Isolation and cloning of cDNA for both IGF-1 R and FSHR genes from mature bovine oocytes of using a few numbers of cells.Abstract This study was conducted in order to follow the expression of two important genes IGF-R and FSHR FSHR Follicle-Stimulating Hormone Receptor FSHR Four Seasons Hotels and Resorts that related to the fertility of bovine during the maturation stage of oocytes (COC See chip on chip. development). We have studied the expression of these two genes in both immature and mature oocytes by isolation of cDNA directly without extraction of RNA RNA: see nucleic acid. RNA in full ribonucleic acid One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic by using small number of cells as a rapid method. In addition, we have isolated these two genes from blood sample as a different source of donor cells via RNA extraction. Our results showed that IGF-1R and FSHR genes are expressed clearly in the mature oocytes if compared with the immature oocytes and these two genes are clearly expressed inside mature oocytes itself. After the isolation and identification by PCR PCR polymerase chain reaction. PCR abbr. polymerase chain reaction Polymerase chain reaction (PCR) and the purification we have cloned the FSHR gene by using pUCm-T vector and have used PMD (Polarization Mode Dispersion) The type of dispersion that occurs in singlemode fiber due to a lack of perfect symmetry in the fiber and from external pressures on the cable. Light travels over singlemode fiber in two polarization states. 18T-simple vector to clone IGF-1R then we make sequencing for these two genes which were isolated from the germ cells. These two genes will be ready for transfection and transfer to other type of cells. Keywords: Gene expression, FSHR, IGF-1 R, fertility, cell cloning, bovine. Introduction Since the first convincing demonstration of somatic cell nuclear transfer Noun 1. somatic cell nuclear transfer - moving a cell nucleus and its genetic material from one cell to another nuclear transplantation, SCNT, somatic cell nuclear transplantation biological research - scientific research conducted by biologists [1] and production of the first transgenic cattle [2] there has been renewed interest in both understanding the concept of nuclear reprogramming and developing more efficient ways of producing animals by nuclear transfer. The production of transgenic animals by germ and somatic cell nuclear transfer have proven to be a more efficient method than other methods such as gene injection or sperm mediation. The vast majority of bovine somatic cell nuclear transfer studies have been initiated with oocytes derived from ovaries collected at slaughter house, though in vitro maturation In vitro maturation (IVM) is the technique of letting Ovarian follicles mature in vitro. Techniques available The ability of in IVM depends on how mature the follicle already is. of oocytes, well established before the advent of somatic cell nuclear transfer as reported earlier by [3]. The transgenic and knock-out technologies have brought a new dimension into studies of gene function in vivo. It is now possible to insert new functional genes, and inactivate in·ac·ti·vate v. 1. To render nonfunctional. 2. To make quiescent. in·ac ti·va and modify the existing ones, in living
organisms. The current animal experiments with gene transfer will
undoubtedly also pave the way to future gene therapy of human diseases.
Reproductive biology has already begun to benefit from the novel transgenic techniques, which have helped elucidate the functions of the gonadotrophin Gonadotrophin Hormones that stimulate the ovary and testicles. Mentioned in: Klinefelter Syndrome gonadotrophin (gōnad´ōtrōf´in), n See gonadotropin. genes, and findings in animals expressing other hormone genes have elucidated functions of the hypothalamic hypothalamic pertaining to the hypothalamus. hypothalamic hormones see hypothalamus. hypothalamic-pituitary-adrenocortical axis pituitary--onadal axis [4]. Follicle-stimulating hormone (FSH FSH follicle-stimulating hormone. FSH abbr. follicle-stimulating hormone Facioscapulohumeral muscular dystrophy (FSH) ) is necessary and sufficient to induce maturation of ovarian follicles to a mature, preovulatory phenotype in the intact animal, resulting in the generation of mature eggs and production of estrogen [5]. These physiological responses to FSH are accomplished by the activation of more than 100 different target genes in granulosa cells [6- 7]. IGF (Internet Governance Forum) An international organization of governments and U.N. agencies that was founded to discuss Internet issues such as security and spam. It was created at the United Nations Summit in 2005 after the U.S. system expression has been largely explored in the bovine follicular fol·lic·u·lar adj. 1. Relating to, having, or resembling a follicle or follicles. 