Printer Friendly
The Free Library
21,420,022 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Its length polymorphism in oysters and its use in species identification.

ABSTRACT In an effort to develop genetic markers for oyster identification, we studied length polymorphism polymorphism, of minerals, property of crystallizing in two or more distinct forms. Calcium carbonate is dimorphous (two forms), crystallizing as calcite or aragonite. Titanium dioxide is trimorphous; its three forms are brookite, anatase (or octahedrite), and rutile.  in internal transcribed spacers (ITS) between major ribosomal RNA ribosomal RNA
n.
See rRNA.


ribosomal RNA (rī´bōsō´m
 genes in 12 common species of Ostreidae: Crassostrea virginica, C. rhizophorae, C. gigas, C. angulata, C. sikamea, C. ariakensis, C. hongkongensis, Saccostrea echinata, S. glomerata, Ostrea angasi The southern mud oyster or native flat oyster, Ostrea angasi, is endemic to southern Australia, ranging from Western Australia to southeast New South Wales and around Tasmania. , O. edulis, and O. conchaphila. We designed two pairs of primers and optimized PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
 conditions for simultaneous amplification of ITS1 and ITS2 in a single PCR. Amplification was successful in all 12 species, and PCR products were visualized on highresolution agarose agarose

more highly purified form of agar with similar uses to agar and widely used in the separation of nucleic acid fragments.
 gels. ITS2 was longer than ITS1 in all Crassostrea and Saccostrea species, whereas they were about the same size in the three Ostrea species. No intraspecific in·tra·spe·cif·ic   also in·tra·spe·cies
adj.
Arising or occurring within a species: intraspecific competition.
 variation in ITS length was detected. Among species, the length of ITS1 and ITS2 was polymorphic polymorphic - polymorphism  and provided unique identification of 8 species or species pairs: C. ariakensis, C. hongkongensis, C. sikamea, O. conchaphila, C. virginica/C, rhizophorae, C. gigas/C, angulata, S. echinata/S, glomerata, and O. angasi/O, edulis. The ITS assay provides simple, rapid and effective identification of C. ariakensis and several other oyster species. Because the primer sequences are conserved, the ITS assay may be useful in the identification of other bivalve bivalve, aquatic mollusk of the class Pelecypoda ("hatchet-foot") or Bivalvia, with a laterally compressed body and a shell consisting of two valves, or movable pieces, hinged by an elastic ligament.  species.

KEY WORDS: species identification, ribosomal RNA, ITS, genetic marker, oysters, Ostreidae, Suminoe oyster, Crassostrea ariakensis

INTRODUCTION

Oysters cannot be reliably identified using morphological characteristics. Shell coloration col·or·a·tion  
n.
1. Arrangement of colors.

2. The sum of the beliefs or principles of a person, group, or institution.
 and morphology in oysters are highly variable and sensitive to environmental influence. The use of morphological characteristics has led to numerous errors in oyster identification and classification (Harry 1985, Li & Qi 1994). Genetic markers are needed for oyster identification. Oysters often occur sympatrically or are transported around for aquaculture aquaculture, the raising and harvesting of fresh- and saltwater plants and animals. The most economically important form of aquaculture is fish farming, an industry that accounts for an ever increasing share of world fisheries production.  purposes. Accurate identification of oyster species is essential for oyster research and aquaculture. The proposed introduction of Crassostrea ariakensis (Fujita 1913) to Chesapeake Bay Chesapeake Bay, inlet of the Atlantic Ocean, c.200 mi (320 km) long, from 3 to 30 mi (4.8–48 km) wide, and 3,237 sq mi (8,384 sq km), separating the Delmarva Peninsula from mainland Maryland. and Virginia.  adds urgency to the development of effective methods for oyster identification, because C. ariakensis coexists with several closely related species in Asia.

Several types of genetic techniques have been studied for oyster identification. They include cytogenetic cytogenetic /cy·to·ge·net·ic/ (-je-net´ik)
1. pertaining to chromosomes.

