (polymerization) of RNA from ribonucleoside triphosphates, with DNA serving as a template. (Gibco BRL BRL In currencies, this is the abbreviation for the Brazilian Real. Notes: The currency market, also known as the Foreign Exchange market, is the largest financial market in the world, with a daily average volume of over US $1 trillion. , Life Technologies, Inc., Grand Island, NY, USA), and 1 pmol of primer ALK-NS5R. Truncated noninfectious eDNA molecules were produced. PCR products were generated independently from the envelope, NS3 region, and NS5 region by using ALK-ES/ALK-ER, ALKNS3S/ALK-NS3R, and ALK-NS5S/ALK-NS5R pairs of primers, respectively. PCR reactions were carried out in a volume of 100 mL that included 10 mmol/L Tris-HCl (pH 9.0), 1.5 mmol/L MgC12, 50 mmol/L KCI KCI Kansas City International (airport) KCI Kennel Club of India KCI Key Club International KCI Korea Concrete Institute KCI Kitchener Collegiate Institute KCI Kids Central, Inc. KCI The Kitchen Collection, Inc. KCI Kodak Canada Inc. , 0.1% Triton X100, 200 mmol/L each deoxynucleoside triphosphate triphosphate /tri·phos·phate/ (tri-fos´fat) a salt containing three phosphate radicals. tri·phos·phate n. A salt or ester containing three phosphate groups. , 0.2 mmol/L of each primer, 3 mL of eDNA and 1.5 U of Taq DNA polymerase DNA polymerase /DNA po·lym·er·ase/ (pah-lim´er-as) any of various enzymes catalyzing the template-directed incorporation of deoxyribonucleotides into a DNA chain, particularly one using a DNA template. (Promega Corp., Madison, WI, USA). The thermocycler profile was 5 min at 95[degrees]C, followed by 35 cycles of 30 s at 95[degrees]C, 1 min at 55[degrees]C, and 2 min at 72[degrees]C, and terminated by a final extension for 7 min at 72[degrees]C. PCR products of the expected size were purified from agarose agarose more highly purified form of agar with similar uses to agar and widely used in the separation of nucleic acid fragments. gel slices with the Wizard PCR Preps DNA DNA: see nucleic acid. DNA or deoxyribonucleic acid One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes. Purification System (Promega). Both strands of each PCR product were sequenced directly, with the ABI Abi (ā`bī) [short for Abijah], in the Bible, King Hezekiah's mother. (Application Binary Interface) A specification for a specific hardware platform combined with the operating system. Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit v3.1 on an Applied Biosystems 3730x1 DNA Analyzer (Applied Biosystems, Foster City, CA, USA) at the company Genome Express (Meylan, France). Sequence Data and Phylogenetic phy·lo·ge·net·ic adj. 1. Of or relating to phylogeny or phylogenetics. 2. Relating to or based on evolutionary development or history. Analysis Sequences from the 11 AHFV isolates were compared with homologous sequences representing other tickborne flaviviruses retrieved from the GenBank database: Langat virus Langat virus a tick-borne flavivirus isolated in Malaysia, closely related to other viruses that cause louping ill. (LGTV) (M73835), Powassan virus Powassan virus see flaviviridae. (POWV) (L06436), deer tick deer tick n. Any of several ticks of the genus Ixodes that are parasitic on deer and other animals and transmit the infectious agents of febrile diseases, such as Lyme disease. virus (DTV (Digital TeleVision) Transmitting TV using digital signals. The major DTV standards are ATSC (North America), DVB (Europe) and ISDB (Japan). All three use MPEG-2 video compression and Dolby Digital audio compression. DVB and ISDB also include MPEG audio compression. ) (AF311056), Omsk hemorrhagic fever Omsk hemorrhagic fever see encephalitis. virus (OHFV) (AY323489), Kyasanur Forest disease virus (KFDV) (AY323490 for envelope sequence, and personal data for NS3 and NS5 sequence), tick-borne encephalitis virus tick-borne encephalitis virus n. An arbovirus of the genus Flavivirus that occurs in two subtypes, Central European and Eastern, causing two forms of encephalitis; it is transmitted by ticks. (TBEV TBEV Tick-Borne Encephalitis Virus ) Neudoerfl strain (U27495), Hypr strain (U39392), Vasilchenko strain (L40361), Sofjin strain (AB062064), and Louping ill louping ill an acute encephalomyelitis affecting mostly sheep and red grouse (Lagopus scoticus), but occasionally other domestic animals and humans, caused by a flavivirus and transmitted by Ixodes ricinus. virus (LIV) (Y07863). Nonvectored flaviviruses (Rio Bravo virus [NC_003675] and Apoi virus [NC_003676]) were used to root the phylogenetic tree. The nucleotide sequence alignments were generated with Clustal W 1.7 (6). Nucleotide sequence identities were calculated by the pairwise distance algorithm with the MEGA software program (7). Colinearized sequences derived from envelope, NS3, and NS5 regions were used for studying evolutionary mechanisms. Phylogenetic relationships were determined by using the Jukes-Cantor algorithm combined with either neighbor-joining (NJ) or Minimum Evolution methods implemented in MEGA. Maximum parsimony analyses were also performed in MEGA. The robustness of the resulting branching patterns was tested by bootstrap See boot. (operating system, compiler) bootstrap - To load and initialise the operating system on a computer. Normally abbreviated to "boot". From the curious expression "to pull oneself up by one's bootstraps", one of the legendary feats of Baron von Munchhausen. analysis with 500 replications. Macroevolution and Microevolution Previous data estimated the times of divergence between LIV and other member viruses of the tickborne flavivirus complex on the basis of an analysis of the rates of nonsynonymous substitutions within complete E gene sequences (8). A comparable analysis was performed here with the dataset of colinearized partial envelope, NS3, and NS5 sequences obtained as described above. In a first step, it was shown that, within the group of viruses encompassing LIV, TBEVNEU, TBEVSOF, OHFV, LGTV, KFDV, and POWV, rates of nonsynonymous substitutions in colinearized E-NS3-NS5 sequences are a linear function of rates of nonsynonymous substitutions in complete E gene sequences ([R.sup.2] = 0.995). Distances observed by using nonsynonymous sites were calculated according to the Nei and Gojobori algorithm implemented in MEGA (9). This method allowed plotting genetic distances (non-synonymous substitutions) between colinearized sequences against divergence times calculated by Zanotto et al. (8), which permitted the evaluation of divergence times among AHFV isolates and between AHFV and KFDV. Using the same method, we estimated divergence times between LIV and other tickborne flaviviruses selected in this study. Results Epidemiologic Findings Available epidemiologic data are presented in Table 1. The 11 isolates were recovered during a 5-year period; the first case was recorded in May 1994 and the last in June 1999. Analysis of the seasonal distribution of cases showed that they occurred in 2 peaks, lasting from March to June and from September to October, respectively (Figure 1). All cases occurred in patients originating from Mecca or Jeddah, 2 cities in Saudi Arabia 75 km apart, representing a zone of 5,000 k[m.sup.2]. Sequence Analysis RT-PCR RT-PCR reverse transcriptase-polymerase chain reaction. See PCR1. amplification using primers ALK-ES/ALKER, ALK-NS3S/ALK-NS3R, and ALK-NS5S/ALK-NS5R produced 742-bp, 757-bp, and 723-bp products, respectively (Tables 2). Once primer sequence was excluded, the respective lengths of the sequences included in the study were 699 nt, 713 nt, and 685 nt. These sequences were deposited in GenBank under accession numbers AY727543-AY727575. All AHFV sequences were of the same length, and an optimal alignment was obtained without incorporating any gap. The genetic diversity observed among the 11 strains of AHFV included in this study was up to 0.4%, 0.6%, and 0.9% in E, NS3, and NS5 regions, respectively, and p distance of nonsynonymous substitutions per nonsynonymous sites reached 0% in the envelope, 0.19% in the NS3 gene, and 0.77% in NS5. A total of 21 nt positions were variable, 6 of them associated with a modification of the encoded amino acid amino acid (əmē`nō), any one of a class of simple organic compounds containing carbon, hydrogen, oxygen, nitrogen, and