Printer Friendly
The Free Library
19,111,409 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Isolation and genetic characterization of Rift Valley fever virus from Aedes vexans arabiensis, Kingdom of Saudi Arabia. (Dispatches).


An outbreak of Rift Valley fever Rift Valley fever

An arthropod-borne (primarily mosquito), acute, febrile, viral disease of humans and numerous species of animals. Rift Valley fever is caused by a ribonucleic acid (RNA) virus in the genus Phlebovirus of the family Bunyaviridae.
 in the Kingdom of Saudi Arabia and Yemen in 2000 was the first recognized occurrence of the illness outside of Africa and Madagascar. An assessment of potential mosquito vectors in the region yielded an isolate from Aedes vexans arabiensis, most closely related to strains from Madagascar (1991) and Kenya (1997).

**********

On September 10, 2000, accounts of unexplained hemorrhagic fever in humans and associated illness in livestock along the southwestern border of Saudi Arabia and neighboring Yemen were reported to the Ministry of Health, Kingdom of Saudi Arabia. On September 15, 2000, the Centers for Disease Control and Prevention Centers for Disease Control and Prevention (CDC), agency of the U.S. Public Health Service since 1973, with headquarters in Atlanta; it was established in 1946 as the Communicable Disease Center.  (CDC See Control Data, century date change and Back Orifice.

CDC - Control Data Corporation
), Atlanta, Georgia, confirmed a diagnosis of Rift Valley fever in serum samples submitted by the Ministry of Health. This confirmation marked the first occurrence of Rift Valley fever outside of Africa (1).

Rift Valley fever virus (RVFV RVFV Rift Valley Fever Virus ) is an important veterinary pathogen in Africa causing abortions and deaths in young animals, primarily goats and sheep (2). This mosquito-borne virus can also infect humans by arthropod arthropod

Any member of the largest phylum, Arthropoda, in the animal kingdom. Arthropoda consists of more than one million known invertebrate species in four subphyla: Uniramia (five classes, including insects), Chelicerata (three classes, including arachnids and horseshoe
 blood-feeding or by contact with infected animal fluids and tissues. RVFV infection in humans is generally not apparent or is self-limiting; serious complications including hemorrhagic fever, encephalitis, and retinitis retinitis /ret·i·ni·tis/ (ret?i-ni´tis) inflammation of the retina.

retinitis circina´ta , circinate retinitis circinate retinopathy.
 can occur. Vector-borne virus transmission in Africa is generally associated with periodic heavy rainfall during epizootics and attendant human infections (2).

We conducted an entomologic en·to·mol·o·gy  
n.
The scientific study of insects.



ento·mo·log
 investigation in the Asir, Jizan, and Makkah Regions, north of the suspected origin of the outbreak in Jizan, and in neighboring Yemen. Because this outbreak in the Arabian Peninsula was the first recorded outside of Africa, we wanted to determine the potential arthropod vectors and their larval larval

1. pertaining to larvae.

2. larvate.


larval migrans
see cutaneous and visceral larva migrans.
 habitats. A review of recent human infections indicated that the affected households were located in the foothills and at the base of the Sarawat Mountains. Four locations were selected for arthropod collections, Muhayil, Al Birk, Rijal Alma'a, and Al Majardah, because these areas are representative of the different ecologic habitats from coastal plain to mountainous regions. This fertile plain used for cultivation is known as the Tihamah.

The Study

We collected adult and immature arthropods on December 5-13, 2000, using carbon dioxide--baited CDC miniature light traps and by sampling potential larval habitats with dippers Noun 1. Dippers - a Baptist denomination founded in 1708 by Americans of German descent; opposed to military service and taking legal oaths; practiced trine immersion
Church of the Brethren, Dunkers

Baptist denomination - group of Baptist congregations
. Adult specimens were frozen in liquid nitrogen for later virus testing in Fort Collins, Colorado The City of Fort Collins, a home rule municipality situated on the Cache la Poudre River along the Colorado Front Range, is the county seat and most populous city in Larimer County, Colorado. . To investigate potential vertical transmission of RVFV, mosquito larvae Larvae, in Roman religion
Larvae: see lemures.
 were reared to adults in the malaria control laboratory in Abha, Asir Region, for later virus testing in the United States.