2. pertaining to cytogenetics.


cytogenetic

pertaining to or originating from the origin and development of the cell.
 analysis (ThiriotQuievreux & Insua 1992, Li & Havenhand 1997, Leitao et al. 1999, Xu et al. 2001, Wang et al. 2004a), DNA sequencing DNA sequencing

The determination of the sequence of nucleotides in a sample of DNA.
 (Banks et al. 1993, Littlewood 1994, O Foighil et al. 1995, O Foighil et al. 1998, Wang et al. 2004b), restriction fragment length polymorphism restriction fragment length polymorphism
n. Abbr. RFLP
Intraspecies variations in the length of DNA fragments generated by the action of restriction enzymes and caused by mutations that alter the sites at which these enzymes act, changing
 (RFLP RFLP
abbr.
restriction fragment length polymorphism



RFLP

restriction fragment length polymorphism.

RFLP 
) (Cordes et al. 2005, Klinbunga et al. 2005) and multiplex species-specific polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is  (PCR) (Wang & Guo, 2008). Cytogenetic analyses revealed considerable variation among species, but chromosomal differences in general are not useful or practical for species identification. DNA sequencing offers unprecedented power of revealing interspecific in·ter·spe·cif·ic  
adj.
Arising or occurring between species.



interspecific also interspecies  

Arising or occurring between species.

Adj. 1.
 differences, but it is also time-consuming and not readily accessible. RFLP markers require post-PCR digestion with restriction enzymes, which may create additional variation. Multiplex species-specific PCR is more powerful if a large number of species are covered. Simple and effective methods for oyster identification are still needed.

In previous studies, we noticed that some oyster species differed in the length of ITS between major ribosomal genes (Xu et al. 2001, Wang et al. 2004a). To determine the extent of ITS length polymorphism and whether it can be used for oyster identification, we designed a set of primers and studied ITS length polymorphism in 12 species of Ostreidae. Here we report that ITS length is a stable character of species and can be used for the identification of C. ariakensis and seven other species and species groups.

MATERIALS AND METHODS

Primer Design

We downloaded major ribosomal RNA sequences from all available oyster species from GenBank, along with sequences from some other bivalve species. We aligned the sequences to identify conserved sequences flanking ITS1 and ITS2. We designed two pairs of primers targeting ITS1 between 28S and 5.8S, and ITS2 between 5.8S and 18S rRNA genes (Fig. 1, A). The primer sequences for ITS1 are 5'-GTTTCCGTAGGTGAACCTGC (28S forward) and 5'-ACACGAGCCGAGTGATCCAC (5.8S reverse). The primer sequences for ITS2 are 5'-TCTCGCCTGATCTGAGGTCG (5.8S forward) and GCAGGACACATTGAACATCG (18S reverse).

Oyster Species

We used 12 species of Ostreidae that were available to us to test the ITS primer pairs and determine possible length polymorphism (Table 1). Each species was represented by at least five individuals. Whenever possible, individuals from diverse geographic populations were included to test possible intraspecific variation. The 36 C. virginica (Gmelin, 1791) samples covered various sites along the Atlantic and Gulf coasts of the United States United States, officially United States of America, republic (2005 est. pop. 295,734,000), 3,539,227 sq mi (9,166,598 sq km), North America. The United States is the world's third largest country in population and the fourth largest country in area. . The C. rhizophorae (Guilding, 1828) samples were from the first generation progeny of a Caribbean population produced at the Harbor Branch Oceanographic Institute, FL. Four geographic populations of C. gigas (Thunberg, 1793) were represented: one was a Rutgers stock (originated from Japan via Washington State), and the other three were wild and hatchery hatchery

a commercial establishment dedicated to the hatching of bird eggs to provide day old chicks and poults to the poultry industry.


hatchery liquid
the contents of unfertilized eggs. Used in petfood manufacture.
 stocks from Shandong, China. C. angulata (Lamarck, 1819) samples were collected from three sites in southern China. C. sikamea (Amemiya, 1828) samples were from Washington state (originated from Japan) and Xiamen, China. Two populations of C. ariakensis were used, one from Rutgers University Rutgers University, main campus at New Brunswick, N.J.; land-grant and state supported; coeducational except for Douglass College; chartered 1766 as Queen's College, opened 1771. Campuses and Facilities


