Printer Friendly
The Free Library
19,122,084 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Ixodid and argasid tick species and West Nile virus.


Control of West Nile virus West Nile virus, microorganism and the infection resulting from it, which typically produces no symptoms or a flulike condition. The virus is a flavivirus and is related to a number of viruses that cause encephalitis.  (WNV WNV West Nile Virus
WNV World Net Visions
) can only be effective if the vectors and reservoirs of the virus are identified and controlled. Although mosquitoes are the primary vectors, WNV has repeatedly been isolated from ticks. Therefore, tick-borne transmission studies were performed with an ixodid (Ixodes ricinus) and an argasid tick species (Ornithodoros moubata). Both species became infected after feeding upon viremic hosts, but I. ricinus ticks were unable to maintain the virus. In contrast, O. moubata ticks were infected for at least 132 days, and the infection was maintained through molting molting, periodical shedding and renewal of the outer skin, exoskeleton, fur, or feathers of an animal. In most animals the process is triggered by secretions of the thyroid and pituitary glands.  and a second bloodmeal. Infected O. moubata ticks transmitted the virus to rodent hosts, albeit at a low level. Moreover, the virus was nonsystemically transmitted between infected and uninfected O. moubata ticks co-fed upon uninfected hosts. Although ticks are unlikely to play a major role in WNV transmission, our findings suggest that some species have the potential to act as reservoirs for the virus.

**********

The first report of a West Nile virus (WNV) outbreak within the Western Hemisphere occurred in 1999 in New York City New York City: see New York, city.
New York City

City (pop., 2000: 8,008,278), southeastern New York, at the mouth of the Hudson River. The largest city in the U.S.
 and resulted in human, equine, and avian deaths (1). Since 1999, WNV has been found in an additional 44 states of the United States as well as in parts of Canada, the Caribbean, and South America (2,3). During 2002 more than 4,000 people diagnosed with WNV and 284 deaths were reported in the United States (latest records available from: http://www.cdc.gov/ncidod/dvbid/westnile/index.htm).

WNV is a member of the genus Flavivirus that contains over 70 identified viruses. Most of these viruses are vectored by mosquitoes or ticks, although a few have no known vectors (4). WNV has been isolated from 43 species of mosquito in the United States (5), the most important of which is Culex Culex /Cu·lex/ (ku´leks) a genus of mosquitoes found throughout the world, many species of which are vectors of disease-producing organisms.

Cu·lex
n.
 pipiens (6). It has also been isolated from hard (ixodid) and soft (argasid) tick species in regions of Europe Europe is often divided into regions due to geographical, cultural or historical criteria. Some common divisions are as follows. Directional divisions
Groupings by compass directions are the hardest to define in Europe, since (among other issues) the pure geographical criteria
, Africa, and Asia (7-13) where WNV is endemic. Ticks rank second only to mosquitoes in their importance as vectors of human pathogens and transmit a greater variety of infectious agents than any other arthropod arthropod

Any member of the largest phylum, Arthropoda, in the animal kingdom. Arthropoda consists of more than one million known invertebrate species in four subphyla: Uniramia (five classes, including insects), Chelicerata (three classes, including arachnids and horseshoe
 group (14). However, whether or not ticks are major vectors of WNV has not been adequately investigated.

Current strategies to control WNV in the United States are largely based on measures to avoid exposure and to control vector species, but at present only mosquito species are targeted by government surveillance and preventive control programs (15). Resident U.S. tick populations could also play a role in the WNV transmission cycle in the current outbreak. We investigated an argasid tick species and an ixodid tick species for their competence as vectors and reservoirs of the New York strain (NY99) of WNV.

Materials and Methods

Ticks

We tested a hard tick species, Ixodes ricinus, and a soft tick species, Ornithodoros moubata, for their vector competence with WNV (NY99 strain). These species are not native to the United States and were chosen mainly for their availability. O. moubata ticks were considered potential vectors for the Eg101 strain of WNV in a study by Whitman and Aitken in 1960 (16). I. ricinus ticks are the primary vectors of Borrelia burgdorferi, the agent causing Lyme disease in Europe and are important vectors of the flaviviruses tick-borne encephalitis virus tick-borne encephalitis virus
n.
An arbovirus of the genus Flavivirus that occurs in two subtypes, Central European and Eastern, causing two forms of encephalitis; it is transmitted by ticks.
 (TBEV TBEV Tick-Borne Encephalitis Virus ) and Louping ill virus (LIV) (17).

Ticks were taken from colonies reared and maintained for many generations at the Centre for Ecology and Hydrology The Centre for Ecology and Hydrology is a publicly-funded body of the United Kingdom specialising in interdisciplinary scientific research on terrestrial and freshwater environments. , Oxford, according to standard methods (18). Colony ticks were WNV negative by reverse transcriptase-polymerase chain reaction (RT-PCR RT-PCR

reverse transcriptase-polymerase chain reaction. See PCR1.
) testing (15 members of each species tested).