2. Affecting or growing out of a follicle or follicles. wall whereas it remains poorly studied in the COC. Several studies have shown that insulin-like growth factor-1 (IGF-1) plays a role in ovarian folliculogenesis in cattle and other species through paracrine-autocrine regulation. Relationships between follicular-fluid concentration of total IGF-1 and the stage of follicle follicle /fol·li·cle/ (fol´i-k'l) a sac or pouchlike depression or cavity.follic´ular atretic ovarian follicle an involuted ovarian follicle. development have been studied in many species, including cattle [8, 9, 10 and 11] and sheep [12]. The main goal of the current study was to investigate and follow the expression of both FSHR and IGF1R gene in different stages of COC development in the bovine without extracting RNA by using small number of cells as source of germ donor cells and extract these two genes from blood as a source of somatic cells to make a confirmation and comparison the results of gene expression in oocytes. In addition we have cloned and make sequencing for both of FSHR and IGF-1R to study the differences between the two types of donor cells (Germ and somatic cells) for the following study that will be related to the transfer (nuclear transfer) and/or gene transfection of both of two genes to the fertilized oocytes of farm animals for the improvement of the fertility. Materials and Methods Oocyte oocyte /oo·cyte/ (-sit) the immature female reproductive cell prior to fertilization; derived from an oogonium. It is a primary o. prior to completion of the first maturation division, and a secondary o. collection and maturation Ovaries were collected from cows at local abattoir abattoir (ăb'ətwär`) [Fr.], building for butchering. The abattoir houses facilities to slaughter animals; dress, cut and inspect meats; and refrigerate, cure, and manufacture byproducts. and transported at 26-30 [degrees]C within 3-5 hrs from collection to the laboratory in physiological saline supplemented with penicillin-G with sodium salt (100 IU/ml) and streptomycin sulfate (0.2 [micro]g/ml). Oocytes were aspirated from the atretic follicles follicles, n the masses that are embedded in a meshwork of reticular fibers within the lobules of the thyroid gland. See also thyroid gland. ranging in diameter from 2 to 5 mm using 18- gauge needle, into modified-PBS solution. The oocytes were divided into two groups: first group was immature oocytes having no polar body which were subjected to pipetted up and down repeatedly to remove and liberate the compact cumulus cells from the oocyte itself and then washed with PBS PBS in full Public Broadcasting Service Private, nonprofit U.S. corporation of public television stations. PBS provides its member stations, which are supported by public funds and private contributions rather than by commercials, with educational, cultural, solution supplemented with 0.05% polyvinylpyrrolidone polyvinylpyrrolidone /poly·vi·nyl·pyr·rol·i·done/ (-vi?nil-pi-ro´li-don) povidone. polyvinylpyrrolidone see povidone; called also PVP. to apply molecular work and get cDNA. The second group was immature oocytes, they were washed twice using maturation medium (TCM-199, Sigma Chemical Co.) supplemented with foetal calf serum (nFCS), follicle stimulating hormone Follicle stimulating hormone (FSH) A hormone that stimulates the growth and maturation of mature eggs in the ovary. Mentioned in: Polycystic Ovary Syndrome, Premature Menopause (FSH)(Sigma)(0.01 mg/ml), 1 [micro]g/ml 17[alpha] estradiol (Sigma) and Streptomycin/Pencillin (50 ug/ml) (Sigma). Cumulus oocyte complexes (150-250) were introduced into a 35 X 10 mm polystyrene Petri dish containing 2.5 ml of the maturation medium covered with mineral oil and cultured for 22-24 hrs at 38.5 [degrees]C and 5% CO2 in air. Cumulus-oocyte complexes were harvested after 22-24 h of culture. Presence of first polar body and cumulus cells expansion were the criteria for maturation of the oocytes. In vitro matured COCs were treated for 3-4 min with hyaluronidase Hyaluronidase Any one of a family of enzymes, also known as hyaluronate lyases or spreading factors, produced by mammals, reptiles, insects, and bacteria, which catalyze the breakdown of hyaluronic acid. (1 mg/ml in PBS; Sigma) before stripping free of oocytes. After three additional washes in PBS solution provided with "a cells-to-cDNA II" kit (Ambion, Texas, USA), denuded oocytes were transferred in a minimal volume of medium to 1.5 ml tubes. Cumulus cells were also transferred to 1.5 ml