Rutgers maintains three campuses.
 (originated from Japan via Washington state) and the other from Weifang, China. C. hongkongensis (Lain & Morton 2003) samples were from Guangdong and Guangxi, China. Saccostrea echinata (Quoy & Gairnard, 1835) samples came from Fujian and Guangdong, China. S. glomerata (Gould, 1850) and Ostrea angasi (Sowerby 1871) samples were obtained from Australia. O. edulis (Linnaeus 1758) samples were from Maine, and O. conchaphila (Carpenter 1857) came from Washington state. The identity of most samples from China was confirmed using DNA sequences in a previous study (Wang 2004).

[FIGURE 1 OMITTED]

PCR Condition and Optimization

Genomic DNA genomic DNA
n.
The full complement of DNA contained in the genome of a cell or organism.
 was isolated from 30-50 mg of adductor muscle Noun 1. adductor muscle - a muscle that draws a body part toward the median line
adductor

skeletal muscle, striated muscle - a muscle that is connected at either or both ends to a bone and so move parts of the skeleton; a muscle that is characterized by
 using CTAB CTAB Clear to auscultation bilaterally, see there  (hexadecyltrimethylammonium bromide bromide, any of a group of compounds that contain bromine and a more electropositive element or radical. Bromides are formed by the reaction of bromine or a bromide with another substance; they are widely distributed in nature. ) buffer and phenol/chloroform protocol as described in Doyle & Doyle (1987). Primers for ITS1 and ITS2 were tested separately first, to identify ITS1 and ITS2 fragments. The two primers pairs were then combined to amplify ITS1 and ITS2 in a single-tube PCR. PCR condition was optimized by using different annealing annealing (ənēl`ĭng), process in which glass, metals, and other materials are treated to render them less brittle and more workable.  temperature, and different concentrations of Mg[C1.sub.2]. Different proportions of ITS1 and ITS2 primers were tested for balanced amplification of the two fragments. The optimal PCR condition was identified as: 10 mM Tris-HC1, pH8.3, 50 mM KC1, 1.5 mM of Mg[Cl.sub.2], 0.2 mM each of dNTP, 0.4 mg/mL BSA 1. BSA - Business Software Alliance.
2. BSA - Bidouilleurs Sans Argent.
, 0.05 [micro]M of internal primers, 1 [micro]M of external primers, 0.24 U Taq DNA polymerase DNA polymerase /DNA po·lym·er·ase/ (pah-lim´er-as) any of various enzymes catalyzing the template-directed incorporation of deoxyribonucleotides into a DNA chain, particularly one using a DNA template.  (Promega), 10-25 ng of genomic DNA in a total volume of 10-[micro]L. PCR was conducted on a PE 9700 thermocycler (PE Biosystems) using the follow profile: an initial 5 min denature de·na·ture
v.
1. To change the nature or natural qualities of.

2. To render unfit to eat or drink without destroying usefulness in other applications, especially adding methyl alcohol to ethyl alcohol.

3.
 at 95[degrees]C; 30 cycles of 1 min denature at 95[degrees]C, 1 rain annealing at 60[degrees]C and 1 rain extension at 72[degrees]C; and a final extension at 72[degrees]C for 5 min, and followed by holding at 4[degrees]C. Negative controls, containing no template, were included in each run. PCR products were separated on 1.5% (w:v) high resolution agarose gels and visualized by ethidium bromide Ethidium bromide (sometimes abbreviated as EtBr) is an intercalating agent commonly used as a nucleic acid stain in molecular biology laboratories for techniques such as agarose gel electrophoresis.  (0.5 [micro]g/mL) staining and UV illumination. A 100-bp ladder (Roche) was used as the size standard.

We used one individual from each of the 12 species for PCR optimization The polymerase chain reaction (PCR) is a commonly used molecular biology tool for amplifying DNA, and various techniques for PCR optimization have been developed by molecular biologists to improve PCR performance and minimize failure. . After optimization, we analyzed all individuals listed in Table 1 to detect interspecific and intraspecific differences in ITS length.