Virus and Viral Assays

The WNV strain used (NY99) was supplied by Robert Shope, University of Texas. High-titer mouse brain suspension stocks of WNV (2.9 x [10.sup.7] PFU/[mL.sup.-1]) were diluted in phosphate-buffered saline (PBS PBS
 in full Public Broadcasting Service

Private, nonprofit U.S. corporation of public television stations. PBS provides its member stations, which are supported by public funds and private contributions rather than by commercials, with educational, cultural,
) to a concentration of [10.sup.5] PFU/[mL.sup.-1] before use. Viral stocks and the serum samples from infected mice were tested for infectious virus by plaque assays on pig kidney epithelial cells as described previously (19), by using a 3% carboxymethylcellulose carboxymethylcellulose /car·boxy·meth·yl·cel·lu·lose/ (-meth?il-sel´u-los) a substituted cellulose polymer of variable size, used as the sodium or calcium salt as a pharmaceutical suspending agent, tablet excipient, and  overlay.

Tick Infection and Co-feeding Transmission Experiments

Seven groups of six BALB/c mice (female, 4-6 weeks old) were injected subcutaneously with [10.sup.4] PFU PFU

plaque-forming unit; in virology, areas of cell lysis (CPE) in monolayer cell culture, under overlay conditions, initiated by infection with a single virus particle.
 of WNV. Three of the mice were bled daily from the tail to follow the course of viremia viremia /vi·re·mia/ (vi-re´me-ah) the presence of viruses in the blood.

vi·re·mi·a
n.
The presence of viruses in the bloodstream.
 by plaque assay. Two groups of mice were infested in·fest  
tr.v. in·fest·ed, in·fest·ing, in·fests
1. To inhabit or overrun in numbers or quantities large enough to be harmful, threatening, or obnoxious:
 with I. ricinus nymphs (20 per mouse); one group was infested 3 days before infection, the other 4 days after infection. The other five groups of mice were infested with second instar INSTAR. Likeness; resemblance; equivalent as, instar dentium, like teeth; instar omnium, equivalent to all.  O. moubata ticks (10 per mouse) on either the same day (day 0) or 1, 2, 3, or 4 days after infection. After the initial experiment, and to increase the number of positive ticks available for experimentation, 12 additional mice were infested with O. moubata 2 days after infection with WNV.

Ticks housed in gauze-covered neoprene neoprene: see rubber.
neoprene

Any of a class of elastomers (rubberlike synthetic organic compounds of high molecular weight) made by polymerization of the monomer 2-chloro-1,3-butadiene and vulcanized (cross-linked, like rubber), by sulfur,
 feeding chambers on mice (18) were removed when fully engorged en·gorge  
v. en·gorged, en·gorg·ing, en·gorg·es

v.tr.
1. To devour greedily.

2. To gorge; glut.

3. To fill to excess, as with blood or other fluid.

v.intr.
, 24 hours after infestation infestation /in·fes·ta·tion/ (-fes-ta´shun) parasitic attack or subsistence on the skin and/or its appendages, as by insects, mites, or ticks; sometimes used to denote parasitic invasion of the organs and tissues, as by helminths.  in the case of O. moubata ticks and 6 days after infestation in the case of I. ricinus nymphs. The engorged ticks were stored at 20[degrees]C in KCl-saturated desiccators until testing for WNV or until ready for a further bloodmeal, as indicated in Table 1. After storage, the ticks (pools and individual ticks) were homogenized ho·mog·e·nize  
v. ho·mog·e·nized, ho·mog·e·niz·ing, ho·mog·e·niz·es

v.tr.
1. To make homogeneous.

2.
a. To reduce to particles and disperse throughout a fluid.

b.
 in 500 [micro]L of PBS by using plastic homogenizers under sterile conditions. The homogenates were frozen and stored at -70[degrees]C until analyzed. Tick homogenates were assayed for infectious virus antigen (by immunofluorescence Immunofluorescence

A technique that uses a fluorochrome to indicate the occurrence of a specific antigen-antibody reaction. The fluorochrome labels either an antigen or an antibody.
 assay) and viral RNA RNA: see nucleic acid.
RNA
 in full ribonucleic acid

One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic
 (by RT-PCR) as shown in Table 1.

Co-feeding transmission experiments were carried out by infesting clean BALB/c mice (n = 7, Harlan, UK) with 10 third instar O. moubata ticks 57 days after they had taken an infectious bloodmeal, and 10 uninfected ticks (second instar) in separate feeding chambers. The two feeding chambers were separated by at least 1 cm.

To investigate tick-to-host transmission, 10 BALB/c mice were infested with cohorts of 5, 10, 15, or 20 third instar O. moubata ticks 57 days after an infectious bloodmeal. Fifteen days after infestation, the mice (including those used for co-feeding) were euthanized; brains were removed, homogenized in 1 mL of sterile PBS, and stored at -70[degrees]C until they were tested for WNV.