tubes and were centrifuged at 17,000 g for 10 min at 4 [degrees]C. The supernatant was discarded. All samples were stored in groups of 5- 7 COCs, at -80 [degrees]C until assayed. Preparation of cell lysates Five to seven oocytes from either immature or mature follicles were washed three times with PBS solution provided with "a cells-to-cDNA II" kit (Ambion, Texas, USA). To make a cell lysate ly·sate n. The cellular debris and fluid produced by lysis. , 50 [micro]l of the cell lysis buffer that was provided in the cells-to cDNA II kit was added to 0.5 ml of small tube containing the pelleted cells and vortexed for 5 min. in order to mix the cells. To lyses ly·ses n. Plural of lysis. the cells, the suspension was heated using a block-type thermal cycler system according to the manufacturer's instructions. DNase digestion and reverse transcript: Cell lysates were supplemented with DNase I provided in the cells-to-cDNA II kit (0.16 IU/[micro]l) of RNase-free certified DNase I with 10 IU/[micro]l. They were then incubated at 37[degrees]C for 5 minutes. Immediately after the end of the incubation, each tube was heated for 15 min at 75[degrees]C to inactivate the DNase. To synthesize the first strand of cDNA as per the cells-to-cDNA II kit protocol, 5 [micro]l cell lysate, 4[micro]1 dNTP Mix, 2 [micro]l oligo dT and 5 [micro]l RNase-free water were assembled in an RNase-free 0.5 ml tube, then heated for 3 min at 70[degrees]C. After this mixture was cooled on ice, 2 [micro]l 10 x RT buffer, 1 [micro]l M-MLV reverse transcriptase and 1 [micro]l RNase inhibitor were added to the reaction tubes. Reverse transcription was carried out for 30 min at 42[degrees]C, followed by incubation at 95[degrees]C for 10 min. RT-minus products with all the reaction components except for the reverse transcriptase were produced for each sample, and were then employed for PCR in order to demonstrate that the template for the PCR product was cDNA, not genomic DNA. RNA Extraction from Blood sample of bovine RNA extraction from blood samples was applied according to the protocol 1 of Molecular Cloning [13] as follows: Remove the medium and rinse the cells with ice cold PBS. Remove PBS and lyse lyse (liz) 1. to cause or produce disintegration of a compound, substance, or cell. 2. to undergo lysis. lyse or lyze v. To undergo or cause to undergo lysis. the cells in 2 ml of solution D, Transfer the cell lysate to polypropylene snap-cap tube. Add 0.1 ml of 2 MSodium acetate, 1 ml of phenol and 0.2 ml of chloroformisoamyl alchol per milliter of solution D and Vortex for 90 seconds. Incubate for 15 minutes on ice and then centrifuge at 9000 rpm for 20 minutes. Add an equal volume of isopropanol isopropanol, isopropyl alcohol, or 2-propanol (ī'səprō`pənōl, ī'səprō`pĭl), (CH3)2CHOH, a colorless liquid that is miscible with water. to the extracted RNA and mix. Allow the RNA at -20[degrees] C for 1 hour or more. Collect the precipitated RNA by centrifugation at 10,000 rpm for 30 minutes at 4[degrees] C. Carefully decant de·cant tr.v. de·cant·ed, de·cant·ing, de·cants 1. To pour off (wine, for example) without disturbing the sediment. 2. To pour (a liquid) from one container into another. the isopropanol and dissolve the RNA pellet in 0.3 ml of solution D for every 1 ml of the medium used. Transfer the solution to a new microfuge tube, vortex it well and precipitate the RNA with 1 volume of isopropanol for 1 hour or more at - 20[degrees], Collect the RNA by centrifugation at maximum speed for 10 minutes at 4[degrees] C. Wash the pellet twice with 75 % ethanol, centrifuge again and remove any remaining ethanol. Add 50- 100 ul of DEPEC-treated water. Store the RNA at -70[degrees] C till use. PCR cycles programs for FSHR and IGF-1 The primers for FSHR, and IFG-1R were designed using the Gene Bank sequences (accession numbers: AF176811 and X15726 respectively) according to [14] were synthesized by Shanghi Sangon Biological Engineering Technology and Services Co., Ltd as follow: For IGF-1 Sense: AAGCTGAGAAGCAGGCAGAG Anti- sense: CGGAGGTTGGAGATGACAGT (E coR-1 and Hind III) are the restriction site) For FSH Sense: GCCAAGTCAACTTACCGCTT Anti- sense: TGACCCCTAGCCTGAGTCAT (E coR-1 and Xho) are the restriction site) The PCR was performed in a light Cycler Elmer machine. The basic protocol for PCR was an initial incubation at 94[degrees]C for 2 min to activate modified Taq polymerase. Thirty-five cycles of PCR were carried out with denaturation denaturation, term used to describe the loss of native, higher-order structure of protein molecules in solution. Most globular proteins exhibit complicated three-dimensional folding described as secondary, tertiary, and quarternary