Printer Friendly
The Free Library
6,673,412 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Intrinsic hepatic phenotype associated with the Cyp1a2 gene as shown by cDNA expression microarray analysis of the knockout mouse. (Article).


Several forms of cytochrome cytochrome (sī`təkrōm'), protein containing heme (see coenzyme) that participates in the phase of biochemical respiration called oxidative phosphorylation.  P450 (CYP CYP

In currencies, this is the abbreviation for the Cyprus Pound.

Notes:
The currency market, also known as the Foreign Exchange market, is the largest financial market in the world, with a daily average volume of over US $1 trillion.
) appear to metabolize me·tab·o·lize
v.
1. To subject to metabolism.

2. To produce by metabolism.

3. To undergo change by metabolism.



metabolize

to subject to or be transformed by metabolism.
 principally pharmaceutical agents, as well as other dietary and plant chemicals. Other CYP forms have major roles in steroid, sterol Sterol

Any of a group of naturally occurring or synthetic organic compounds with a steroid ring structure, having a hydroxyl (—OH) group, usually attached to carbon-3.
, and bile acid bile acid /bile ac·id/ (bil as´id) any of the steroid acids derived from cholesterol; classified as primary, those synthesized in the liver, e.g.  metabolism. CYP1A CYP1A Cytochrome P450 1A 2 expression is constitutively high in mouse liver and is well known for metabolizing several drugs and many procarcinogens to reactive intermediates that can cause toxicity or cancel. CYP1A2 is also known to carry out several endogenous functions such as uroporphyrinogen and melatonin melatonin: see pineal gland.
melatonin

Hormone secreted by the pineal gland of most vertebrates. It appears to be important in regulating sleeping cycles; more is produced at night, and test subjects injected with it become sleepy.
 oxidation and the 2- and 4-hydroxylations of estradiol. We have used cDNA microarray analysis of the untreated Cyp1a2(-/-) knockout mouse knock·out mouse
n.
A transgenic mouse that has been genetically engineered to exhibit mutations in specific genes.
 to search for changes in gene expression that might indicate important intrinsic roles for this enzyme. For 15 of the up- or downregulated genes, these increases or decreases were corroborated cor·rob·o·rate  
tr.v. cor·rob·o·rat·ed, cor·rob·o·rat·ing, cor·rob·o·rates
To strengthen or support with other evidence; make more certain. See Synonyms at confirm.
 by reverse-transcription real-time polymerase chain reaction In Molecular Biology, real-time polymerase chain reaction, also called quantitative real time polymerase chain reaction (QRT-PCR) or kinetic polymerase chain reaction . Other than upregulation of the Hprt gene (used in the selection procedure for disrupting the Cyp1a2 gene), we found several genes upregulated that are associated with cell-cycle regulation and lipid metabolism. Besides Cyp1a2, the gene exhibiting the greatest downregulation was Igfbp1 (insulin-like growth factor insulin-like growth factor

one of the twenty or so substances, additional to the classic bone-regulating hormones, which exert an effect on bone cell metabolism. See also somatomedin C.
 binding protein-l), showing only 12% expression of that in the Cyp1a2(+/+) wild-type liver. Recurrent themes between both up- and downregulated genes include cell-cycle control, insulin action, lipogenesis lipogenesis /lipo·gen·e·sis/ (-jen´e-sis) the formation of fat; the transformation of nonfat food materials into body fat.lipogenet´ic

lip·o·gen·e·sis
n.
1.
, and fatty acid fatty acid, any of the organic carboxylic acids present in fats and oils as esters of glycerol. Molecular weights of fatty acids vary over a wide range. The carbon skeleton of any fatty acid is unbranched. Some fatty acids are saturated, i.e.  and cholesterol biosynthetic bi·o·syn·the·sis  
n.
Formation of a chemical compound by a living organism. Also called biogenesis.



bi
 pathways. Histologically, the Cyp1a2(-/-) mouse exhibited an approximately 50% decrease in lipid stored in hepatocytes, and 50% increase in lipid present in interstitial fat-storing cells compared with that in the Cyp1a2(+/+) wild-type. These data suggest that the CYP1A2 enzyme might perform additional hepatic endogenous functions heretofore not appreciated. Key words: cDNA expression library; cell cycle control; cholesterol biosynthesis Biosynthesis

The synthesis of more complex molecules from simpler ones in cells by a series of reactions mediated by enzymes. The overall economy and survival of the cell is governed by the interplay between the energy gained from the breakdown of compounds
; CYP1A2, endogenous substrate metabolism; CYP1A2, foreign chemical metabolism; Cyp1a2(-/-) knockout mouse; fatty acid biosynthesis; insulin action; lipogenesis. Environ Health Perspect 111:855-861 (2003). doi:10.1289/txg. 5925 available via http://dx.doi.org/[Online 20 November 2002]