RESULTS

PCR Amplification

Amplification of ITS1 and ITS2 were successful in all 12 species tested. ITS1 primers were slightly more efficient, as they produced stronger bands than ITS2 primers under the same condition. In all Crassostrea and Saccostrea species studied, ITS2 are longer than ITS1 (Fig. 1, B). ITS1 varied from about 500-550 bp, and ITS2 ranged from 550-600 bp. In the three Ostrea species, ITS1 and ITS2 appeared to be the same size at around 550 bp.

Simultaneous amplification of ITS1 and ITS2 required optimization. Among different annealing temperatures tested, 60[degrees]C gave the best results. At low annealing temperatures (50[degrees]C and 55[degrees]C), the two primes pairs produced weak bands. Cycle number and magnesium chloride magnesium chloride Warning - High-alert drug!

Chloromag, Mag 64, Mag Delay, Slo-Mag

Pharmacologic class: Mineral

Therapeutic class:
 did not significantly affect amplification. Different ratios of internal and external of primers (1:1, 1:5, 1:20, and 1:50) were tested, and the external: internal primer ratio of 1:20 produced the best results with clear and sharp bands.

Interspecific Differences

Length of both ITS1 and ITS2 were polymorphic among the 12 species studied. Some species can be clearly identified by their unique ITS size, whereas some closely related species cannot be separated. When ITS1 and ITS2 were simultaneously amplified and analyzed, they can distinguish eight species or speciesgroups. First, all three Ostrea species can be separated from Crassostrea and Saccostrea species, because they produced a single band for ITS1 and ITS2, and all oysters from other two genus had two bands (Fig. 1, C). Within Ostrea, O. angasi and O. edulis cannot be separated by ITS length, but both of them were clearly different from O. conchaphila. The two species of Saccostrea can be separated from Crassostrea species. They also differed slightly in ITS length, but the difference was too small to allow reliable separation. Among the 7 Crassostrea species, C. ariakensis, C. hongkongensis and C. sikamea had unique ITS profiles and could be positively identified. C. virginica and C. rhizophorae were almost identical in their ITS length and could not be separated from each other. They could be identified as a pair. Similarly, there was no difference in ITS length between C. gigas and C. angulata, but they could be clearly identified as a pair. In summary, ITS1 and ITS2 profile provided identification of 8 species and species-pairs: C. ariakensis, C. hongkongensis, C. sikamea, O. conchaphila, C. virginica/C, rhizophorae, C. gigas/ C. angulata, S. echinata/S, glomerata, and O. angasi/O, edulis. The assay also separated all three Ostrea species from members of the other two genera.

[FIGURE 2 OMITTED]

Intraspecific Variation

To determine if the size of ITS1 and ITS2 are variable within species, individuals representing diverse populations of each species were analyzed. In C. virginica, 36 oysters collected from 11 sites along the Atlantic and Gulf coasts did not show any detectable variation in ITS length. Similarly, 16 C. gigas that originated from Japan and China had indistinguishable ITS profiles. Five oysters were tested in the other species and none showed any intraspecific difference. The ITS profiles of five individuals from each species are presented in Figure 2.

DISCUSSION

This study shows that the size of ITS1 and ITS2 are conserved within species, but variable among some species of Ostreidae. Small intraspecific variation in ITS size has been observed at the DNA sequence level (Kenchington et al. 2002). At the level of agarose gel electrophoresis Agarose gel electrophoresis is a method used in biochemistry and molecular biology to separate DNA, RNA, or protein molecules by size. This is achieved by moving negatively charged nucleic acid molecules through an agarose matrix with an electric field (electrophoresis). , however, all individuals of the same species are indistinguishable in their ITS size. The individuals that we used were from diverse populations. Some of the populations, such as C. virginica populations from the Atlantic and Gulf coasts, are know to be genetically different (Karl & Avise 1992). Geographically distant populations were represented in several other species. For C. gigas, C. ariakensis and C. sikamea, populations originated from Japan and China were studied. The fact that no intraspecific variation was observed in such diverse samples (Table 1) suggests that ITS size is a stable character for each species and can be used for the purpose of species identification. Although diverse geographic populations are represented, the sample size for most species is small and needs to be expanded. For most Crassostrea species tested here, the lack of intraspecific variation has been confirmed through routine use in our laboratory (see later).