All collection sites were in very arid habitats; the soil is dry and rocky, and Acacia species are the only trees present. Livestock, including goats (the predominant animal), sheep, camels, and cattle, were present at every site. In general, livestock are housed at night very close to the owners' homes. Light traps were hung in and near the residences of recent patients, and the area was examined for larval habitats. Typical larval habitats included wastewater catchments from houses that yielded mainly Culex Culex /Cu·lex/ (ku´leks) a genus of mosquitoes found throughout the world, many species of which are vectors of disease-producing organisms.

Cu·lex
n.
 pipiens complex mosquitoes; pools at the edge of wadis; and small, walled, passively or actively flooded cultivated plots that yielded Aedes vexans arabiensis and Ae. vittatus (3). Ae. (Stegomyia) unilineatus, a mosquito species previously recorded from Africa, India, and Pakistan, was found in light trap collections from several sites (Godsey MS, submitted for publication). The immature and adult arthropod collections are presented in Table 1. The low species diversity and small numbers collected in light traps may have reflected that rainfall was light to nonexistent non·ex·is·tence  
n.
1. The condition of not existing.

2. Something that does not exist.



non
 2 weeks before our collection efforts. We did examine one walled farming plot, which contained water to a depth of approximately 5 cm; it held enormous numbers of Ae. vexans arabiensis larvae and pupae. Overnight, this habitat had dried up to a 2-m diameter pool.

Collected arthropod specimens were identified and placed into pools of up to 50 individual mosquitoes by collection site. A total of 161 pools were triturated, clarified by centrifugation, and spread onto confluent con·flu·ent
adj.
1. Flowing together; blended into one.

2. Merging or running together so as to form a mass, as sores in a rash.
 sheets of Vero cells in six-well plates (4). A single pool (SA01 #1322) yielded a virus isolate. The virus was identified as RVFV by sequencing a DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 fragment amplified from the M segment by reverse transcription-polymerase chain reaction using the primers RVF RVF Rift Valley Fever (febrile disease caused by a virus)
RVF Right Ventricular Failure
RVF Residual Volume Fraction
RVF Rational Valuation Formula (economics) 
3082 5'actttgtgggagcagccgtatctt3' and RVF3400 5'cctgcttcccgcct atcatcaaat3'.

RVFV was isolated from a pool of 37 Ae. vexans arabiensis female mosquitoes collected by light trap at site 3 (N18[degrees] 45.089 min; E41[degrees] 56.373 min) near the city of Muhayil. A human infection was recorded from this site ("Agida"); we also witnessed aborted bovine fetuses on the property. Other arthropods collected at this site included Cx. tritaeniorhynchus and psychodid sandflies.

RVFV is a member of the virus family, Bunyaviridae; the genomes of these viruses exist in three pieces or segments: small (S), medium (M), and large (L). We sequenceda portion of each of the genome segments and analyzed them by the maximum likelihood algorithm in PAUP PAUP Phylogenetic Analysis Using Parsimony  (5) in relation to the published sequences of other geographic isolates to determine the possible origin of the mosquito isolate and whether the isolate was a possible reassortant between two existing virus strains (5,6). Maximum likelihood trees for each genomic segment shared identical topologies (data not shown). The congruence of placement of the Saudi virus strain in the three trees indicated that this virus was not a reassortant. The phylogram for segment M (Figure; Table 2) demonstrates that the most closely related RVFV isolates were from Kenya (1997) and Madagascar (1991). Reasonable hypotheses to explain how RVFV was introduced into the Kingdom of Saudi Arabia (and/ or Yemen) from East Africa are that an infected mosquito was carried over the narrow waterway between the Red Sea and the Gulf of Aden Noun 1. Gulf of Aden - arm of the Indian Ocean at the entrance to the Red Sea
Indian Ocean - the 3rd largest ocean; bounded by Africa on the west, Asia on the north, Australia on the east and merging with the Antarctic Ocean to the south
 by air currents or that infected livestock were imported from East Africa. How long the virus was in the Arabian Peninsula before the epidemic occurred is unknown.