Immunofluorescence Assay

Samples of tick (or mouse brain) homogenate homogenate /ho·mog·e·nate/ (ho-moj´in-at) material obtained by homogenization.

homogenate

material obtained by homogenization.
 (100 [micro]L) were used to infect 2 x [10.sup.6] C6/36 mosquito cells in a total of 3 mL L-15 medium containing 7% fetal calf serum (Gibco-BRL, Paisley, UK) in 30 mm Petri dishes that contained glass coverslips. Infected cells were incubated at 28[degrees]C for 3 days. Cells were fixed in cold acetone acetone (ăs`ĭtōn), dimethyl ketone (dīmĕth`əl kē`tōn), or 2-propanone (prō`pənōn), CH3COCH3  and treated according to standard methods (19). Infected cells were fluorescein fluorescein /flu·o·res·ce·in/ (fldbobr-res´en) a fluorescing dye; its sodium salt is used as a tracer in retinal angiography and as a diagnostic aid for revealing corneal trauma and fitting contact lenses.  isothiocyanate-labelled with a broadly reactive flavivirus E-protein monoclonal antibody (MAb 813) (20) or a WNV-specific monoclonal antibody (MAb 546) (21). Labeled cells were visualized by using an Olympus epifluorescence microscope. Uninfected cells were used as negative controls and cells infected with the original viral stock as positive controls. Tick samples were deemed positive when more than 10% of the cells showed specific fluorescence with both monoclonal antibodies.

Nested RT-PCR Assay

RNA was extracted from homogenized samples (100 [micro]L) by using RNAgents total RNA extraction kit in accordance with the manufacturer's instructions (Promega, Madison, WI). cDNA synthesis was carried out with Superscript II reverse transcriptase (Invitrogen, San Diego, CA) and 3'(1) primer (Table 2) for 50 min at 42[degrees]C, in a total volume of 20 [micro]L. PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
 was carried out on the cDNA (1 [micro]L) by using 5'(1) and 3'(1) primers. Nested PCR was carried out on 1 [micro]L of the first-round PCR product using the nested primers 5'(2) and 3'(2). All PCR reactions were carried out in a 50-[micro]L volume with REDTaq DNA polymerase (Sigma Chemical Co., St. Louis, MO). A Hybaid Touchdown thermal cycler was used with the following program: 94.5[degrees]C for 1 min, 30 cycles of 94[degrees]C for 40 s, 56[degrees]C for 1 min, and 72[degrees]C for 1 min, followed by a final extension step of 72[degrees]C for 10 min. Viral stock, RNA extracted from uninfected ticks, and PBS-only samples were used as control reactions. Positive samples gave a PCR product of approximately 1.2 kbp. This method could detect RNA from a viral stock equivalent of 9 PFU (data not shown).

To confirm the identity of RT-PCR products, PCR products were gel purified with QIAquick (Qiagen, Crawley, UK) columns in accordance with manufacturer's instructions. The purified DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 was sequenced with an ABI Abi (ā`bī) [short for Abijah], in the Bible, King Hezekiah's mother.


(Application Binary Interface) A specification for a specific hardware platform combined with the operating system.
 automatic sequencer See MIDI sequencer.

(music) sequencer - Any system for recording and/or playback of music via a programmable memory which stores music not as audio data, but as some representation of notes.
 and the nested primers 5'(2) and 3'(1) and a primer based on the internal sequence of the E gene of WNV (not shown).

Results

Host-to-Tick Transmission

BALB/c mice infected with WNV were weakly viremic 2 and 3 days after injection, with mean titers of 6 x [10.sup.3] and 3 x [10.sup.3] PFU/[mL.sup.-1] blood respectively. After 4 days, viremia was no longer detectable by plaque assay, although severe neurologic disease developed in the mice after 5 or 6 days, and they were euthanized. O. moubata ticks that had led on mice on days corresponding to the viremic period (i.e., days 2 and 3 after infection), but not those fed outside this period, contained viral antigen as measured by immunofluorescence assay (IFA Immunofluorescent assay (IFA)
A blood test sometimes used to confirm ELISA results instead of using the Western blotting. In an IFA test, HIV antigen is mixed with a fluorescent compound and then with a sample of the patient's blood.
) (Table 1). Two days after engorgement engorgement /en·gorge·ment/ (en-gorj´ment)
1. local congestion; distention with fluids.

2. hyperemia.


engorgement

distention.
, 17% (n = 12) I. ricinus ticks that started to feed on hosts 3 days before WNV injection, but not those that had started to feed 4 days after injection, were positive for WNV RNA. When the former group of ticks was tested 28 days later, no evidence of infection was found. Infected O. moubata ticks, in contrast, maintained the virus after molting into the next instar (i.e., third instar); following a second, noninfectious bloodmeal; and after molting a second time into fourth instars. Fifty percent of the individual ticks (n = 14) tested by RT-PCR were positive for WNV RNA when examined 132 days after the initial infectious bloodmeal.

Co-feeding Transmission

Five days after engorgement, 23% (n = 66) of uninfected second instar O. moubata ticks that had co-fed with infected cohorts of third instar ticks on noninfected mice were positive for WNV RNA (Table 1). The remaining unfed ticks (n = 15) were tested after they had molted into third instars, 45 days after co-feeding. Four of these ticks (26%) were positive for WNV RNA. The identities of the PCR products obtained from three positive samples were confirmed by sequence analysis.

Tick-to-Host Transmission

Infected cohorts of O. moubata ticks (third instar) were fed on uninfected mice to investigate tick-to-host transmission. Of the 17 uninfected mice used (including mice used in co-feeding experiments), none showed clinical signs of infection. One of the brains tested, from a mouse infested with an infected cohort of 20 ticks, was positive by RT-PCR but negative when tested by IFA (Table 1). The PCR product was sequenced to confirm the identity of WNV.