**********

During more than 2.5 billion years of evolution, it is likely that cytochrome P450 (CYP) genes first appeared in prokaryotes and then in early eukaryotes to carry out important roles in critical life processes; following the divergence of plants and animals Plants and Animals are a Canadian indie-rock band from Montreal, comprised of guitarist-vocalists Warren Spicer and Nic Basque, and drummer-vocalist Matthew Woodley.[1] They are signed to Secret City Records.  some 1.8 billion years ago and especially after the radiation of innumerable phyla phy·la  
n.
Plural of phylum.
 about 543 million years ago, animal CYP enzymes then took on the functions of metabolizing many plant products and other environmental chemicals that were consumed, inhaled, or in contact with the animal's skin (Nebert 1997; Nebert and Dieter 2000). For some CYP forms, evidence clearly indicates that their principal functions include the oxidative metabolism of endogenous molecules such as steroids, sterols sterols (ster´ôlz),
n.pl steroids having one or more hydroxyl groups and no carbonyl or carboxyl groups (e.g., cholesterol).
, bile acids, retinoic acid retinoic acid /ret·i·no·ic ac·id/ (ret?i-no´ik) an oxidized derivative of retinol, believed to be the form of vitamin A that plays a role in the development and growth of bone and in the maintenance of normal epithelial structures. , and many of the > 100 eicosanoids (Nebert and Russell 2002). In addition, it is likely there are still many endogenous roles of CYP of which we remain ignorant. For instance, although CYP1A1/1A2/1B1 induction is well established in the metabolism of pro-carcinogenic polycyclic aromatic hydrocarbons and arylamines, these three enzymes are suggested to have pivotal functions in degrading the putative endogenous ligand(s) of the aryl ar·yl
n.
An organic radical derived from an aromatic compound by the removal of one hydrogen atom.
 hydrocarbon (AH) receptor and perhaps participate in apoptosis and cell-cycle regulation (Nebert et al. 2000b).

Among the few abundant CYPs that are expressed constitutively in mammalian liver, CYP1A2 carries out several known endogenous functions such as uroporphyrinogen and melatonin oxidation and the 2- and especially 4-hydroxylations of estradiol (Nebert and Russell 2002). The Cyp1a2(-/-) knockout mouse, however, has no apparent overt phenotype or problems with viability or fertility (Liang et al. 1996). These findings suggest that, in the absence of a foreign chemical, the expression of CYP1A2 might be redundant. In humans, CYP1A2-mediated activity varies >60-fold between individuals (Nebert 1997; Eaton et al. 1995; Nebert et al. 1996; Dorne et al. 2001), also with no overt phenotype; most of the variation does not depend on lifestyle or nutrition but is likely to be genetically determined (Le Marchand et al. 1997). It seems unlikely, however, that high constitutive CYP1A2 expression in mammalian liver continues without a particular purpose, whereas CYP1A1 expression occurs only under conditions of ligand-activation of the AH receptor (Nebert et al. 2000b). CYP1A2 is absent in fish but present in birds and mammals, suggesting that between 380 million and 320 million years ago this gene arose from CYP1A1 by way of a duplication event; most likely, the duplicated CYP1A2 gene "drifted" from CYP1A1 until it became involved in one or more critical life functions or in the metabolism of dietary components or environmental chemicals, such that the animal gained a reproductive or survival advantage (Heilmann et al. 1988; Nebert et al. 1991).

The development of mice with disruptions in specific genes allows testing of hypotheses that various CYPs might have physiologic roles not yet identified (Nebert and Duffy 1997). Many knockout mouse lines show profoundly altered phenotypes from normal, including lethality during embryogenesis Embryogenesis

The formation of an embryo from a fertilized ovum, or zygote. Development begins when the zygote, originating from the fusion of male and female gametes, enters a period of cellular proliferation, or cleavage.
 if the gene participates in a nonredundant component of a metabolic pathway. In one of our laboratories we have been particularly interested in the effect of knocking out members of the Cyp1a family. For example, Cyp1a1(-/-) knockout mice are fertile and healthy and show no apparent changes in the activity or expression of other genes in the [Ah] gene battery, including Cyp1a2, following administration of AH receptor ligands (Dalton et al. 2000a). Similarly, the untreated or inducer-treated Cyp1a2(-/-) null mouse shows no apparent changes in expression of other genes in the [Ah] gene battery, including Cyp1a1 (Liang et al. 1997). On the other hand, both Cyp1a1(-/-1) and Cyp1a2(-/-) lines show modified biochemical responses to foreign chemicals (Liang et al. 1996; Dalton et al. 2000a; Liang et al. 1997; Pineau et al. 1995; Buters et al. 1996; Peters et al. 1999; Kimura et al. 1999; Shertzer et al. 2002). Cyp1a2(-/-) mice metabolize zoxazolamine, caffeine, and phenacetin phenacetin /phe·nac·e·tin/ (fe-nas´e-tin) an analgesic and antipyretic, whose major metabolite is acetaminophen, now little used because of its toxicity.

phenacetin

see acetophenetidin.
 less extensively than Cyp1a2(+/+) wild-type mice and are more susceptible to some aspects of toxicity of these drugs (Liang et al. 1996; Buters et al. 1996; Peters et al. 1999). On the contrary, Cyp1a2-null mice are unexpectedly protected from 4-aminobiphenyl-induced tumorigenesis tumorigenesis /tu·mor·i·gen·e·sis/ (-jen´e-sis) oncogenesis.

tu·mor·i·gen·e·sis
n.
Formation or production of tumors.
 (Kimura et al. 1999) and 4-aminobiphenyl-induced methemoglobinemia Methemoglobinemia Definition

When excessive hemoglobin in the blood is converted to another chemical that cannot deliver oxygen to tissues, called methemoglobin.
 (Shertzer et al. 2002). Cyp1a2(-/-) mice also appear to be completely protected from hepatic uroporphyria caused by dioxin, hexachlorobenzene, and iron overload Iron overload
A side effect of frequent blood transfusions in which the body accumulates abnormally high levels of iron. Iron deposits can form in organs, particularly the heart, and cause life-threatening damage.
, although metabolism of these chemicals does not seem to be involved in the mechanism of their toxicity (Sinclair et al. 1998; Sinclair et al. 2000; Smith et al. 2001); in these cases, CYP1A2 appears to be functioning in a mode that does not involve production of a reactive metabolite metabolite, organic compound that is a starting material in, an intermediate in, or an end product of metabolism. Starting materials are substances, usually small and of simple structure, absorbed by the organism as food. . Other studies suggest that CYP1A2 might have a role in bilirubin Bilirubin