in certain cases sulfur. These compounds are the building blocks of proteins. (Table 3). Fourteen of 28 observed mutations were nonsynonymous and therefore affected the protein sequence. Thirteen were located in the NS5 at nucleotide positions NS5-1679, NS51693, NS5-1720, NS5-1930, and NS5-2096, and 1 was located in NS3 at nucleotide position NS3-1177. The multi-passaged 1176 strain did not develop more mutations than the low-passage isolates. We sequenced the homologous regions of KFDV strain P9605 (corresponding to the first human isolate, isolated from blood in 1957 by Dandavate at the Virus Research Center at Vellore field station) for comparative analysis (R.N. Charrel and X. de Lamballerie, unpub, data). In the 3 regions, the genetic heterogeneity observed between the sequences of the 11 AHFV isolates and KFDV strain was 7.3%-7.6%, 6.6%-7.2%, and 8.2%-8.8% at the nucleotide level for E, NS3, and NS5 regions, respectively. Phylogenetic Analysis Phylogenetic analyses performed independently with envelope, NS3, and NS5 gene sequences did not provide an accurate picture of the recently published topology deduced from complete coding sequences (5,10). Accordingly, a dataset of colinearized sequences was used to increase the discrimination of analysis and provide branching patterns concordant with complete sequence-based analysis. Such procedures were recently reported to reflect adequately complete genome analysis of West Nile virus West Nile virus, microorganism and the infection resulting from it, which typically produces no symptoms or a flulike condition. The virus is a flavivirus and is related to a number of viruses that cause encephalitis. strains (11). Figure 2 represents the phylogenetic reconstruction based on the analysis of E-NS3-NS5 colinearized sequences. All phylogeny algorithms used provided very similar results in term of branching patterns. All AHFV isolates clustered together. Their closest relative was KFDV. The existence of a more divergent lineage common to AHFV and KFDV was supported by a 100% bootstrap value. Discussion Little information exists on seasonal patterns and host preferences of the tick species circulating in Saudi Arabia. However, extensive investigations of the most closely related virus, KFDV, have established that 2 species of ticks (Ixodes petauristae, I. ceylonensis) are involved in viral transmission and that they exhibit different seasonal peaks; similarly, each developmental stage has a peak of activity that corresponds to different seasons. Whether AHFV has similar features is unknown, but if so this finding could account for 2 peaks of cases during the year (8 cases from March to June, 3 cases from September to October). Two additional cases reported through ProMED in 2002 and 2004 (2,4) also occurred in March and April, thus reinforcing the evidence of a peak in frequency in the spring. Camels and sheep are believed to be the hosts that replicate AHFV, but other mammals may be involved in the natural cycle. Recent reports posted on the ProMED Web site suggest that since 1999, additional cases have occurred (3). Accordingly, AHFV is maintained through a cycle that needs to be clarified through veterinary and entomologic en·to·mol·o·gy n. The scientific study of insects. en to·mo·log surveillance programs. As discussed, analysis of genetic
data provided no evidence for multiple introductions of the virus in
Saudi Arabia during the period studled; however, this must be confirmed
with sequence data covering a larger time period.Although the number of reported cases is low, case histories suggest that AHFV may have infected humans through various routes (oral, direct contact, tick bite), as previously demonstrated for other flaviviruses vectored by ticks (12). Based on a questionnaire administered by the physician when a patient was admitted, 3 different modes of infection were considered probable, i.e., skin wound (n = 6), tick bite (n = 2), and consumption of unpasteurized Adj. 1. unpasteurized - not having undergone pasteurization unpasteurised raw camel milk (n = 3). Working as a butcher in a slaughterhouse slaughterhouse: see abattoir; meatpacking. was the occupation with the most exposure; the 6 butchers most probably acquired AHFV infection through skin abrasions or wounds and contact with sheep-infected blood. Although, the 5 other patients did not have clear occupational exposures, 2 of them (or their relatives) reported tick bites shortly before the episode, and the 3 others (or their relatives) reported raw milk consumption. Therefore, these 5 patients may have acquired AHFV infection through tick bite or raw milk consumption, as previously documented for tick-borne encephalitis virus (12,13). Although the human cases were acquired from different sources and through different routes, the clinical and biological features were similar; whether asymptomatic infection may occur is not known and would require seroepidemiologic studies. From 1999 to 2004, the ProMED Web site reported on 3 occasions a total of 9 cases of infection; at least 2 were fatal. The overall rate of death observed with AHFV (6/24, 25%) appears to be much higher than that currently reported for KFDV (3.0%-8.9%) (14,15) and stable during the period 1994-2004. The genetic variability between the different isolates was low regardless of 1) time of the year during which the strain was recovered, 2) disease symptoms in the infected patients, 3) presumed route of infection, and 4) environment in which the patient lived. This pattern was observed for KFDV isolates in India, although these conclusions were established from antigenic methods rather than sequence analyses (14). This evolutionary pattern is consistent with the existence of a recent common ancestral lineage for all AHFV isolates characterized in this study. This lineage went through a period of in situ In place. When something is "in situ," it is in its original location. evolution in this region. The fact that all strains were recovered from humans, after suckling mouse inoculation, could bias the results by acting as a genetic filter. Whether AHFV genetic diversity is as low as implied in this study remains to be seen. This point will only be resolved when strains obtained from cattle, camels, and ticks from Saudi Arabia and neighboring countries are studied. However, because these strains were transmitted to humans through distinct pathways, they do not likely represent a specific genetic cluster Genetic cluster A group of viral strains with very similar, yet distinct, nucleic acid sequences. Mentioned in: Noroviruses associated with a specific pathogenicity. Evolution of AHFV and closely related tickborne flaviviruses was addressed on the basis of previous estimation of the times of divergence of flavivirus species (8) (Figure 3). By using the same method, we estimated that KFDV and AHFV diverged 66-177 years ago. By comparison, the divergence between POWV and DTV, according to the same algorithm, was estimated to have occurred 275-393 years ago, and divergence between TBENEU and LIV occurred 291-411 years ago (estimated 364-498 years ago [8]). Accordingly, the divergence between KFDV and AHFV appears to be a recent event in the evolution of tickborne flaviviruses, comparable with the divergence observed between isolates of LIV (8). Regarding the common ancestor to the AHFV isolates included in this study, and when one takes the life cycle of ticks into account, the algorithm indicated that strains diverged 4-72 years ago, which implies a limited number of generations between this ancestor and the strains currently circulating in Saudi Arabia. [FIGURE 3 OMITTED] The high genetic similarity between all AHFV strains makes designing and developing specific and sensitive RT-PCR diagnostic assays possible. Close antigenic properties are also important for vaccine development. Among the many issues that merit future investigations, cross-protection conferred by KFDV and commercially available tickborne encephalitis virus vaccines should be tested since slaughterhouse workers appear to rank high on the risk scale and therefore may be the first population to benefit from this information. Seroepidemiologic studies are needed in various population groups to determine the