Discussion

Laboratory studies from the 1950s suggested that some tick species might serve as competent vectors for WNV. Hurlbut and Taylor (1956) showed that O. savignyi and O. erraticus ticks were infected after feeding on mice inoculated with the Ar-248 strain of WNV, but transmission from infected ticks to mice was not observed (22,23). Vermeil ver·meil  
n.
1. Vermilion or a similar bright red color.

2. Gilded silver, bronze, or copper.

adj.
Bright red in color.
 et al. (1959) infected O. maritimus and O. erraticus ticks by feeding on inoculated (Uganda 28B strain) chickens, guinea-pigs, mice, or gerbils. Infected ticks transmitted the virus to uninfected mice (24). More recently, an artificial membrane system was used to infect Argas arboreus ticks, which were then able to transmit the virus to uninfected hosts, although transstadial transmission of WNV was not observed (25,26).

Our study demonstrated that both I. ricinus and O. moubata ticks become infected with WNV (NY99 strain) through feeding on virus-infected rodent hosts, but only when these hosts were viremic (i.e., systemic transmission). Thirty days after engorgement, we no longer found any evidence of WNV infection in the I. ricinus ticks. This finding suggests that nymphs of this tick species do not support replication of the virus, and therefore are not competent vectors for WNV. By extrapolation, the closely related tick species, I. scapularis (the main U.S. Lyme disease vector) is also unlikely to be a competent vector of WNV, although this hypothesis will need to be confirmed experimentally.

In contrast, infected O. moubata ticks maintained infectious virus for at least 132 days (length of experiment), and WNV persisted transstadially through at least two developmental stages. Evidence for tick-to-host transmission of WNV was found in our study, although the level of infection observed (subclinical subclinical /sub·clin·i·cal/ (sub-klin´i-k'l) without clinical manifestations.

sub·clin·i·cal
adj.
Not manifesting characteristic clinical symptoms. Used of a disease or condition.
) makes assessing its importance without further investigation difficult. Whitman and Aitken (1960) observed much higher levels of transmission from WNV-infected (Eg101 strain) O. moubata ticks to day-old chicks but only when very high feeding densities were used (an average of 49 ticks per chick) (16). Although ticks often feed in large numbers on individual hosts (27), tick-to-host transmission appears to be very inefficient when compared to mosquito transmission of WNV (23). Consequently, this mode of transmission is unlikely to be important in the natural transmission cycle of WNV. Perhaps higher levels of infection (and therefore transmission) would be found with ticks that feed on birds, the natural reservoir hosts of WNV. Some avian species exhibit much higher (> [10.sup.10] PFU/mL serum) and more prolonged viremia when infected with WNV than the mice used for this investigation (28,29). Although neither of the tick species that we tested are obligate obligate /ob·li·gate/ (ob´li-gat) pertaining to or characterized by the ability to survive only in a particular environment or to assume only a particular role, as an obligate anaerobe.  bird feeders, I. ricinus ticks often feed on pheasants in the United Kingdom (30), and several species of Ornithodoros ticks feed almost exclusively on birds, for example, the O. capensis group of ticks that are established along the southern coast of the United States (31). As members of this group have been shown to be competent vectors for WNV (24), these ticks could represent a reservoir of the virus in the United States.

The transmission of flaviviruses such as TBEV and LIV from infected to noninfected ixodid ticks through co-feeding on nonviremic hosts (nonsystemic transmission) is a well-established phenomenon (32). Indeed, this mode of transmission is believed to play a substantial role in the epidemiology of these diseases (27). We tested for co-feeding transmission of WNV between infected and uninfected O. moubata ticks. More than 22% of the uninfected ticks were positive for WNV RNA 5 days after co-feeding. A similar percentage of ticks were positive 40 days later, after having molted to the next developmental stage. As co-fed ticks were in contact with the mice for <24 hours, this finding strongly suggests that WNV was nonsystemically transmitted between infected and uninfected ticks, since viremia had insufficient time to develop. Our study represents the first unequivocal report of co-feeding transmission by an argasid tick species. Argasid ticks, unlike ixodid ticks, typically feed for [less than or equal to] 2 hours. Vesicular stomatitis virus vesicular stomatitis virus A rhabdovirus which replicates in the cytoplasm of infected cells; most VSV victims were in direct contact with oral secretions of infected livestock Clinical Fever, chills, malaise, myalgia, N&V, pharyngitis.  has been transmitted between infected and noninfected co-feeding black flies (Simulium Simulium /Si·mu·li·um/ (si-mu´le-um) a genus of biting gnats; some species are intermediate hosts of Onchocerca volvulus.

Si·mu·li·um
n.
 vittatum), insects that typically feed for 4-5 min (33). Langerhans cells are believed to be the agents of viral transmission between feeding sites of infected and noninfected co-feeding hard ticks (32,34). Langerhans cells, which are susceptible to WNV infection (35), have been shown to migrate rapidly (within 2 hours) from localized antigen-stimulated epidermal Epidermal
Referring to the thin outermost layer of the skin, itself made up of several layers, that covers and protects the underlying dermis (skin).