The predominant orange pigment of bile. It is the major metabolic breakdown product of heme, the prosthetic group of hemoglobin in red blood cells, and other chromoproteins such as myoglobin, cytochrome, and catalase.
 metabolism (Zaccaro et al. 2001). It has been proposed that CYP1A1 metabolizes an endogenous substrate that modulates AH receptor-mediated gene expression and that, in the liver, CYP1A2 can take over this role (Nebert et al. 2000b). Since there is no constitutive expression of Cyp1a1 in the liver, it would be interesting to investigate whether nonpathologic changes in hepatic metabolism hepatic metabolism Therapeutics The constellation of chemical alterations to drugs or metabolites that occur in the liver, carried out by microsomal enzyme systems, which catalyze glucuronide conjugation, drug oxidation, reduction and hydrolysis. See Metabolism.  might occur in the complete absence of constitutive CYP1A2. We have thus used cDNA microarrays to compare hepatic gene expression differences between the untreated Cyp1a2(-/-) knockout and the Cyp1a2(+/+) wild-type mouse.

Materials and Methods

The Cyp1a2(-/-) mouse line. Knockout mice had been generated by removing portions of exons 2 and all of exons 3-5 of the Cyp1a2 gene; insertion of the Hprt minigene cassette was used for selection in embryonic stem (ES) cell cultures (Liang et al. 1996). Although the mice were originally generated from a mixture of the C57BL/6J and 129/J inbred strains, the Cyp1a2(-/-) genotype was subsequently backcrossed into the C57BL/6J strain to a theoretical level of >99.8%; if the mouse genome contains 40,000 genes, this would mean that the Cyp1a2(-/-) line in the Nebert mouse colony should have fewer than about 80 genes that might be expected to be of 129/J origin (Nebert et al. 2000a). For this reason, C57BL/6J mice from the Jackson Laboratory (Bar Harbor, ME, USA) were used as the Cyp1a2(+/+) controls in the present experiments. We used untreated males, approximately 10 weeks of age, in the microarray studies; females and males were compared in the histologic studies.

Mouse EST EST electroshock therapy.

EST
abbr.
electroshock therapy
 clones and preparation of cDNA. The arrays comprised 4,246 mouse expressed-sequence-tag (EST) clones (2,783 individual Genbank clusters). Two-thirds of the clones were obtained from the I.M.A.G.E. collections held at the MRC See Maximum return criterion.  Human Gene Mapping gene mapping
n.
The determination of the sequence of genes and their relative distances from one another on a specific chromosome.
 Project (http://www.hgmp.mrc.ac.uk/). The remaining one-third of the EST clones were obtained from Research Genetics (RG9 set; http://www.resgen.com). All clones described in this article were verified by sequence analysis, cDNA from the EST was obtained via polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is  (PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
) amplification using plasmid-specific primers. The PCR products were separated by electrophoresis on agarose agarose

more highly purified form of agar with similar uses to agar and widely used in the separation of nucleic acid fragments.
 gels to ensure that only a single product was obtained for each clone. The reaction products were precipitated and prepared for array, using methods described (DeRisi et al. 1997; Eisen and Brown 1999).

Printing of the arrays. Arrays were printed on poly-k-lysine-coated slides, UV-cross-linked, and blocked prior to use (DeRisi et al. 1997; Eisen and Brown 1999; Turton et al. 2001). The arrays were printed using an arrayer built essentially according to the Stanford designs (cf. http://www.le.ac.uk/cmht/microarray_lab/ Home.htm). The center-to-center distance of the features was 210 [micro]m, and each feature was 90-100 [micro]m in diameter.

Labeling and hybridizations. Total RNA RNA: see nucleic acid.
RNA
 in full ribonucleic acid

One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic
 was prepared from mouse liver by sedimentation through CsCl. The-RNA of five individual Cyp1a2(+/+) wild-type mice and five individual Cyp1a2(-/-) knockout mice were each separately labeled with both Cy3 dUTP and Cy5 dUTP. RNA labeling was carried out essentially as described (DeRisi et al. 1997; Eisen and Brown 1999; Turton et al. 2001). Priming was achieved with the oligo dT(25), using 4 [micro]g of the oligo with 50 [micro]g of total RNA. After denaturation denaturation, term used to describe the loss of native, higher-order structure of protein molecules in solution. Most globular proteins exhibit complicated three-dimensional folding described as secondary, tertiary, and quarternary structures.  at 70[degrees]C for 8 min, annealing annealing (ənēl`ĭng), process in which glass, metals, and other materials are treated to render them less brittle and more workable.  was allowed to occur as the temperature fell to 42[degrees]C over 30 min. At this point, dNTPs (Pharmacia/Amersham, Bucks, UK) were added to final concentrations of 0.5 mM, with the exception of dTTP, which was at 0.2 mM. The desired Cy-labeled dUTP (Pharmacia/Amersham) was then added to a final concentration of 0.1 mM. We used the 1X first-strand buffer (Gibco/ Invitrogen, Paisley, Scottland). RNAsin (20 U) was added to the reaction. Transcription was initiated by addition of 100 U of Superscript Any letter, digit or symbol that appears above the line. For example, 10 to the 9th power is written with the 9 in superscript (109). Contrast with subscript.  II (Gibco/Invitrogen) and allowed to proceed for 1 hr at 42[degrees]C before addition of a second 100 U of Superscript II and another 1-hr incubation at 42[degrees]C. RNA was removed from the synthesized cDNA by addition of NaOH/ EDTA/sodium dodecyl sulfate sulfate, chemical compound containing the sulfate (SO4) radical. Sulfates are salts or esters of sulfuric acid, H2SO4, formed by replacing one or both of the hydrogens with a metal (e.g., sodium) or a radical (e.g., ammonium or ethyl).  (SDS 1. (company) SDS - Scientific Data Systems.
2. (tool) SDS - Schema Definition Set.
) to final concentrations of 0.195 M/10 mM/0.22%, respectively, and incubated at 70[degrees]C for 10 min. The reaction was neutralized by addition of HC1 and buffered to pH 7.5 by the addition of Tris-HC1. The reaction products were purified by passage through a Centri-Sep column (Princeton Separations, Inc., Adelphi, NJ, USA), dried, and resuspended in hybridization hybridization /hy·brid·iza·tion/ (hi?brid-i-za´shun)
1. crossbreeding; the act or process of producing hybrids.