Among species, variation in ITS size is clearly correlated with phylogenetic phy·lo·ge·net·ic
adj.
1. Of or relating to phylogeny or phylogenetics.

2. Relating to or based on evolutionary development or history.
 relationships (i.e., closely related species have the same or similar ITS sizes) whereas distant species differ considerably. All species-pairs that cannot be separated by ITS size, C. gigas/angulata, C. virginica/rhizophorae, S. echinata/ glomerata and O. edulis/angasi, are closely related to each other (Littlewood 1994) and some are even considered as the same species. C. gigas and C. angulata are regarded as same species by some.(Menzel 1974, Buroker et al. 1979), although they are clearly different at the DNA sequence level (Boudry et al. 1998, O Foighil et al. 1998). Kenchington et al. (2002) have suggested that O. edulis and O. angasi may be con-specific based on ITS sequences. There are also suggestions that C. virginica and C. rhizophorae are the same species (Littlewood 1994). Further, ITS size clearly sets the genus Ostrea apart from Crassostrea and Saccostrea. All these data suggest that variation in ITS size is not random, but a function of phylogeny. Whereas ITS sequences are highly variable (Harris & Crandall 2000, Kenchington et al. 2002, He et al. 2005), concerted evolution may favor the conservation of ITS size within species.

This study provides a simple and effective method for the identification of eight species and species groups. Oysters in mixed populations cannot be reliably identified using morphological characters. Simple and reliable methods of oyster are greatly needed for routine identification. The power of molecular techniques for identifying species has been unequivocally demonstrated in many species. Despite their proven effectiveness, molecular techniques are not widely used for oyster identification. This is largely because most current methods are still too labor-intensive or complicated for common use. Compared with available techniques, the ITS assay developed in this study is relatively easy and inexpensive. PCR with ITS primers are highly specific and robust. The combination of ITS1 and ITS2 primers in one reaction provides two measurements of possible differences. The assay is simple and requires no post-PCR treatment. A limitation of the ITS assay is that it cannot identify closely related species. It is possible that the difference between the closely related species is too small to be detected on agarose gels. The use of sequencing gel or automated sequencers may greatly improve the resolution and provide separation of the closely related species. For C. ariakensis and other species, the assay running on regular agarose gel is sufficient. It offers reliable separation of C. ariakensis from C. virginica and common Asian species, providing a useful tool in C. ariakensis research. This assay has been used in our laboratory to separate C. ariakensis from C. virginica, C. hongkongensis, C. sikamea, and C. gigas/C, sikamea, or for hybrid detection (Bushek et al. 2008). Over hundreds of samples analyzed, we have not seen any intraspecific variation in ITS size variation in those species.

Another advantage of the ITS assay is its wide applicability. Because primers are designed using highly conserved sequences, the ITS primers will likely amplify in all oyster species and hence provide possible detection and identification of new or unknown species. The ITS assay is best suited for separating known species with characterized ITS sizes. Caution is needed when the assay is applied to situations where unknown or uncharacterized species are involved. All possible species should be characterized first, and any unexpected ITS length polymorphism should be interrogated to confirm species identity. During the primer design, sequence from other bivalves such as scallops and clams were also considered. It is possible the ITS assay developed here will work in other bivalve species, but further study is needed to determine its usefulness in other bivalves.

ACKNOWLEDGMENTS

We thank Drs. John Scarpa and Haiyan Wang for providing some of the oyster samples. This study is supported by grants from the United States Sea Grant (B/T-9801; R/OD-2003-1), US Department of Agriculture (96-35205-3854), New Jersey Commission on Science and Technology (02-2042-007-11) and China's National Science Foundation (39825121) and 863 Program (2001AA628150). This is publication IMCS-2008-5 and NJSG-08-686.