Mentioned in: Antiangiogenic Therapy, Histiocytosis X


epidermal
 sites (36). Therefore, these cells could possibly play a similar role in the co-feeding transmission of WNV by soft tick species.

Although this study is not exhaustive, it does demonstrate that tick species can become infected with the U.S. strain of WNV through feeding upon infected hosts and through co-feeding with infected ticks on noninfected hosts. In some tick species, WNV can be maintained through the transstadial stages of the tick lifecycle, and infected ticks may be capable of infecting hosts through further feeding. When compared to experimental studies with mosquito species (37-39), ticks are clearly not efficient vectors of WNV and therefore are unlikely to be important vectors for WNV in the current U.S. epidemic. However, our results demonstrate that WNV can persist for a comparatively long time in infected ticks and be transmitted between vertebrate hosts; this finding suggests a reservoir potential of ticks for WNV that justifies further investigation.
Table 1. Results of immunofluorescence assay (IFA) or nested
reverse transcriptase-polymerase chain reaction (RT-PCR) from
Ornithodoros moubata and Ixodes ricinus ticks fed on West Nile
virus-inoculated BALB/c mice or noninfected mice (co-fed ticks)

                                       Days from     Days after
                      Developmental   infection to   engorgement
Species                   stage       infestation        (a)

O. moubata                                 0           1, 2, 7
  First bloodmeal     Second instar        1             1-7
  (infected mice)                          2           1-7, 14
                                           3           1-7, 14
                                           4           1, 3, 7
                      Third instar         2             22
                                           3             22
                                           2             132
  Second bloodmeal    Third instar         2           60 (3)
  (uninfected mice)                        2           64 (7)
                      Fourth instar        2           75 (25)
Uninfected co-fed     Second instar       N/A             5
O. moubata ticks      Third instar        N/A            45
I. ricinus                Nymph            4              2
  First bloodmeal                          -3             2
  (infected mice)                          -3            30
BALB/c mice (d)            N/A            N/A            N/A

                                       Days from
                      Developmental   infection to
Species                   stage       infestation    IFA (b) +/-

O. moubata                                 0            -(8)
  First bloodmeal     Second instar        1            -(5)
  (infected mice)                          2            +(5)
                                           3            +(5)
                                           4            -(5)
                      Third instar         2            +(5)
                                           3            +(5)
                                           2            +(5)
  Second bloodmeal    Third instar         2            +(5)
  (uninfected mice)                        2            +(5)
                      Fourth instar        2            +(5)
Uninfected co-fed     Second instar       N/A            ND
O. moubata ticks      Third instar        N/A            ND
I. ricinus                Nymph            4             ND
  First bloodmeal                          -3            ND
  (infected mice)                          -3            ND
BALB/c mice (d)            N/A            N/A           -(1)

                                       Days from       RT-PCR (c)
                      Developmental   infection to   (no. positive/
Species                   stage       infestation     no. tested)

O. moubata                                 0               ND
  First bloodmeal     Second instar        1               ND
  (infected mice)                          2              +(5)
                                           3              +(5)
                                           4               ND
                      Third instar         2               ND
                                           3               ND
                                           2              7/14
  Second bloodmeal    Third instar         2              +(5)
  (uninfected mice)                        2              +(5)
                      Fourth instar        2              +(5)
Uninfected co-fed     Second instar       N/A            15/66
O. moubata ticks      Third instar        N/A             4/15
I. ricinus                Nymph            4              0/12
  First bloodmeal                          -3             2/12
  (infected mice)                          -3             0/25
BALB/c mice (d)            N/A            N/A             1/17

(a) Number of days after the ticks had completed feeding on inoculated
mice when ticks were tested for virus infection. Where given,
parentheses depict ticks that had fed a second time and the number of
days after which the ticks were tested.

(b) Tick homogenate samples were scored positive if >10% of inoculated
C6/36 cells showed specific fluorescence with both 813 and 546
monoclonal antibodies. Numbers of ticks in each pool are shown in
parentheses.

(c) Where indicated by +, pools ofticks were tested; numbers of ticks
in each pool are shown in parentheses. ND, not done.

(d) Mice were infested with infected O. moubata ticks and after 14 days
were sacrificed and the brain homogenates tested by IFA and RT-PCR.
N/A, not applicable.

Table 2. Nucleotide sequences of primers used in first round (5'[1] and
3'[2]) and second round (5'[2] and 3'[2]) of nested RT-PCR (a)

Primer                    Sequence

5'(1)       CCATATGAATTCCATGAGTGCTATCAATCGGCGGAG
3'(1)    CATATGCGGCCGCTTACTAGGTGATTGATCTGTTGTTCTCC
5'(2)      CATATGCGGCCGCTTACTACCGGTCCATCCAAGCCTC
3'(2)    CCATATAGATCTCGGAGGTCATTCAACTGCCTTGGAATGAGC

Primer                Position in WNV (NY99) (b)

5'(1)    31 as upstream (C gene) from start of PrM gene (373)
3'(1)     31 as downstream (NS1) from end of E gene (2,562)
5'(2)                   Start of E gene (967)
3'(2)                 395 aa into E gene (2,152)

(a) RT-PCR, reverse transcriplase--polymerase chain reaction;
aa, amino acids.