2. molecular hybridization

3.
 buffer. Prior to hybridization, the samples were heated to 100[degrees]C for 2 min, then at 42[degrees]C for at least 30 min.

Hybridizations were conducted in humidified chambers at 42[degrees]C for approximately 16 hr. The hybridization buffer consisted of 50% deionized de·i·on·ize  
tr.v. de·i·on·ized, de·i·on·iz·ing, de·i·on·iz·es
To remove ions from (a solution) using an ion-exchange process.



de·i
 formamide/ 0.5% SDS/6x SSPE SSPE
abbr.
subacute sclerosing panencephalitis



SSPE

subacute sclerosing panencephalitis.

SSPE Subacute sclerosing panencephalitis, see there
 (1 M NaCl/0.33 mM Na[H.sub.2]P[O.sub.4]/6.6 mM EDTA EDTA: see chelating agents. , pH 7.4) and 2.5x Denhardt's/0.06 [micro]g/[micro]L of poly[A.sub.(80)]/ 0.66 [micro]g/l[micro]L human Cot 1 DNA/0.27 [micro]g/[micro]L yeast tRNA. The arrays were washed in 1.0x SSC SSC Secondary School Certificate
SSC Standard Systems Center (USAF)
SSC State Services Commission (New Zealand)
SSC Swedish Space Corporation
SSC Salem State College (Massachusetts) 
 (0.15 M NaCl/0.015 M Na citrate citrate /cit·rate/ (sit´rat) a salt of citric acid.

citrate phosphate dextrose  (CPD) anticoagulant citrate phosphate dextrose solution.
, pH 7.0), 0.03% SDS for 10 min, then washed in 0.2x SSC for 5 min, and a final wash in 0.05x SSC for 5 min at room temperature. The slides were dried by centrifugation Centrifugation

A mechanical method of separating immiscible liquids or solids from liquids by the application of centrifugal force. This force can be very great, and separations which proceed slowly by gravity can be speeded up enormously in centrifugal
 at 800 rpm for 5 min. For each pair of Cyp1a2(+/+) and Cyp1a2(-/-) mice, the Cy3-labeled cDNA product was hybridized against the Cy5-labeled cDNA product, and vice versa--giving 10 separate hybridizations from the five pairs of animals being compared.

Analysis of fluorescence and data processing. The fluorescence of all the features on the slides was measured using the GenePix software (version 3.0.0.85; Axon axon: see nervous system; synapse.  Instruments, Union City, CA, USA). Feature sizes were determined using the inbuilt in·built  
adj.
Built-in; inherent.


inbuilt
Adjective

(of a quality or feeling) present from the beginning: an inbuilt prejudice

Adj. 1.
 automated parameters in the first instance and then adjusted manually where appropriate. The fluorescence of each pixel within the feature was determined, and the median fluorescence of these pixel measurements was taken as the measure of fluorescence for the whole feature. The local background fluorescence was measured using the default GenePix parameters. The raw feature data for each channel were globally centered by reference to the median fluorescence of the whole feature set for that channel. The changes in gene expression obtained are shown as means [+ or -] standard deviations of the ratio between the Cy3 and Cy5 channels for 10 pairs of hybridizations.

Reverse-transcription real-time PCR using SYBR Green. For an alternative estimation of changes in gene expression, the relative mRNA levels of genes of interest were determined by comparison with a mouse endogenous control gene, [beta]-actin (Actb). The primers used (Table 4) were designed to cross exon-exon boundaries to eliminate the detection of any contaminating genomic DNA.

In the first step, cDNA was synthesized from total RNA. A 1,450-[micro]L master mix was made up as follows: 200 [micro]L PCR buffer, (catalog no. Y02028; Gibco/ Invitrogen); 100 [micro]L MgCl2 (50 mM); 20 [micro]L each of dATP, dCTP, dGTP, dTTP (all 100 mM); 19.8 [micro]L random hexamers (catalog no. 27-2166-01; Amersham; 90 OD U/mL); dithiothreitol (Gibco 400147); and 1,030.2 [micro]L water. For cDNA synthesis, a 40-[micro]L reaction contained: 29 [micro]l of the master mix; 8 [micro]L total RNA (400 ng); 40 U RNAsin (catalog no. N211B; Promega, Southampton, UK); and 400 U SuperScript II reverse transcriptase Reverse transcriptase

Any of the deoxyribonucleic acid (DNA) polymerases present in particles of retroviruses which are able to carry out DNA synthesis using an RNA template.
 (Gibco/ Invitrogen). The mixture was heated for 10 min at 23[degrees]C, then for 30 min at 42[degrees]C, and finally for 10 min at 99[degrees]C. In the second step, 1 [micro]L of the product of the cDNA synthesis (from 10 ng RNA), or a non-template control, was incubated with 24 [micro]L SYBR Green PCR Master Mix (part no. 4309155; Applied Biosystems, Warrenton, UK) containing 900 nM forward primer and 300 nM reverse primer in an ABI Abi (ā`bī) [short for Abijah], in the Bible, King Hezekiah's mother.