LITERATURE CITED

Banks, M. A., D. Hedgecock & C. Waters. 1993. Discrimination between closely related Pacific oyster Pacific oyster
n.
An oyster (Crassostrea gigas) cultured in the United States and Europe, having a scalloped shell and a fruity flavor. Also called Portuguese oyster.
 species (Crassostrea) via mitochondrial DNA Mitochondrial DNA (mtDNA) is the DNA located in organelles called mitochondria. Most other DNA present in eukaryotic organisms is found in the cell nucleus. Nuclear and mitochondrial DNA are thought to be of separate evolutionary origin, with the mtDNA being derived from the  sequences coding for large subunit rRNA. Mol. Mar. Biol. Biotechnol. 2:129-136.

Boudry, P., S. Heurtebise, B. Collet, F. Cornette & A. Gerard. 1998. Differentiation between populations of the Portuguese oyster Portuguese oyster

Crassostrea angulata, C. pipas.
, Crassostrea angulata (Lamark) and the Pacific oyster, Crassostrea gigas (Thunberg), revealed by mtDNA RFLP analysis. J. Exp. Mar. Biol. Ecol. 226:279-291.

Buroker, N. E., W. K. Hershberger & K. K. Chew. 1979. Population genetics Population genetics

The study of both experimental and theoretical consequences of mendelian heredity on the population level, in contradistinction to classical genetics which deals with the offspring of specified parents on the familial level.
 of the family Ostreidae. I. Intraspecific studies of Crassostrea gigas and Saccostrea commercialis Saccostrea commercialis

farmed bivalve; called also Sydney rock oyster. See Table 23.
. Mar. Biol. 54:157-169.

Bushek, D., A. Kornbluh, H. Wang, X. Guo, G. DeBrosse & J. Quinlan. 2008. Fertilization interference between Crassostrea ariakensis and Crassostrea virginica: A gamete gamete (găm`ēt): see reproduction.  sink? J. Shellfish Res. 27:591598.

Cordes, J. F., J. B. Stubbs & K. S. Reece. 2005. Phylogenetics phy·lo·ge·net·ics
n.
The study of phylogeny.
 and species identification of Crassostrea oysters based on sequences and PCR-RFLP PCR-RFLP Polymerase Chain Reaction–Restriction Fragment Length Polymorphism  analyses of ITS-1 and COI markers. J. Shellfish Res. 24:647. (Abstract only).

Doyle, J. J. & J. L. Doyle. 1987. A rapid DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 19:11-15.

Harris, D. J. & K. A. Crandall. 2000. Intragenomic variation within ITS1 and ITS2 of freshwater crayfishes (Decapoda: Cambaridae): implications for phylogenetic and microsatellite See miniaturized satellite.  studies. Mol. Biol. Evol. 17:284-291.

Harry, H. W. 1985. Synopsis of the supraspecific classification of living oysters (Bivalvia: Gryphaeidae and Ostreidae). Veliger ve·li·ger  
n.
A larval stage of a mollusk characterized by the presence of a velum.



[New Latin v
 28:121 158.

He, M., L. Huang, J. Shi & Y. Jiang. 2005. Variability of ribosoma; DNA ITS-2 and its utility in detecting genetic relatedness pf pearl oyster. Mar. Biotechnol. 15:40-45.

Karl, S. A. & J. C. Avise. 1992. Balancing selection at allozyme loci loci

[L.] plural of locus.

loci Plural of locus, see there
 in oysters: Implications from nuclear RFLPs. Science 256:100-102.

Kenchington, E., C. J. Bird, J. Osborne & M. Reith. 2002. Novel repeat elements in the nuclear ribosomal RNA operon of the flat oysters flat oysters

Ostrea spp.
 Ostrea edulis C. Linnaeus, 1758 and O-angasi Sowerby, 1871. J. Shellfish Res. 21:697-705.