structures. at 94[degrees]C for 30 Sec, then at annealing annealing (ənēl`ĭng), process in which glass, metals, and other materials are treated to render them less brittle and more workable. temperature 57[degrees]C for 30 Sec for IGF-1 and 55 [degrees]C for FSHR, and then extended at 72[degrees]C for 30 Sec. The RT-minus control from the previous step and minus-template PCR control were included in each reaction of PCR as negative controls. The minus-template PCR should have all the PCR components, with water substituted for the RT reaction aliquot aliquot (al-ee-kwoh) adj. a definite fractional share, usually applied when dividing and distributing a dead person's estate or trust assets. (See: share) , thus verifying that none of the PCR reagents are contaminated with DNA DNA: see nucleic acid. DNA or deoxyribonucleic acid One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes. . PCR products were detected on 2 % agarose gel electrophoresis Agarose gel electrophoresis is a method used in biochemistry and molecular biology to separate DNA, RNA, or protein molecules by size. This is achieved by moving negatively charged nucleic acid molecules through an agarose matrix with an electric field (electrophoresis). to get the fragments of FSHR and IGF-1R to use them in the cloning. Cloning of FSHR and IGF-1R The PCR product was purified and verified by agarose gel analysis for the presence of a single cDNA band for both IGF-1R and FSHR before proceeding with cloning and sequencing using purification kit. Both FSHR and IFG-1R genes were ligated to pUCm-T vector (From 160 Torbay Road Markham Ontario L3R1G6, Canada) then were transformed in LB Medium for overnight then the plasmids were extracted and subjected to two types of restriction enzymes E. coR-1 and Xho for FSHR then make run PCR program to isolate our genes of interest. We have used other vector PMD18T- simple vector (made by Takara Company, China) for the ligation and transformation of IGF-1R gene and have used E coR-1 and Hind III as restriction enzymes after ligation. Sequencing of both FSHR and IGF-1R and Sequence Analysis After the ligation and transformation in LB medium, the transformed that have the cDNA fragments for both FSHR and IGF-1R were applied to the sequencer (Sangon campony--China) to compare our results with that in gene bank. Results Maturtion of Oocytes After the time of culture (22-24 h) we used T test and recorded the maturation rate of oocytes. The mean value of maturation rate was 39.8 [+ or -] 1.5 and 83.6 % (Fig.1). [FIGURE 1 OMITTED] Expression of FSHR and IGF-1R during COC development via cDNA kits Results showed that FSHR and IGF-1R were expressed clearly in the maturation stage than in immatured stage. They did not express either in immature oocyte itself or the compact cumulus cells (Figure 2). Isolation of FSHR and IGF-1R from Blood by extracting mRNA We isolated both of FSHR and IGF-1R via extracting mRNA from the blood sample of bovine to further study and make a confirmation of results of the isolation of these two genes from COC via cDNA dirctly (Fig 3). In addition for the next study that related to the cloning, sequencing and gene transfer Cloning of FSHR and IGF-1R FSHR was cloned into pUCm-T vector and used the restriction enzymes E coR-1 and Xho to get the fragment of FSHR gene after ligation and transformation. We used other vector with IGF-1R (PMD18T- simple vector) to clone IGF-1R and used E coR-1 and Hind III after ligation and transformation in LB to get the fragment of this gene (Fig. 4 and 5). [FIGURE 2 OMITTED] [FIGURE 3 OMITTED] [FIGURE 4 OMITTED] Sequencing of both FSHR and IGF-1R and Sequence Analysis Sequencing reactions were then analyzed on an ABI Abi (ā`bī) [short for Abijah], in the Bible, King Hezekiah's mother. (Application Binary Interface) A specification for a specific hardware platform combined with the operating system. Prism 310 sequencer available at (Sangon-China) using 'proof-reading' Taq-polymerase. Nucleic acid sequences were analyzed using the basic local alignment search tool (BLAST) against GenBank data banks (NR and EST EST electroshock therapy. EST abbr. electroshock therapy ). A cDNA sequence for both FSHR and IGF-1R were considered near to homologous to a GenBank sequence when at least 100 base pairs (bp) matched with an E probability value of less than [e.sup.