(Application Binary Interface) A specification for a specific hardware platform combined with the operating system.
 PRISM 7700 Sequence Detection System. The thermal-cycler protocol was stage one, 50[degrees]C for 2 min; stage two, 95[degrees]C for 10 min; stage three, 40 cycles at 95[degrees]C for 15 sec and 60[degrees]C for 1 min. For every sample of Cyp1a2(+/+) and Cyp1a2(-/-) liver, the relative level of each gene examined was compared with that for [beta]-actin. A comparison was then made for the expression of the gene between the wild-type and the knockout animal.

Histologic analysis of liver. Liver was prepared for routine light- and electron-microscopic histology and morphometry mor·phom·e·try
n.
Measurement of the form of organisms or of their parts.



morpho·met
 (Dalton et al. 2000b). Twenty-eight Cyp1a2(-/-) and 28 Cyp1a2(+/+) mice were used, with equal numbers of males and females (8-10 weeks of age). Phase-contrast microscopy of toluidine toluidine Toxicology An aniline analogue used today to dye, and to manufacture chemicals  bluestained 1.5-micron-thick plastic sections was used to quantify the relative amounts of parenchymal pa·ren·chy·ma  
n.
1. Anatomy The tissue characteristic of an organ, as distinguished from associated connective or supporting tissues.

2.
 and interstitial cells and to determine the volume density of hepatocyte hepatocyte /hep·a·to·cyte/ (hep´ah-to-sit?) a hepatic cell.

hep·a·to·cyte
n.
A parenchymal liver cell.


Hepatocyte
A liver cell.
 and of interstitial fat, glycogen glycogen (glī`kəjən), starchlike polysaccharide (see carbohydrate) that is found in the liver and muscles of humans and the higher animals and in the cells of the lower animals.  pools, and necrosis. A grid of 75 intersections was visualized over the light-microscopic image using a Zeiss Photomik lightmicroscopy (Carl Zeiss GmbH, Vienna, Austria) and camera lucida, and the number of positive intersections lying over hepatocytes, interstitial cells, lipid, and glycogen was counted. The volume density (Vd) of each parameter was determined by dividing those values by the total number of positive intersections lying over the entire tissue.

Statistical analysis of microarray data was performed using the two-tailed paired t-test, taking the reference ratio for the population as 1.0 and comparing this with the ratio change. Means and standard-errors-of-the-mean were obtained from morphometric data, using the General Linear Model of SAS (1) (SAS Institute Inc., Cary, NC, www.sas.com) A software company that specializes in data warehousing and decision support software based on the SAS System. Founded in 1976, SAS is one of the world's largest privately held software companies. See SAS System.  6.1 (SAS Institute, Inc., Cary, NC, USA). A p <0.05 value was regarded as statistically significant.

Results

cDNA expression microarray. To investigate potential biochemical phenotypic differences, we compared constitutive hepatic gene expression of Cyp1a2(-/-) mice with that of aged-matched Cyp1a2(+/+) mice, using cDNA microarrays. Labeling of samples with both Cy3 and Cy5 dyes (reverse-labeling) was performed to take into account any methodologic bias. Our information was thus based on 10 separate hybridizations from five mice. Although it is often customary in array work to use an arbitrary cut-off at a 2-fold change in expression, we believe that <2-fold alterations can be important in critical-life-process pathways and therefore chose to list all expressions that had changed significantly as assessed statistically at p <0.05 (Tables 1, 2). Only a relatively few genes were detected that exhibited significant up-or downregulation. With the particular array used, we found a greater number of downregulated than upregulated genes in the Cyp1a2(-/-) mouse.

The >5-fold elevation in Hprt gene expression (Table 1) is likely explained by the Hprt minigene cassette used in the selective elimination to disrupt the Cyp1a2 (Liang et al. 1996), or any other gene (van der Lugt et al. 1991), in ES cells. The Gadd45g gene, the Spr1c1 gene, and the Cyp2a4/2a5 gene(s) were upregulated 3.2-, 2.4- and 1.9-fold, respectively. In addition to the marked decrease in Cyp1a2 gene expression (Table 2), as expected, several other genes were downregulated by 2.5-fold or more. These included the Igfbp1, GOs2, Fasn, Cyp4a14, Scd1, Hmgcr, Gk and Fabp2 genes. Recurrent functional themes among both these up- and downregulated genes include cell-cycle control, insulin action, lipogenesis, and fatty acid and cholesterol biosynthetic pathways.

Besides Cyp1a2, there were at least three other mouse Cyp genes upregulated (Table 1) and two others downregulated (Table 2). We also documented in our microarray that the expression of at least nine other mouse Cyp genes was not significantly altered (Table 3). Expression of genes encoding the AH receptor and both forms of heme oxygenase was also not significantly changed (Table 3).

Reverse-transcription real-time PCR. To prove the accuracy of the cDNA microarray, we chose 15 of the genes that had exhibited significant differences in expression between the genotypes (in Tables 1, 2) for further analysis by reverse-transcription real-time PCR, and we used Actb expression as a reference "housekeeping" gene. For the 6 upregulated and the 9 downregulated genes investigated (Table 4), there was good agreement with those changes that had been observed using the cDNA arrays. The data in Table 4 thus confirm the robustness of the cDNA expression microarray approach.