extent of AHFV infection and its geographic distribution in the Middle East peninsula (Yemen, Oman). Studies are needed to achieve a better understanding of the natural history of this virus but its pathogenicity in humans, specifically the prevalence of asymptomatic and symptomatic cases. The most important issues to resolve are the origin of the virus, how it is dispersed, and how it came to be in Saudi Arabia so that disease control strategies can be devised. Table 1. Epidemiologic data available for the 11 male patients infected with Alkhurma hemorrhagic fever virus (AHFV) AHFV isolate Date of isolation Nationality Occupation 87 May 1994 Egyptian Butcher 228 May 1994 Egyptian Butcher 1176 September 1995 Egyptian Butcher MOS September 1995 Egyptian Butcher 1209 October 1995 Saudi Soldier 5975 June 1997 Saudi Driver 7344 March 1998 Saudi Engineer 7466 March 1998 Egyptian Butcher 7471 March 1998 Egyptian Butcher 7586 April 1998 Saudi Student 9518 June 1999 Eritrean Poultry worker AHFV isolate Source of infection Origin Outcome 87 Wound Mecca Recovery * 228 Wound Mecca Death 1176 Wound Mecca Death MOS Wound Jeddah Recovery * 1209 Camel raw milk Jeddah Recovery * 5975 Camel raw milk Jeddah Death 7344 Tick bite Jeddah Recovery * 7466 Wound Jeddah Recovery * 7471 Wound Jeddah Recovery * 7586 Tick bite Jeddah Death 9518 Camel raw milk Jeddah Recovery * * Recovery without sequelae. Table 2. Positions of primers used for PCR amplification and sequencing of AHFV genome and resulting sequences * Primer Position, per AHFV PCR product name Sequence prototype sequence size (bp) ALK-ES GGATATGTGTATGATGTCAATAA 1342-1364 742 ALK-ER GCTGCAGTTCAACGAAACCT 2083-2064 ALK-NS3S CAATGAAGCTTATGTTAGTAGC 5064-5085 757 ALK-NS3R CACAAAATCTGGCTTCTCTTCT 5820-5799 ALK-NS5S AGCAAATCCTGCGTTATCTGA 9308-9328 723 ALK-NS5R GTCCCTGCGGGACCCAG 10030-10014 Primer Sequence used for name analysis ([dagger]) ALK-ES 699 ALK-ER ALK-NS3S 713 ALK-NS3R ALK-NS5S 685 ALK-NS5R * AHFV, Alkhurma hemorrhagic fever virus; PCR, polymerase chain reaction. ([dagger]) Primers excluded. Table 3. Mutated positions in the sequences of the 11 AHFV isolates included in the study * Position/ Strain gene Coding ([dagger]) sequence 228 87 mos 1176 1209 E 480 1323 A A A A A 513 1356 G G G G G 579 1422 T T T T T 1062 1905 A A A A A NS3 600 1323 C C C C C 687 1356 T T T T T 714 1422 G G G G G 600 1905 T T T T T 687 1323 C C C C C 714 1356 A A A A G ** 600 1422 T T T T T 687 1905 A A A A A NS5 1079 1323 G G G G C ** *** 687 1356 C C C C C 714 1422 T T C ** *** T T 600 1905 C C C C C 687 1323 A A A A A 714 1356 G G G G A ** *** 600 1422 T T T T T 2096 1905 A A A A T ** *** 2244 9783 C C C C T ** Position/ Strain gene ([dagger]) 5975 7471 7466 7344 7586 E 480 A A G ** A A 513 G G A ** G G 579 T T T T T 1062 G ** A A A A NS3 600 C C T ** C C 687 T T T C ** C ** 714 G G G A ** G 600 C ** T T T T 687 C T ** C C T ** 714 A A A A A 600 C ** T T T T 687 A G ** *** A A A NS5 1079 G G G G G 687 C C C C T ** *** 714 T T T T T 600 C C C T ** C 687 A A A A A 714 A ** *** A ** *** G G A ** *** 600 T T T T T 2096 T ** *** T ** *** A A T ** *** 2244 C C C C C Position/ Strain gene ([dagger]) 9518 E 480 A 513 G 579 C ** 1062 A NS3 600 C 687 T 714 G 600 T 687 C 714 A 600 T 687 A NS5 1079 G 687 C 714 T 600 C 687 G ** 714 A ** *** 600 C ** 2096 T ** *** 2244 C * AHFV, Alkhurma hemorrhagic fever virus. ([dagger]) By reference to the nucleotide sequence of AHFV prototype strain deposited in GenBank under accession number AF331718; ** shaded cell indicates mutated position; *** underlined nucleotides indicate nonsynonymous mutations. Acknowledgments We thank Stuart Nichol, Pierre Rollin, Tom Ksiazek, and Heinz Feldmann for providing noninfectious material of Kyasanur Forest disease virus prototype strain, and the 2 reviewers for their helpful suggestions. This study has been supported by institutional funding from the Institute for Research Development and the French Ministry of Research. References (1.) Zaki AM. Isolation of a flavivirus related to the tick-borne encephalitis complex from human cases in Saudi Arabia. Trans R Soc Trop Med Hyg. 1997;9l:179-81. (2.) Zaki