-10] with very little abnormalities. In the second round of the work we will do more focusing about the sequence analysis of these two genes in related to the method which is used to isolate these genes (cDNA and mRNA) and the donor cells making a comparison between them to be ready for gene transfer or gene transfection. Discussion In this work, we have investigated spatial and temporal expression of the IGF-1R and FSHR via cDNA within bovine COC during oocyte maturation without extraction of RNA. Our results are from a few studies that show cell-specific localization as well as concomitant changes in the IGF-1 and FSH receptors expression during the maturation of somatic and germinal Germinal conflict of capital vs. labor: miners strike en masse. [Fr. Lit.: Germinal] See : Riot Germinal portrays the sufferings of workers in the French mines. [Fr. Lit. compartments of bovine COC. We have investigated the expression of FSHR and IGF1 R receptors within bovine COC during oocyte maturation by using small number of cells. Our results showed a similar results and in agreement with [15] who have developed an easy and rapid method for measuring gene expression in a small number of cells by real-time PCR without RNA extraction and purification, and to use this method to determine more precisely IGF-I IGF-I see somatomedin C. IGF-I Insulin-like growth factor I, somatomedin-C A polypeptide hormone structurally similar to proinsulin, synthesized in the liver and fibroblasts, giving fibroblasts a paracrine function; serum levels correlate with gene expression in the cumulus cells surrounding oocytes. So we have suggested that this easy and rapid method can be established and useful to solve the problem of the small number of the ovaries of cattle in the slaughter house. Our results showed cell-specific localization in the FSHR and IGF1R during the maturation of somatic and germinal compartments of bovine COC. It has previously been demonstrated the expression of mRNAs for IGFR-I and FSHR in mural granulosa cells of bovine follicles as were studied by [16, 17, 18, 19 and 20] but contradicting the results of expression of these genes couldn't be identified in cumulus cells rather was limited to oocytes. The lack of detection of IGF-1 mRNA in the bovine ovary as mentioned before by [21] may be confirmed by our results where we found that both of IGF-1R and FSHR clearly expressed only in the mature oocytes only after 22- 24 hours of culture. Indeed this two genes did not expressed either in the immature oocytes itself or its compact cumulus cells. Where [21] suggest that one day after luteinization luteinization /lu·te·in·iza·tion/ (-in?i-za´shun) the process by which a postovulatory ovarian follicle transforms into a corpus luteum through vascularization, follicular cell hypertrophy, and lipid accumulation, the latter in some in vivo, full-length FSH-receptor mRNA was detectable at low levels in the newly-formed corpus luteum, their results showed that granulosa cell luteinization in cattle is associated with a change in splicing of the FSH-receptor primary transcript. Conversely, the faint and transitory specific signal of IGF-1 mRNA detected in bovine oocytes at the onset of in vitro maturation which was detected by [22] using PCR analysis is in agreement with our results. Morever Mary Hunzicker-Dunn and Evelyn T. Maizels, C (2006) [5] have investigated that FSH receptors are located exclusively on granulosa cells in females that drives the proliferation, growth and differentiation of granulosa cells. They have concluded that this investigation was characterized by: increased vascularization vascularization /vas·cu·lar·iza·tion/ (vas?ku-ler-i-za´shun) 1. the process of becoming vascular. 2. angiogenesis. 3. the surgically induced development of vessels in a tissue. of the theca theca /the·ca/ (the´kah) pl. the´cae [L.] a case or sheath.the´cal theca folli´culi internal layer of cells peripheral to the basal lamina, formation of a fluid-filled antrum antrum /an·trum/ (an´trum) pl. an´tra, antrums [L.] a cavity or chamber.an´tral cardiac antrum within the maturing follicle, and development of two "classes" of granulosa cells with distinct polarities and gene expression (the cumulus granulosa cells that surround the oocyte and mural granulosa cells that are peripheral to the antrum and line the basal lamina). Morever, In agreement with our investigation, [23] have concluded that transcriptional events initiated by FSH did not occur when COCs resumed meiosis spontaneously in the presence of hCG in bovine. These findings strongly suggest that gene expressions in the surrounding cumulus cells are essential for the meiotic meiotic pertaining to meiosis. granulosa cell luteinization in cattle and is associated with a change in splicing of the FSH-receptor as was also described by [24]. According to the study of both [23] and [24] they have suggest that this process resembles, in reverse, the changes in FSH-receptor transcript splicing during development of the gonads The prenatal