Klinbunga, S., B. Khamnamtong, N. Puanglarp, P. Jarayabhand, W. Yoosukh & P. Menasverta. 2005. Molecular taxonomy of cupped oysters (Crassostrea, Saccostrea, and Striostrea) in Thailand based on COI, 16S, and 18S rDNA polymorphism. Mar. Biotechnol. 7:306-317.

Leitao, A., C. Thiriot-Quievreux, P. Boudry & I. Malheiro. 1999. A "G" chromosome banding study of three cupped oyster species: Crassostrea gigas, Crassostrea angulata and Crassostrea virginica (Mollusca: Bivavia). Genet genet: see civet. . Sel. Evol. 31:519-527.

Li, X. & J. N. Havenhand. 1997. Karyotype, nucleolus organiser regions. and constitutive heterochromatin in Ostrea angasi (Mollusca: Bivalvia): Evidence of taxonomic relationships within the Ostreidae. Mar. Biol. 127:443-448.

Li, X. & Z. Qi. 1994. Studies on the comparative anatomy comparative anatomy: see anatomy. , systematic classification and evolution of Chinese oysters. Stud. Mar. Sin. 35:143-173. (in Chinese)

Littlewood, D. T. J. 1994. Molecular phylogenetics of cupped oysters based on partial 28S rRNA gene sequences. Mol. Phylogenet. Evol. 3:221-229.

Menzel, R. W. 1974. Portuguese and Japanese oysters are the same species. J. Fish. Res. Board Can. 31:453-455.

O Foighil, D., P. M. Gaffney & T. J. Hilbish. 1995. Differences in mitochondrial mitochondrial

pertaining to mitochondria.


mitochondrial RNAs
a unique set of tRNAs, mRNAs, rRNAs, transcribed from mitochondrial DNA by a mitochondrial-specific RNA polymerase, that account for about 4% of the total cell RNA that
 16S ribosomal gene sequences allow discrimination among American (Crassostrea virginica) and Asian (C. gigas, C. ariakensis) oyster species. J. Exp. Mar. Biol. Ecol. 192: 211-220.

O Foighil, D., P. M. Gaffney, A. E. Wilbur & T. J. Hilbish. 1998. Mitochondrial cytochrome oxidase cytochrome oxidase
n.
An oxidizing enzyme containing iron and a porphyrin, found in mitochondria and important in cell respiration as an agent of electron transfer from certain cytochrome molecules to oxygen molecules.
 I gene sequences support an Asian origin for the Portuguese oyster Crassostrea angulata. Mar. Biol. 131:497-503.

Thiriot-Quievreux, C. & A. Insua. 1992. Nucleolar organizer region variation in the chromosomes of three oyster species. J. Exp. Mar. Biol. Ecol. 157:33-40.

Wang, H. 2004. Studies on the molecular phylogeny and taxonomy of common oysters in China seas. Ph.D. dissertation, Institute of Oceanology, Chinese Academy of Sciences The Chinese Academy of Sciences (CAS) (Simplified Chinese: 中国科学院; Pinyin: Zhōngguó Kēxuéyuàn), formerly known as Academia Sinica , Qingdao, Shandong, China.

Wang, Y., Z. Xu & X. Guo. 2004a. Differences in the rDNA-bearing chromosome divide the Asian-Pacific and Atlantic species of Crassostrea (Bivalvia, Mollusca). Biol. Bull. 206:46-54.

Wang, H., X. Guo, G. Zhang & F. Zhang. 2004b. Classification of jinjiang oysters Crassostrea rivularis (Gould, 1861) from China, based on morphology and phylogenetic analysis. Aquaculture 242: 137-155.

Xu, Z., X. Guo, P. M. Gaffney & J. C. Pierce. 2001. Chromosomal location of the major ribosomal RNA genes in Crassostrea virginica and Crassostrea gigas. Veliger 44:79-83.