(b) Nucleotide position in relation to complete genome sequence of
WNV (NY99) shown in parentheses (accession no. AF19685).


References

(1.) Lanciotti RS, Roehrig JT, Deubel V, Smith J, Parker M, Steele K, et al. Origin of the West Nile virus responsible for an outbreak of encephalitis in the northeastern United States. Science 1999;286:2333-7.

(2.) Centers for Disease Control and Prevention Centers for Disease Control and Prevention (CDC), agency of the U.S. Public Health Service since 1973, with headquarters in Atlanta; it was established in 1946 as the Communicable Disease Center. . Provisional surveillance summary of the West Nile virus epidemic--United States, January-November 2002. MMWR MMWR Morbidity & Mortality Weekly Report Epidemiology A news bulletin published by the CDC, which provides epidemiologic data–eg, statistics on the incidence of AIDS, rabies, rubella, STDs and other communicable diseases, causes of mortality–eg,  Morb Mortal Wkly Rep 2002;51:1129-33.

(3.) Aiken L. Health Canada "nearly blindsided" by West Nile virus incidence. CMAJ CMAJ Canadian Medical Association Journal  2003;168:756.

(4.) Monath TP, Heinz FX. Flaviviruses. In: Fields BN, Knipe DM, Howley PM, editors. Fields virology virology, study of viruses and their role in disease. Many viruses, such as animal RNA viruses and viruses that infect bacteria, or bacteriophages, have become useful laboratory tools in genetic studies and in work on the cellular metabolic control of gene expression . New York: Lippincott-Raven; 1996. p. 961-1034.

(5.) Centers for Disease Control and Prevention. West Nile virus--entomology [monograph on the Interact]. 2002 [cited 2004 Feb 11]. Available from: http://www.cdc.gov/ncidod/dvbid/westnile/mosquitospecies.htm

(6.) Campbell GL, Marfin AA, Lanciotti RS, Gubler DJ. West Nile virus. Lancet Infect Dis 2002;2:519-29.

(7.) Platonov AE. West Nile encephalitis in Russia 1999-2001: Were we ready? Are we ready? Ann N Y Acad Sci 2001;951:102-16.

(8.) Mathiot CC, Georges AJ, Deubel V. Comparative analysis of West Nile virus strains isolated from human and animal hosts using monoclonal antibodies and cDNA restriction digest profiles. Res Virol 1990;141:533-43.

(9.) Iakimenko VV, Bogdanov, II, Tagil'tsev AA, Drokin DA, Kalmin OB. The characteristics of the relationships of arthropods of the refuge complex with the causative agents of transmissible transmissible /trans·mis·si·ble/ (trans-mis´i-b'l) capable of being transmitted.

trans·mis·si·ble
adj.
Capable of being conveyed from one person to another.
 viral infections in bird rookeries. Parazitologiia 1991;25:156-62.

(10.) L'Vov DK, Dzharkenov AF, L'Vov DN, Aristova VA, Kovtunov AI, Gromashevskii VL, et al. Isolation of the West Nile fever West Nile fever West Nile meningoencephalitis Infectious disease An acute, mosquito-borne flaviviral infection endemic–rarely, epidemic–in the Near East, Africa, former Soviet Union, India Clinical After a 3-6 day incubation, children present with a  virus from the great cormorant The Great Cormorant (Phalacrocorax carbo), known in Australia as the Black Cormorant, is a widespread member of the cormorant family of seabirds. It breeds in much of the Old World and the Atlantic coast of North America.  Phalacrocorax carbo car·bo  
n. pl. car·bos Informal
A carbohydrate.
, the crow Corvus corone, and Hyalomma marginatum ticks associated with them in natural and synanthroic biocenosis bi·o·ce·no·sis also bi·o·coe·no·sis   or bi·o·ce·nose
n. pl. bi·o·ce·no·ses
A group of interacting organisms that live in a particular habitat and form an ecological community.
 in the Volga delta (Astrakhan Astrakhan, city, Russia
Astrakhan (ăs`trəkăn, Rus. ä`strəkhənyə), city (1990 pop. 521,000), capital of Astrakhan region, SE European Russia.
 region, 2001). Vopr Virusol 2002;47:7-12.

(11.) Lvov DK, Timopheeva AA, Smirnov VA, Gromashevsky VL, Sidorova GA, Nikiforov LP, et al. Ecology of tick-borne viruses in colonies of birds in the USSR USSR: see Union of Soviet Socialist Republics. . Med Biol 1975;53:325-30.

(12.) Hoogstraal H. Birds as tick hosts and as reservoirs and disseminators of tickborne infectious agents. Wind Parazytol 1972;18:703-6.

(13.) Hoogstraal H, Clifford CM, Keirans JE, Kaiser MN, Evans DE. The Ornithodoros (Alectorobius) capensis group (Acarina Acarina /Ac·a·ri·na/ (ak?ah-ri´nah) an order of arthropods (class Arachnida), including mites and ticks.