development of the gonads is a part of the development of reproductive system and sultimately forms the testes in males and ovaries in females. They initially develop from the mesothelial layer of the peritoneum. . According to study of [25] who have investigated the potential role of the oocyte in modulating proliferation and basal, FSH-induced and insulin-like growth factor insulin-like growth factor one of the twenty or so substances, additional to the classic bone-regulating hormones, which exert an effect on bone cell metabolism. See also somatomedin C. (IGF)-induced secretion of inhibin in·hib·in n. A peptide hormone secreted by the follicular cells of the ovary and the Sertoli cells of the testis that inhibits secretion of follicle stimulating hormone from the anterior pituitary. A (inh A), activin activin /ac·ti·vin/ (ak´ti-vin) a nonsteroidal regulator synthesized in the pituitary glands and gonads that stimulates the secretion of follicle-stimulating hormone. ac·ti·vin n. A (act A), follistatin (FS), estradiol ([E.sub.2]), and progesterone ([P.sub.4]) by mural bovine granulosa cells. They have concluded that in the absence of FSH or IGF, co-culture with oocytes had no effect on any of the measured hormones, although cell number was increased up to 1.8-fold. The bovine oocytes secrete a factor(s) capable of modulating granulosa cell proliferation and responsiveness to FSH and IGF in terms of steroidogenesis steroidogenesis /ste·roi·do·gen·e·sis/ (ste-roi?do-jen´e-sis) production of steroids, as by the adrenal glands.steroidogen´ic ste·roid·o·gen·e·sis n. The biological synthesis of steroids. and production of inhibin-related peptides, bovine oocytes express TGF TGF transforming growth factor. but not EGF, and TGF is a prime candidate for mediating the actions of oocytes on bovine granulosa cells as was described by [25]. Insulin-like growth factor-I and gonadotropins are synergistic for growth and differentiation of the follicle, follicular growth and steroidogenesis in postpartum cattle, therefore, should be correlated with greater LH secretion as well as greater blood IGF-I concentrations [26-27]. Consistent with previous studies demonstrating expression of IGF-IR and FSHR in COC development of bovine, expression of FSHR and IGF-1R were identified in mature oocytes rather than immature oocytes or the compact cumulus cells of both immature and mature oocytes. Our results for isolating IGF-1 and FSHR genes from the blood sample are in corresponding with the following conclusion of [28] where he has suggested that ovarian IGF are a composite of IGF from both endocrine (liver) and autocrine autocrine /au·to·crine/ (-krin) denoting a mode of hormone action in which a hormone binds to receptors on and affects the function of the cell type that produced it. au·to·crine adj. and paracrine paracrine /para·crine/ (par´ah-krin) 1. denoting a type of hormone function in which hormone synthesized in and released from endocrine cells binds to its receptor in nearby cells and affects their function. 2. (ovary) sources. The IGF stimulate ovarian function by acting synergistically syn·er·gis·tic adj. 1. Of or relating to synergy: a synergistic effect. 2. Producing or capable of producing synergy: synergistic drugs. 3. with gonadotropins to promote growth and steroidogenesis of ovarian cells. [29, 30] have concluded that somatic cloned animals have been associated with aberrant gene expression (, as well as developmental abnormalities and high neonatal death rates, our study will compare the abnormalities that will occurr in this two sources of donors after the gene sequencing and transfer in the following study. Where their findings have suggested the incomplete reactivation of some inactivated inactivated rendered inactive; the activity is destroyed. inactivated viruses treated so that they are no longer able to produce evidence of growth or damaging effect on tissue. genes from the differentiated somatic donor cells. Thus in the second round of the work we will do more focusing about the sequence analysis of these two genes in regard to the method used to isolate these genes (cDNA or mRNA) and the donor cells to be ready for gene transfer or gene transfection Conclusion The results presented here clearly demonstrate a rapid method for identification of both FSHR and IGF 1R expression during COC development without extracting mRNA. The expressions of these two genes were restricted to mature oocytes only. In addition we have cloned and sequenced cDNA clones of these two genes from the germ cells for the further study. Furthermore, they provide evidence for a cell-specific pattern of FSHR and IGF family member gene expression