A. Tick-borne flavivirus--Saudi Arabia. ProMEd. Archive number 20020509.4144 May 9, 2002. [cited 7 May 2002]. Available from http://www.promedmail.org (3.) Fagbo S. Dengue/DHF update 2003 (09). ProMED. Archive number 20030303.0532. March 3, 2003. [cited 28 Feb 2003]. Available from http://www.promedmail.org (4.) Zaki A. Alkhurma virus, human death--Saudi Arabia. ProMED. Archive number 20040302.0631. March 2, 2004. [cited 1 Mar 2004]. Available from http://www.promedmail.org (5.) Charrel RN, Zaki AM, Attoui H, Fakeeb M, Billoir F, Yousef Al, et al. Complete coding sequence of the Alkhurma virus, a tick-borne flavivirus causing severe hemorrhagic fever in humans in Saudi Arabia. Biochem Biophys Res Commun. 2001;287:455-61. (6.) Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment A multiple sequence alignment (MSA) is a sequence alignment of three or more biological sequences, generally protein, DNA, or RNA. In general, the input set of query sequences are assumed to have an evolutionary relationship by which they share a lineage and are descended from a aided by quality analysis tools. Nucleic Acids Nucleic acids The cellular molecules DNA and RNA that act as coded instructions for the production of proteins and are copied for transmission of inherited traits. Res. 1997:25:4876-82. (7.) Kumar S, Tamura K, Jakobsen IB, Nei M. MEGA2: molecular evolutionary genetics analysis software. Bioinformatics. 2001;17:1244-5. (8.) Zanotto PM, Gould EA, Gao GF, Harvey PH. Holmes EC. Population dynamics of flaviviruses revealed by molecular phylogenies. Proc Natl Acad Sci USA. 1996;93:548-53. (9.) Nei M. Gojobori T. Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions. Mol Biol Evol. 1986;3:418-26. (10.) Lin D, Li L, Dick D, Shope RE, Feldmann H, Barrett AD, et al. Analysis of the complete genome of the tick-borne flavivirus Omsk hemorrhagic Hemorrhagic A condition resulting in massive, difficult-to-control bleeding. Mentioned in: Hantavirus Infections hemorrhagic pertaining to or characterized by hemorrhage. lever virus. Virology. 2003;313:81-90. (11.) Charrel RN, Brault AC, Gallian P, Lemasson JJ, Murgue B, Murri S, et al. Evolutionary relationship between Old World West Nile virus strains. Evidence for viral gene flow between Africa. the Middle East, and Europe. Virology. 2003;315:381-8. (12.) Gritsun TS, Lashkevich VA, Gould EA. Tick-borne encephalitis. Antiviral antiviral /an·ti·vi·ral/ (-vi´ral) destroying viruses or suppressing their replication, or an agent that so acts. an·ti·vi·ral adj. Res. 2003;57:129-47. (13.) Gresikova M, Sekeyova M, Stupalova S, Necas S. Sheep milk-borne epidemic of tick-borne encephalitis in Slovakia. Intervirology. 1975:5:57-61. (14.) Burke DS, Monath TP. Flaviviruses. In: Knipe DM, Howley PM, editors. Field's virology. 4th ed. Vol. 2. Philadelphia: Lippincott Williams & Wilkins, 2001. p. 1043-25. (15.) Rodrigues FM, Bhat HR, Prasad Prasāda (Sanskrit: प्रसाद), prasād/prashad (Hindi), Prasāda in (Kannada), prasādam (Tamil), or prasadam SR. A new focal outbreak of Kyasanur Forest disease in Beltangadi taluk south Kenara district, Karnataka state. Bulletin of the National Institute of Virology in Pune. 1982;1:6,7. Remi N. Charrel, * Ali Mohamed Zaki, [dagger] Mazen Fakeeh, [dagger] Amany Ibrahim Yousef, [dagger] Reine de Chesse, * Houssam Attoui, * Xavier de Lamballerie * * Universite de la Mediterranee, Marseille, France; and [dagger] Dr. Suliman Fakeeh Hospital, Jeddah, Saudi Arabia Address for correspondence: Remi N. Charrel, Universite de la Mediterranee. Unite des Virus Emergents, 27 bd J Moulin moulin (m lăN`): see pothole. , Marseille,
France 13005; fax: 33-491 32 44 95; email: rnc-virophdm@gulliver.frDr. Charrel is a virologist virologist microbiologist specializing in virology. in a hospital diagnostic laboratory and a university research group. His research interests are arthropodborne and rodentborne viruses that cause disease in humans, with special interest in emerging and reemerging viruses, particularly arenaviruses, flaviviruses, and phleboviruses. |
|
||||||||||||||||||||

to·mo·log
lăN`)
Printer friendly
Cite/link
Email
Feedback
Reader Opinion