[FIGURE OMITTED]

The most abundant culicine culicine /cu·li·cine/ (ku´li-sin) (ku´li-sin)
1. a member of the genus Culex or related genera.

2.
 mosquitoes we collected were Ae. vexans arabiensis, Cx. pipiens complex, and Cx. tritaeniorhynchus. All three species should be considered important epidemic and epizootic ep·i·zo·ot·ic
adj.
Affecting a large number of animals at the same time within a particular region or geographic area. Used of a disease.



ep
 vectors of RVFV in Saudi Arabia. The floodwater flood·wa·ter  
n.
The water of a flood. Often used in the plural.

floodwater naguas fpl (de la inundación)

floodwater n
 mosquito, Ae. vexans arabiensis, has the potential to be an important epidemic and epizootic vector because of the tremendous numbers of individual mosquitoes that are produced after a flooding rain. Whether or not RVFV is able to persist on the Arabian Peninsula is unknown. Clearly, vertical transmission of the virus in the epidemic mosquito vector would be an important factor to consider.
Table 1. Arthropods collected in the Kingdom of Saudi Arabia,
December 5-13, 2000

Taxon                                                   Female    Male

Specimens reared from larvae and pupae
Aedes vexans arabiensis                                   887      858
Ae. vittatus                                                0        2
Culex pipiens complex                                      67       47

Specimens collected in carbon dioxide-baited light trap
Anopheles dthali                                           50        0
Ae. vexans arabiensis                                     122        0
Ae. vittatus                                                6        3
Ae. aegypti                                                 2        0
Ae. unilineatus                                            18        3
Cx. pipiens complex                                       266      149
Cx. nebulosus                                               1        0
Cx. salisburiensis                                          1        0
Cx. tritaeniorhynchus                                      42        0
Aedes species                                              16        0
Anopheles species                                         142        1
Culex species                                              31        0
Psychodidae                                                61       18
Ceratopogonidae                                            26        3

Table 2. Rift Valley fever virus strains used in the phylogenetic
analyses

Virus designation       Strain name        Geographic origin

SNS UGA44                Smithburn               Uganda
Ar UGA55                   Lunyo                 Uganda
Ar CAR69                 Ar B 1976        Central African Rep.
MP12 EGY77                 MP12                  Egypt
Ar BUF84                Ar D 38457            Burkina Faso
H2 MAU87                 H D 47311             Mauritania
H3 MAU87                 H D 47408             Mauritania
An MAD91                 An Mg 990             Madagascar
B EGY93                  B EGY 93                Egypt
H EGY93                  H EGY 93                Egypt
H KEN97                  384-97.1                Kenya
Ar SA01                  SA01 1322            Saudi Arabia

Virus designation    Year of isolation           Source

SNS UGA44                  1944              Entebbe strain
Ar UGA55                   1955                 Mosquito
Ar CAR69                   1969                 Mosquito
MP 12 EGY77                1977              ZH 548 strain
Ar BUF84                   1984                 Mosquito
H2 MAU87                   1987                  Human
H3 MAU87                   1987                  Human
An MAD91                   1991                  Bovine
B EGY93                    1993                 Buffalo
H EGY93                    1993                  Human
H KEN97                    1997                  Human
Ar SA01                    2001                 Mosquito


Acknowledgments

We thank Abdullah I. Al-Sharif, Abdullah Abu-Dahish, A.M. Khan, and Mr. Maray Yahya for their generous logistical assistance. We would also like to thank Amy Lambert for doing the original reverse transcription-polymerase chain reaction on the isolate.

References

(1.) Centers for Disease Control and Prevention. Outbreak of Rift Valley fever--Saudi Arabia, August-October, 2000. MMWR MMWR Morbidity & Mortality Weekly Report Epidemiology A news bulletin published by the CDC, which provides epidemiologic data–eg, statistics on the incidence of AIDS, rabies, rubella, STDs and other communicable diseases, causes of mortality–eg,  Morb Mortal Wkly Rep 2000;49:905-8.