suggesting interactions between somatic and germinal cells. Finally, the concomitant investigation of the pattern of the IGF-1 and FSH receptor expression during the differentiation of COC provides further information on the possible synergistic actions between IGF-1 and FSH. Acknowledgement We thank the staff and members of College of Animal Science and Technology, Huazhong Agricultural University- China) for their assistance and generous donation of materials used in this study specially the members of the office of Animal Husbandry Program for their financial support to this work. References [1] Wilmut, I., Schnieke, AE., McWhir, J., Kind, AJ., and Campbell, KH., 1997. "Viable offspring derived from fetal and adult mammalian cells". Nature. 385, 810- 813. [2] Cibelli, JB., Stice, SL., Golueke, PJ., Kane, JJ., and Jerry, J., Ponce LF., and Robl, JM., 1998. "Cloned transgenic calves produced from nonquiescent fetal fibroblasts Fibroblasts A type of cell found in connective tissue; produces collagen. Mentioned in: Skin Grafting ". Science 280, 1256-1258. [3] Bruggerhoff K, Zakhartchenko V, Wenigerkind H, Reichenbach HD, Prelle K, Schernthaner W, Alberio R, Kuchenhoff H, Stojkovic M, Brem G, Hiendleder S, Wolf E. 2002. "Bovine somatic cell nuclear transfer using recipient oocytes recovered by ovum pick-up: Effect of maternal lineage of oocyte donors". Biol Reprod 2002, 66: 367-373. [4] Hill, JR., Winger, QA., Long, CR., Looney, CR., Thompson, JA. and Westhusin, ME., 2000. "Development rates of male bovine nuclear transfer embryos derived from adult and fetal cells". Biol. Reprod. 62, 1135-1140. [5] Hunzicker-Dunn M, Maizels ET. 2006. "FSH signaling pathways in immature granulosa cells that regulate target gene expression: branching out from protein kinase A". Cell Signal. 2006, 18(9):1351-9. [6] Humpherys, D., Eggan, K., Akutsu, H., Hochedlinger, K., Rideout, W. M., III, Biniszkiewicz, D., Yanagimachi, R. & Jaenisch, R. 2001. Science 293, 95-97. [7] Humpherys, D., Eggan, K., Akutsu, H., Friedman, A., Hochedlinger, K., Yanagimachi, R., Lander, E. S., Golub, T. R. & Jaenisch, R. 2002.Proc. Natl. Acad. Sci. USA 99, 12889-12894. [8] De la Sota RL, Simmen FA, Diaz T, Thatcher WW. 1996. "Insulin-like growth factor system in bovine first wave-dominant and subordinate follicles". Biol Reprod; 1996, 55: 803-812. [9] Echternkamp SE, Howard HJ, Roberts AJ, Grizzle grizzle a bluish-gray or iron-gray coat color in dogs, consisting of a mixture of black and white hairs. In canaries, it describes light, grayish markings on the head, body, wings or tail. J, Wise T. 1994. "Relationships among concentrations of steroids, insulin-like growth factor-I, and insulin-like growth factor binding proteins in ovarian follicular fluid of beef cattle". Biol Reprod; 1994, 51: 971-981. [10] Mihm M, Good TEM TEM 1. transmission electron microscope. 2. triethylenemelamine. 3. transmissible encephalopathy of mink. , Ireland JLH, Ireland JJ, Knight PG, Roche JF. 1997. "Declinein serum follicle-stimulating hormone concentrations alters key intrafollicular growth factors involved in selection of the dominant follicle in heifers". Biol Reprod; 57:1328-1337. [11] Spicer, L.J. and Chamberlain, C.S., 2000. "Production of insulin-like growth factor-I by granulosa cells but not theca cells is hormonally responsive in cattle". Anim. Sci. 78, 2919-2926. [12] Monget P, Monniaux D, Pisselet C, Durand P. 1993. "Changes in the insulin-like growth factor-I (IGF-I), IGF-II, and their binding proteins during growth and atresia atresia /atre·sia/ (ah-tre´zhah) congenital absence or closure of a normal body opening or tubular structure.atret´ic anal atresia , atresia a´ni imperforate anus. of ovine ovine pertaining to, characteristic of, or derived from sheep. ovine atopic dermatitis symmetrical erythema, alopecia, lichenification, excoriation on woolless areas; sporadic cases, recur each summer. ovarian follicles". Endocrinology 1993; 132:1438-1446. [13] Sambrok and Russell: Molecular Cloning- a laboratory manual, Third edition, 2001. Cold Spring Harbor Laboratory The Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, New York