Histology and morphometry. Conducting histology on mouse liver several years ago, it had independently been noted in one of our laboratories that the lipid-containing cells differ between Cyp1a2(-/-) and Cyp1a2(+/+) mice (Figure 1). Morphometric analysis of 28 Cyp1a2(-/-) and 28 Cyp1a2(+/+) mouse livers corroborated that these lipid-storage differences are consistent and statistically significant (Table 5). The Vd of hepatic glycogen pools was slightly but not significantly greater in the Cyp1a2(-/-) mouse. The increase in Cyp1a2(-/-) interstitial fat accounted for a small increase in the Vd of interstitium overall, which had a p value of 0.089. Total lipid stores were significantly (p = 0.035) decreased in the Cyp1a2(-/-) liver compared with that in Cyp1a2(+/+) liver. This decrease principally reflected a Vd of hepatocyte-containing lipid droplets in Cyp1a2(-/-) liver that was approximately 55% of that seen in Cyp1a2(+/+) liver. On the other hand, there was a 45% increase in the Vd of lipid found within the Cyp1a2(-/-) interstitial fat-storing cells compared with that in Cyp1a2(+/+) liver. Gender influenced the response, with females showing a greater increase than males in fat stored in interstitial cells; in retrospect, therefore, it might have been worthwhile in the microarray experiments to include comparisons between males and females.

[FIGURE 1 OMITTED]

There were no significant differences in hepatocyte necrosis, inflammatory infiltrate, binucleated bi·nu·cle·ate   also bi·nu·cle·at·ed or bi·nu·cle·ar
adj.
Having two nuclei.

Adj. 1. binucleated - having two nuclei
binuclear, binucleate
 hepatocytes, or number of apoptotic hepatocytes that could be attributed to the loss of CYP1A2. The mitotic index mitotic index
(mītot´ik),
n the number of cells per unit undergoing mitosis during a given time. The ratio is used primarily as an estimation of the rate of tissue growth.
 in Cyp1a2(-/-) liver was slightly elevated but not statistically significant compared with that in Cyp1a2(+/+) liver (p = 0.16).

Discussion

The data in this study strongly suggest that mouse hepatic CYP1A2 is involved in a number of previously unrecognized endogenous functions. These findings are in contrast to popular opinion that CYP1A2 exists solely for the metabolism of pharmaceuticals and other environmental chemicals.

Cell cycle control. The >3-fold upregulation of the Gadd45g gene in Cyp1a2(-/-) mice suggests there is some cellular stress (Fornace et al. 1989), perhaps in genomic stability, or alterations in cell cycle control that might occur in the absence of hepatic CYP1A2 constitutive expression; GADD45[gamma] is also associated with apoptosis (Hollander et al. 2001), though this was not reflected in an increase in apoptotic hepatocytes. This marked increase in Gadd45g expression could be related to disruption of the Cyp1a2 gene directly, or to some secondary response caused by the complete absence of CYP1A2 activity. It might also be pertinent that there is a 5-fold downregulation of the G0/G1 switch gene-2 (GOs2) (Table 2) and a 65% increase in the E4F1 transcription factor (E4fl) gene (Table 1), both involved in cell-cycle regulation. Likely reasons for CYP1A2 involvement in oxidative stress oxidative stress,
n an imbalance of the prooxidant antioxidant ratio in which too few antioxidants are produced or ingested or too many oxidizing agents are produced.
, cell cycle control, and apoptosis have been recently reviewed (Nebert et al. 2000b). Histologically, however, the mitotic index in the Cyp1a2(-/-) mice is only slightly elevated (not statistically significant), and the percent binucleated hepatocytes (which reflects hepatocyte hypertrophy hypertrophy (hīpûr`trəfē), enlargement of a tissue or organ of the body resulting from an increase in the size of its cells. Such growth accompanies an increase in the functioning of the tissue.  and karyokinesis karyokinesis /karyo·ki·ne·sis/ (kar?e-o-ki-ne´sis) division of the nucleus, usually an early stage in the process of cell division, or mitosis.karyokinet´ic

kar·y·o·ki·ne·sis
n.
See mitosis.
 without cytokinesis cytokinesis: see mitosis.
Cytokinesis

The physical partitioning of a plant or animal cell into two daughter cells during cell reproduction.
) in Cyp1a2(-/-) is almost identical to that in the Cyp1a2 (+/+) wild type.

Insulin action, lipogenesis, and fatty acid and cholesterol biosynthetic pathways. Other than Cyp1a2, the gene exhibiting apparently the greatest downregulation was Igfbpl (insulin-like growth factor binding protein-l), which showed only 12% expression of that in the Cyp1a2(+/+) wild-type mouse (Table 2). Again, this may be linked to an overall downregulation of cell proliferation or alterations in lipid metabolism. The Igfbpl promoter shares common insulin regulatory response elements with the phosphenolpyruvate carboxykinase (Pck1) gene, which catalyzes the rate-limiting and committed step in gluconeogenesis gluconeogenesis /glu·co·neo·gen·e·sis/ (gloo?ko-ne?o-jen´e-sis) the synthesis of glucose from molecules that are not carbohydrates, such as amino and fatty acids.

glu·co·ne·o·gen·e·sis
n.
, although different mechanisms are used by insulin to inhibit expression of these two genes (Yeagley et al. 2001). Pck1 was downregulated more than 2-fold in the Cyp1a2(-/-) mouse (Table 2). Interestingly, glucokinase, another gene associated with insulin action, was also downregulated. In hepatocytes, insulin stimulates a rapid increase in transcription of the gene coding for sterol response-binding protein-lc, which has been implicated im·pli·cate  
tr.v. im·pli·cat·ed, im·pli·cat·ing, im·pli·cates
1. To involve or connect intimately or incriminatingly: evidence that implicates others in the plot.