(2.) Peters CJ. Emergence of Rift Valley fever. In: Saluzzo JF, Dodet B, editors. Factors in the emergence of arboviruses arboviruses (ar´bōvī´rsz),
n.
. Paris: Elsevier; 1997. p. 253-64.

(3.) White GB. Notes on a catalog of Culicidae of the Ethiopian region. Mosquito Systematics systematics: see classification.  1975;7:303-44.

(4.) Miller BR, Nasci RS, Lutwama JJ, Godsey MS, Savage HM, Lanciotti RS, et al. First field evidence for natural vertical transmission of West Nile virus West Nile virus, microorganism and the infection resulting from it, which typically produces no symptoms or a flulike condition. The virus is a flavivirus and is related to a number of viruses that cause encephalitis.  in Culex univittatus complex mosquitoes from Rift Valley Province Rift Valley Province of Kenya, bordering Uganda, is one of Kenya's seven administrative provinces outside Nairobi. Rift Valley Province is the largest and one of the most economically vibrant provinces in Kenya. , Kenya. Am J Trop Med Hyg 2000;62:240-6.

(5.) Swofford DL. PAUP * :Phylogenetic Analysis Using Parsimony par·si·mo·ny  
n.
1. Unusual or excessive frugality; extreme economy or stinginess.

2. Adoption of the simplest assumption in the formulation of a theory or in the interpretation of data, especially in accordance with the rule of
 (* and other methods). Version 4.08b. Sunderland (MA): Sinauer Associates; 1998.

(6.) Sall AA, de A. Aanotto PM, Sene OK, Zeller HG, Digoutte JP, Thiongane Y, et al. Genetic reassortment of Rift Valley fever in nature. J Virol 1999;73:8196-200.

Barry R. Miller, * Marvin S. Godsey, * Mary B. Crabtree, * Harry M. Savage, * Yagob Al-Mazrao, ([dagger]) Mohammed H. Al-Jeffri, ([dagger]) Abdel-Mohsin M. Abdoon, ([dagger]) Suleiman M. Al-Seghayer, ([dagger]) Ali M. Al-Shahrani, ([dagger]) and Thomas G. Ksiazek *

* Centers for Disease Control and Prevention, Atlanta, Georgia, USA; and ([dagger]) Ministry of Health, Riyadh, Kingdom of Saudi Arabia

Dr. Miller is chief of the Virus and Vector Molecular Biology Section, Arbovirus arbovirus

Any of a large group of viruses that develop in arthropods (chiefly mosquitoes and ticks). The name derives from “arthropod-borne virus.” The spheroidal virus particle is encased in a fatty membrane and contains RNA; it causes no apparent harm to the
 Diseases Branch, Division of Vector-Borne Infectious Diseases, Centers for Disease Control and Prevention. His research interests include arboviral ecology, virus-vector interactions, and molecular systematics.

Address for correspondence: Barry R. Miller, Division of Vector-Borne Infectious Diseases, Centers for Disease Control and Prevention, P.O. Box 2087, Fort Collins, CO 80522, USA; fax: 970-221-6476; e-mail: brm4@cdc.gov
COPYRIGHT 2002 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2002, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Author:Ksiazek, Thomas G.
Publication:Emerging Infectious Diseases
Geographic Code:7YEME
Date:Dec 1, 2002
Words:1635
Previous Article:Antimicrobial resistance in Streptococcus pneumoniae, Taiwan. (Synopsis).
Next Article:Rat-to-human transmission of Cowpox infection. (Dispatches).
Topics:



Related Articles
Hitching a ride with imported insects.
Migrant mosquito harbors mysterious virus.
Asian mosquitoes carry dangerous virus.
West Nile Virus Infection in Birds and Mosquitoes, New York State, 2000.
Vector competence of California mosquitoes for West Nile virus. (Research).
Genetic analysis of viruses associated with emergence of Rift Valley fever in Saudi Arabia and Yemen, 2000-01. (Research).
Rift Valley fever virus infection among French troops in Chad. (Letters).
Rift Valley fever in Chad.
Dengue emergence and adaptation to peridomestic mosquitoes.
Nosocomial acquisition of dengue.

Terms of use | Copyright © 2012 Farlex, Inc. | Feedback | For webmasters | Submit articles