YONGPING WANG (1,2) AND XIMING GUO (1) *

(1) Haskin Shellfish Research Laboratory, Institute of Marine and Coastal Sciences The Institute of Marine and Coastal Sciences (IMCS) focuses on marine science-related education and research. IMCS was founded in 1993 on the Cook Campus at Rutgers University in New Brunswick, New Jersey. , Rutgers University, 6959 Miller Avenue, Port Norris, New Jersey Port Norris is a census-designated place and unincorporated area located within Commercial Township, in Cumberland County, New Jersey. It is part of the Vineland-Millville- Bridgeton Primary Metropolitan Statistical Area for statistical purposes.  08349; (2) Experimental Marine Biology Laboratory, Institute of Oceanology, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao, Shandong 266071, People's Republic of China

* Corresponding author. E-mail: xguo@hsrl.rutgers.edu
TABLE 1.

Species and geographic populations of Ostreidae represented
in the ITS study.

           Species              Number         Population/Origin

Crassostrea virginica
  Gmelin                          4      Long Island Sound, USA
                                  4      Delaware Bay, USA
                                  3      Quinby Inlet, VA, USA
                                  3      Chincoteague Bay, VA, USA
                                  3      Pensacola Bay, FL, USA
                                  3      Pass Christian, MS Sound, USA
                                  3      Biloxi Bay, MS Sound, USA
                                  4      Grand Isle, LA, USA.
                                  3      San Antonio Bay, TX, USA
                                  3      Bill Days Reef, TX, USA
                                  3      South Pass Reef, TX, USA
C. rhizophorae Guilding           5      HBOI, FL, USA
C. gigas Thunberg                 7      Rutgers, NJ, USA
                                  3      Penglai, Shandong, China
                                  3      Weihai, Shandong, China
                                  3      Rushan, Shandong, China
C. angulata Lamarck               3      Xiamen, Fujian, China
                                  1      Putian, Fujian, China
                                  1      Wenzhou, Zhejiang, China
C. sikamea Amemiya                3      Washington State, USA
                                  2      Xiamen, Fujian, China
C. ariakensis Fujita              3      Rutgers, NJ, USA
                                  2      Weifang, Shandong, China
C. hongkongensis Lam              4      Zhanjiang, Guangdong, China
  and Morton
                                  1      Beihai, Guangxi, China
Sassostrea echinata               3      Xiamen, Fujian, China
  Quoy et Gaimard
                                  2      Zhanjiang, Guangdong, China
S. glomerata Gould                5      Australia
Ostrea angasi Sowerby             5      Australia
O. edulis Linnaeus                5      Maine, USA
O. conchaphila Carpenter          5      Washington State, USA
COPYRIGHT 2008 National Shellfisheries Association, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2008 Gale, Cengage Learning. All rights reserved.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Author:Wang, Yongping; Guo, Ximing
Publication:Journal of Shellfish Research
Article Type:Report
Geographic Code:9CHIN
Date:May 1, 2008
Words:3539
Previous Article:Identification of Crassostrea ariakensis and related oysters by multiplex species-specific PCR.
Next Article:Classification of common oysters from North China.
Topics:



Related Articles
Widespread null alleles and poor cross-species amplification of microsatellite DNA loci cloned from the Pacific oyster, Crassostrea gigas.
Geographic variation in nuclear genes of the eastern oyster, Crassostrea virginica Gmelin.
Chromosomal mapping of 5S ribosomal RNA genes in the eastern oyster, Crassostrea virginica Gmelin by fluorescence in situ hybridization.
An improved and rapid biochemical identification of indigenous aerobic culturable bacteria associated with Galician oyster production.
The Kumamoto oyster Crassostrea sikamea is neither rare nor threatened by hybridization in the Northern Ariake sea, Japan.
Identification of Crassostrea ariakensis and related oysters by multiplex species-specific PCR.
Classification of common oysters from North China.
Fertilization interference between Crassostrea ariakensis and Crassostrea virginica: a gamete sink?
Assessment of genetic diversity of the eastern oyster Crassostrea virginica in Veracruz, Mexico using microsatellite markers.
Prospect of oyster culture in Pakistan: pathology assessment of two commercially important oyster species.

Terms of use | Copyright © 2013 Farlex, Inc. | Feedback | For webmasters | Submit articles