2.
 in the expression of lipogenic lipogenic /lip·o·gen·ic/ (-jen´ik) forming, producing, or caused by fat.

lipogenic

producing, forming or caused by fat.
 genes; moreover, cholesterol synthesis genes in hepatocytes include fatty acid synthase Fatty acid synthases (FAS) is enzymatic system composed of 272 kDa multifunctional polypeptide, in which substrates are handed from one functional domain to the next[1][2][3][4][5].  (Fasn), steroyl-coenzyme A desaturase (Scd1), 3-hydroxy-3-methylglutaryl-coenzyme A reductase reductase /re·duc·tase/ (-tas) a term used in the names of some of the oxidoreductases, usually specifically those catalyzing reactions important solely for reduction of a metabolite.  (Hmgcr), glucokinase (Gk), and farnesyl diphosphate di·phos·phate
n.
An ester of phosphoric acid containing two phosphate groups.
 synthase synthase /syn·thase/ (-thas) a term used in the names of some enzymes, particularly lyases, when the synthetic aspect of the reaction is dominant or emphasized.

syn·thase
n.
 (Fdps) (Yeagley et al. 2001; Joseph et al. 2002). The expression of these five genes was significantly decreased in Cyp1a2(-/-) mouse liver (Table 2). The 1.6-fold increase in Cyp7b1 (Table 1), and the downregulation of fatty acid-binding protein-2 (Fabp2) and apolipoprotein apolipoprotein /apo·lipo·pro·tein/ (ap?o-lip?o-pro´ten) any of the protein constituents of lipoproteins, grouped by function in four classes, A, B, C, and E.

ap·o·lip·o·pro·tein
n.
 AIV AIV Avian Influenza Virus
AIV Année Internationale des Volontaires (French)
AIV Associazione Italiana del Vuoto (Italian Vacuum Association)
AIV Assembly-Integration-Verification
AIV Alternative Inter VLC
 (Apoa4) (Table 2), provide further evidence of the possible involvement of CYP1A2 in fatty acid and cholesterol pathways. This possible perturbation perturbation (pŭr'tərbā`shən), in astronomy and physics, small force or other influence that modifies the otherwise simple motion of some object. The term is also used for the effect produced by the perturbation, e.g.  of fatty acid and cholesterol pathways might be reflected in the histologic assessment (Table 5) in which the Cyp1a2(-/-) mouse liver has less volume density of lipid within its hepatocytes, concomitant with increases in lipid in the fat-storing cells in its interstitium compared with that in the Cyp1a2(+/+) wild-type liver.

Cyp gene expression. As expected, the signal for Cyp1a2 gene expression was markedly decreased by >99% in the Cyp1a2(-/-) compared with that in the Cyp1a2(+/+) mouse (Table 2). Since the Cyp1a2 gene is constitutively quite highly expressed in wild-type mice, it was of interest to see whether there might be compensatory expression of any other CYP enzymes. The upregulation of Cyp3a11 (Table 1) and the downregulation of Cyp4a10 and Cyp4a14 (Table 2) might be related to alterations in the arachidonic acid arachidonic acid /arach·i·don·ic acid/ (ah-rak?i-don´ik) a polyunsaturated 20-carbon essential fatty acid occurring in animal fats and formed by biosynthesis from linoleic acid; it is a precursor to leukotrienes, prostaglandins, and  cascade or other physiologic homeostasis homeostasis

Any self-regulating process by which a biological or mechanical system maintains stability while adjusting to changing conditions. Systems in dynamic equilibrium reach a balance in which internal change continuously compensates for external change in a feedback
 (Nebert and Dieter 2000; Nebert and Russell 2002) in the absence of CYP1A2. The ESTs for each of the two Cyp4a genes would have detected either cDNA and, thus, these two could not be properly distinguished--although differences in degree of upregulation were seen.

The greatest difference (1.94-fold upregulation) was observed for Cyp2a4 (Table 1). Although this gene encodes steroid 15[alpha]-hydroxylase in the synthesis of testosterone and estradiol, both CYP2A4 and CYP2A5 have been shown to be modulated by circadian rhythm circadian rhythm: see rhythm, biological.
circadian rhythm

Inherent cycle of approximately 24 hours in length that appears to control or initiate various biological processes, including sleep, wakefulness, and digestive and hormonal activity.
 (Lavery et al. 1999; Akhtar et al. 2002). CYP2A5 has coumarin coumarin /cou·ma·rin/ (koo´mah-rin)
1. a principle extracted from the tonka bean; it contains a factor, dicumarol, that inhibits hepatic synthesis of vitamin K–dependent coagulation factors, and a number of its derivatives are
 7-hydroxylase activity and metabolically activates many chemicals such as nitrosamines nitrosamines

highly hepatotoxic compounds formed in the rumen by the combination of amines and nitrite. They do not appear to occur naturally in large quantities. Nitrosamine poisoning has also been caused by feeding nitrite-treated fishmeal and Solanum incanum.
 and aflatoxin that are known hepatic carcinogens Carcinogens
Substances in the environment that cause cancer, presumably by inducing mutations, with prolonged exposure.