Ac·a·ri·na
n.
: Ixodoidea: Argasidae) of the palearctic and oriental regions. O. (A.) maritimus: identity, marine bird hosts, virus infections, and distribution in western Europe and northwestern Africa. J Parasitol 1976;62:799-810.

(14.) Sonenshine DE. Biology of ticks. Oxford: Oxford University Press; 1991.

(15.) Centers for Disease Control and Prevention. Epidemic/epizootic West Nile virus in the United States: Guidelines for surveillance, prevention, and control. Atlanta: The Centers; 2003.

(16.) Whitman L, Aitken THG THG Tom's Hardware Guide
THG Tetrahydrogestrinone
THG Third Harmonic Generation (laser physics)
THG The Humble Guys (hacker group)
THG The Holmes Group
. Potentiality of Ornithodorus moubata Murray (Acarina, Argasidae) as a reservoir-vector of West Nile virus. Ann Trop Med Parasitol 1960;54:192-204.

(17.) Sonenshine DE, Mather TN. Ecological dynamics of tick-borne zoonoses Zoonoses

Infections of humans caused by the transmission of disease agents that naturally live in animals. People become infected when they unwittingly intrude into the life cycle of the disease agent and become unnatural hosts.
. Oxford: Oxford University Press; 1994.

(18.) Jones LD, Davies CR, Steele GM, Nuttall PA. The rearing and maintenance of ixodid and argasid ticks in the laboratory. Animal Technol 1988;39:99-106.

(19.) Gould EA, Clegg JCS JCS
abbr.
Joint Chiefs of Staff

JCS (US) n abbr (= Joint Chiefs of Staff) → Stabschefs pl 
. Growth, titration and purification of alphaviruses and flaviviruses. In: Malay BWJ BWJ Black Workers for Justice , editors. Virology--a practical approach: Oxford: IRL 1. (jargon, chat) IRL - In real life. Generally synonymous with f2f.
2. (language, robotics) IRL - Industrial Robot Language.
; 1985. p. 43-78.

(20.) Gould EA, Buckley A, Cammack N, Barrett ADT (Asynchronous Data Transfer) A transmission technique used in ISDN PBXs that dynamically allocates bandwidth. See also abstract data type.

ADT - abstract data type
, Clegg JCS, Ishak R, et al. Examination of the immunological relationships between flaviviruses using yellow fever virus yellow fever virus
n.
An arbovirus of the genus Flavivirus that causes yellow fever and is transmitted by mosquitoes.
 monoclonal antibodies. J Gen Virol 1985;66:1369-82.

(21.) Gould EA, Buckley A, Higgs S, Gaidamovich SY. Antigenicity of flaviviruses. In: Archives of virology. Supplementum 1. Calisher CH, editor. Vienna: Springer-Verlag; 1990. p. 137-52.

(22.) Taylor RM, Work TH, Hurlbut HS, Rizk F. A study of the ecology of West Nile virus in Egypt. Am J Trop Med Hyg 1956;5:579-620.

(23.) Hurlbut HS. West Nile virus infection in arthropods. Am J Trop Med Hyg 1956;5:76-85.

(24.) Vermeil C, Lavillaureix J, Reeb E. Sur la conservation et la transmission do virus West Nile par quelques arthropodes. Bull Soc Pathol Exot Filiales 1960;53:273-9.

(25.) Abbassy MM, Stein KJ, Osman M. New artificial feeding technique for experimental infection of Argas ticks (Acari: Argasidae). J Med Entomol 1994;31:202-5.

(26.) Abbassy MM, Osman M, Marzouk AS. West Nile virus (Flaviviridae:Flavivirus) in experimentally infected Argas ticks (Acari:Argasidae). Am J Trop Med Hyg 1993;48:726-37.

(27.) Randolph SE, Miklisova D, Lysy J, Rogers DJ, Labuda M. Incidence from coincidence: patterns of tick infestations on rodents facilitate transmission of tick-borne encephalitis virus. Parasitology Parasitology

The scientific study of parasites and of parasitism. Parasitism is a subdivision of symbiosis and is defined as an intimate association between an organism (parasite) and another, larger species of organism (host) upon which the parasite is
 1999;118:177-86.

(28.) Komar N, Langevin S, Hinten S, Nemeth N, Edwards E, Hettler D, et al. Experimental infection of North American birds <onlyinclude> This list of North American birds is a comprehensive listing of all the bird species known from the North American continent north of Mexico. </onlyinclude>  with the New York 1999 strain of West Nile virus. Emerg Infect Dis 2003;9:311-22.

(29.) McLean RG, Ubico SR, Docherty DE, Hansen WR, Sileo L, McNamara TS. West Nile virus transmission and ecology in birds. Ann N Y Acad Sci 2001;951:54-7.

(30.) Hoodless AN, Kurtenbach K, Nuttall PA, Randolph SE. The impact of ticks on pheasant territoriality Territoriality

Behavior patterns in which an animal actively defends a space or some other resource. One major advantage of territoriality is that it gives the territory holder exclusive access to the defended resource, which is generally associated with
. Oikos 2002;96:245-50. Available from: http://www.ingenta.com

(31.) Keirans JE, Hutcheson HJ, Oliver JH Jr. Ornithodoros (Alectorobius) capensis Neumann (Acari: Ixodoidea: Argasidae), a parasite of seabirds, established along the southeastern seacoast of the United States. J Med Entomol 1992;29:371-3.