Cold Spring Harbor is a hamlet (and census-designated place) in Suffolk County, New York on the North Shore of Long Island. As of the United States 2000 Census, the CDP population was 4,975. , USA [14] Marsters, P., N. R. Kendall and B. K. Campbell 2003. "Temporal relationships between FSH receptor, type 1 insulin-like growth factor receptor, and aromatase expression during FSH-induced differentiation of bovine granulosa cells maintained in serum-free culture". Molecular and Cellular Endocrinology 203, Issues 1-2, 30 May 2003, 117-127 [15] Kanako Kumamoto, Haifeng Wang, Hideaki Yamashiro and Takato Terada 2005. "Easy and rapid method for the determination of gene expression in cumulus cells incubated for oocyte maturation". Reproductive Biology and Endocrinology 2005, doi:10.1186/1477-7827-3-59 [16] Amstrong, D.G., Baxter, G., Gutierrez, C.G., Hogg, C.O., Glazyrin, A.L., and Campbell, B.K., 1998. "Insulin-like growth factor-binding protein-2 and -4 messenger ribonucleic acid expression in bovine ovarian follicles: effect of gonadotropins and developmental status". Endocrinology. 139, 2146-2154. [17] Amstrong, D.G., Gutierrez, C.G., Baxter, G., Glazyrin, A.L., Mann, G.E., Woad, K.J., 2000: Expression of mRNA encoding IGF-I, IGF-II and type 1 IGF receptor in bovine ovarian follicles". J. Endocrinol. 165, 101-113. [18] Schams, D., Berisha, B., Kosmann, M., and Amselgruber, W.M., 200. "Expression and localization of IGF family members in bovine antral follicles during final growth and in luteal luteal /lu·te·al/ (loo´te-al) pertaining to or having the properties of the corpus luteum or its active principle. lu·te·al adj. Of, relating to, or involving the corpus luteum. tissue during different stages of estrous cycle and pregnancy". Domest. Anim. Endocrinol. 22, 51-72. [19] Mishra, S., Lei, Z.M., and Rao, C.V., 2003. "A novel role of luteinizing hormone in the embryo development in cocultures". Biol. Reprod. 68, 1455-1462. [20] Yuan, W. Bao, B., Garverick, H.A., Youngquist, R.S. and Lucy, M.C., 1998. Follicular dominance in cattle is associated with divergent patterns of ovarian gene expression for insulin-like growth factor (IGF)-I, IGF-II, and IGF binding protein-2 in dominant and subordinate follicles". Domest. Anim. Endocrinol. 15, 55-63. [21] Nuttinck, F., Charpigny, G., Mermillod, P., Loosfelt, H., Meduri, G., Freret, S., Grimard, B. and Heyman, Y., 2004. "Expression of components of the insulin-like growth factor system and gonadotropin gonadotropin /go·nado·tro·pin/ (-tro´pin) any hormone that stimulates the gonads, especially follicle-stimulating hormone and luteinizing hormone. receptors in bovine cumulus-oocyte Complexes during oocyte maturation". Domestic Animal Endocrinology. 27, 179-195. [22] Yoshida, Y., Miyamura, M., Hamano, S. and Yoshida, M. 1998. "Expression of growth factor ligand and their receptor mRNAs in bovine ova ova (o´vah) plural of ovum. Ova Eggs. Mentioned in: Stool O & P Test ova plural of ovum. during in vitro maturation and after fertilization in vitro." J. Vet. Med. Sci. 60, 549-554. [23] Wolf E. 2002. "Bovine somatic cell nuclear transfer using recipient oocytes recovered by ovum pick-up: Effect of maternal lineage of oocyte donors." Biol Reprod 2002 66: 367-373. [24] Rajapaksha W.R.A.K.J.S.; Robertson L.; O'Shaughnessy P.J. 1996. "Expression of follicle-stimulating hormone-receptor mRNA alternate transcripts in bovine granulosa cells during luteinization in vivo and in vitro." Molecular and Cellular Endocrinology, Volume 120, Number 1, 18 June 1996, (6).pp. 25-30. [25] Claire G, Nigel P. Groomeb and Philip G. Knight A 2003. "Oocyte-Mediated Suppression of Follicle-Stimulating Hormone- and Insulin-Like Growth Factor-Induced Secretion of Steroids and Inhibin-Related Proteins by Bovine Granulosa Cells In Vitro: Possible Role of Transforming Growth Factor [alpha]1." BIOLOGY OF REPRODUCTION 2003, 68, 758-765. [26] Adashi, E. Y. 1998. "The IGF family and folliculogenesis." J. Reprod. Immunol.1998 39:13-19. [27] Adashi, E. Y. 1994. "Growth factors and ovarian function: the IGF-I paradigm." Horm. Res.1994 42: 44-48. [28] Lucy M. C. 2000. "Regulation of Ovarian Follicular Growth by Somatotropin somatotropin: see growth hormone. andInsulin-Like Growth Factors in Cattle1." J Dairy Sci, 83:1635-1647. [29] Humpherys, D., Eggan, K., Akutsu, H., Hochedlinger, K., Rideout, W. M., III, Biniszkiewicz, D., Yanagimachi, R. & Jaenisch, R. 2001. Science 293, 95-97. [30] Xue, F., Tian, X. C., Du, F., Kubota, C., Taneja, M., Dinnyes, A., Dai, Y., Levine, H., Pereira, L. V. and Yang, X. 2002: Nat. Genet. 31, 216-220. Khairy M A Zoheir *, Li Xiang, Moaeen- ud- Din M, Yun Liu and Li-Guo Yang College of Animal Science and Technology Huazhong Agricultural University Huazhong Agricultural University (HAU) is a multi-disciplinary comprehensive university giving priority to agriculture, characterized by life sciences and supplemented by the combination of agriculture, basic sciences, engineering, liberal arts, law, economic trade, and Wuhan 430070, P. R. China * National Research Center- cell biology department, Dokki, Cairo Egypt E-mail: khma25@yahoo.com |
|
||||||||||||||||||||

ti·va
The Cold Spring Harbor Laboratory
Printer friendly
Cite/link
Email
Feedback
Reader Opinion