(32.) Randolph SE, Gern L, Nuttall PA. Co-feeding ticks: epidemiological significance for tick-borne pathogen transmission. Parasitology Today 1996;12:472-79. Available from: http://www.sciencedirect.com

(33.) Mead DG, Ramberg FB, Besselsen DG, Mare CJ. Transmission of vesicular stomatitis virus from infected to noninfected black flies co-feeding on nonviremic deer mice. Science 2000;287:485-7.

(34.) Labuda M, Austyn JM, Zuffova E, Kozuch O, Fuchsberger N, Lysy J, et al. Importance of localized skin infection in tick-borne encephalitis virus transmission. Virology 1996;219:357-66.

(35.) Johnston LJ, Halliday GM, King NJ. Langerhans cells migrate to local lymph nodes following cutaneous cutaneous /cu·ta·ne·ous/ (ku-ta´ne-us) pertaining to the skin.

cu·ta·ne·ous
adj.
Of, relating to, or affecting the skin.


Cutaneous
Pertaining to the skin.
 infection with an arbovirus arbovirus

Any of a large group of viruses that develop in arthropods (chiefly mosquitoes and ticks). The name derives from “arthropod-borne virus.” The spheroidal virus particle is encased in a fatty membrane and contains RNA; it causes no apparent harm to the
. J Invest Dermatol 2000;114:560-8.

(36.) Weinlich G, Sepp N, Koch F, Schuler G, Romani N. Evidence that Langerhans cells rapidly diasappear from the epidermis in response to contact sensitizers but not to tolerogens/nonsensitizers. In: Arbeitsgemeinschaft Dermatologische Forschung (ADF (1) (Application Development Facility) An IBM programmer-oriented mainframe application generator that runs under IMS.

(2) (Automatic Document Feeder) A paper stacker that feeds one sheet of paper at a time into the unit.
) in cooperation with Deutsche Dermatologische Gesellschaft. XVII meeting. 1989 Nov 17-19. Hamburg, Federal Republic of Germany. Abstracts. Arch Dermatol Res 1990;281:544-91.

(37.) Sardelis MR, Turell MJ, Dohm DJ, O'Guinn ML. Vector competence of selected North American Culex and Coquillettidia mosquitoes for West Nile virus. Emerg Infect Dis 2001;7:1018-22.

(38.) Turell MJ, Sardelis MR, Dohm DJ, O'Guinn ML. Potential North American vectors of West Nile virus. Ann N Y Acad Sci 2001;951:317-24.

(39.) Goddard LB, Roth AE, Reisen WK, Scott TW. Vector competence of California mosquitoes for West Nile virus. Emerg Infect Dis 2002;8:1385-91.

Dr. Lawrie is a postdoctoral researcher in the Nuffield Department of Clinical Laboratory Sciences, University of Oxford. His research interests include identifying and characterizing cancer-associated antigens that are recognized by autologous autologous /au·tol·o·gous/ (aw-tol´ah-gus) related to self; belonging to the same organism.

au·tol·o·gous
adj.
1.
 antibody responses, molecular aspects of the tick-host interface, and transmission of flaviviruses in tick species.

Address for correspondence: Charles H. Lawrie, Nuffield Department of Clinical Laboratory Sciences, Room 5501, Level 5, John Radcliffe Hospital The John Radcliffe Hospital is a large tertiary teaching hospital in Oxford, UK.

It is the main teaching hospital for Oxford University and Oxford Brookes University. As such, it is a well developed centre of medical research.
, Oxford OX3 9DU, United Kingdom; fax: +44 (0)1865-222912; email: charles.lawrie@ndcls.ox.ac.uk

Charles Henderson Lawrie, * Nathalie Yumari Uzcategui, * Ernest Andrew Gould, * and Patricia Anne Nuttall *

* Centre for Ecology and Hydrology, Oxford, United Kingdom
COPYRIGHT 2004 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2004, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Research
Author:Nuttall, Patricia Anne
Publication:Emerging Infectious Diseases
Date:Apr 1, 2004
Words:4510
Previous Article:Maternal malaria and perinatal HIV transmission, Western Kenya (1,2).
Next Article:Antigenic and genetic variability of human metapneumoviruses.
Topics:



Related Articles
West Nile virus transmission in resident birds, Dominican Republic.
Experimental infection of cats and dogs with West Nile virus.
West Nile virus, Guadeloupe.
West Nile virus encephalitis in a Barbary macaque (Macaca sylvanus).
Antibody prevalence of West Nile virus in birds, Illinois, 2002.
West Nile Virus: an overview of its spread in Europe and the Mediterranean basin in contrast to its spread in the Americas.
Novel flavivirus or new lineage of West Nile virus, Central Europe.
Epidemiology and transmission dynamics of West Nile virus disease.
West Nile virus epizootiology, Central Red River Valley, North Dakota and Minnesota, 2002-2005.
West Nile virus antibody prevalence in wild mammals, southern Wisconsin.

Terms of use | Copyright © 2012 Farlex, Inc. | Feedback | For webmasters | Submit articles