Mentioned in: Colon Cancer, Rectal Cancer
 in mice (Negishi et al. 1989; Camus-Randon et al. 1996). CYP2A5 induction differs from most because it seems to occur by a variety of agents, including not only drugs and chemicals such as pyrazole, phenobarbital phenobarbital /phe·no·bar·bi·tal/ (fe?no-bahr´bi-tal) a long-acting barbiturate, used as the base or sodium salt as a sedative, hypnotic, and anticonvulsant.

phe·no·bar·bi·tal
n.
 and cobalt but also viral and parasitic inflammation and in hepatic neoplasia neoplasia /neo·pla·sia/ (-pla´zhah) the formation of a neoplasm.

cervical intraepithelial neoplasia
 (CamusRandon et al. 1996; Wastl et al. 1998). This often occurs under circumstances in which other CYP isoforms are decreased. Thus, it would seem that hepatic Cyp2a5 induction might be associated with a subtle form of liver injury, although nothing was seen histologically. Moreover, mouse Cyp2a5 has been found to possibly be involved in perturbation of the cell cycle and apoptosis (Pelkonen 2002).

There was no significant change in the expression of heme oxygenase-1 (inducible form) (Table 3), however, which is often associated with CYP heme turnover and oxidative stress. In addition, there was no detectable elevation in the transcription of Alas1, coding for 5-aminolevulinate synthase, which can also occur in situations of heme insufficiency {unpublished data). The expression of nine other CYPs was detected but was not significantly different between Cypla2(-/-) and Cyp1a2(+/+) mice (Table 3). Interestingly, this includes the Cyp2e1 gene, encoding an enzyme that is constitutively quite highly expressed in mouse liver and known to be induced by ethanol and involved in small-molecule intermediary metabolism, diabetes mellitus diabetes mellitus

Disorder of insufficient production of or reduced sensitivity to insulin. Insulin, synthesized in the islets of Langerhans (see Langerhans, islets of), is necessary to metabolize glucose. In diabetes, blood sugar levels increase (hyperglycemia).
 and ketosis ketosis /ke·to·sis/ (ke-to´sis) accumulation of excessive amounts of ketone bodies in body tissues and fluids, occurring when fatty acids are incompletely metabolized.ketot´ic

ke·to·sis
n. pl.
, as well as in the metabolism of drugs and dietary components.

Hprt gene expression. The unexpected observation that the Hprt gene is elevated more than 5-fold (Table 1) can most likely be explained by use of the Hprt minigene cassette in the selective elimination of the Cyp1a2gene in ES cells (Liang et al. 1996). In all probability, Hprt expression is being driven by the nearby Cyp1a2 5'-flanking regulatory region and promoter. We are unable to conclude with certainty that none of the changes observed (Tables 1, 2) are the downstream consequence of this striking elevation in Hprt expression.

Conclusions

In summary, absence of the mouse Cyp1a2 gene appears to lead to changes in expression of some genes related to cell growth as well as to a downregulation of genes in energy production mediated by insulin. These endogenous functions would appear to be separate from any activity involving the metabolism of environmental chemicals. It is possible that this Cyp1a2 gene knockout reflects a general disturbed metabolic activity and an intrinsic function (Nebert and Dieter 2000) of CYP1A2 in liver and energy metabolism, which results in the decreased ability of lipid to accumulate within the hepatocyte cytoplasm cytoplasm: see protoplasm.
cytoplasm

Portion of a eukaryotic cell outside the nucleus. The cytoplasm contains all the organelles (see eukaryote).
. It is also not possible at this stage to deduce if there is any phenotypic consequence of Hprt overexpression resulting from the use of this gene in developing the knockout mouse line. It will be easy enough in the near future, however, to disrupt this Hprt selection gene and re-examine re·ex·am·ine also re-ex·am·ine  
tr.v. re·ex·am·ined, re·ex·am·in·ing, re·ex·am·ines
1. To examine again or anew; review.

2. Law To question (a witness) again after cross-examination.
 the Cypla2(-/-) knockout mouse in the absence of Hprt.
Table 1. Hepatic genes significantly expressed to a greater extent
in Cyp1a2(-/-) compared with that in Cyp1a2(+/+) mice.

Description(a)                                    Symbol (a)

Hypoxanthine guanine phosphoribosyltransferase    Hprt (b)
Growth arrest and DNA-damage-inducible 45 gamma   Gadd45g
Cytochrome P450, 2a4 (c)                          Cyp2a4
Major urinary protein-1                           Mup1
RIKEN cDNA 0610010A22 gene                        0610010A22Rik
Cytochrome P450, steroid inducible 3a11           Cyp3a11
E4F transcription factor-1                        E4f1
Cytochrome P450, 7b1                              Cyp7b1
Glutathione S-transferase, pi 2                   Gstp2
Ferritin light chain-1                            Ftl1
NADPH-P450 (cytochrome) oxidoreductase            Por

Description(a)                                    Accession no. (a)

Hypoxanthine guanine phosphoribosyltransferase        BF148132
Growth arrest and DNA-damage-inducible 45 gamma       AI662702
Cytochrome P450, 2a4 (c)                              AI118260
Major urinary protein-1                               AI225954
RIKEN cDNA 0610010A22 gene                            AA198519
Cytochrome P450, steroid inducible 3a11               AI255364
E4F transcription factor-1                            AA270628
Cytochrome P450, 7b1                                  AI287063
Glutathione S-transferase, pi 2                       AA152555
Ferritin light chain-1                                AA059749
NADPH-P450 (cytochrome) oxidoreductase                BI144049

Description (a)                                   Mean (b)      SD

Hypoxanthine guanine phosphoribosyltransferase      5.38       1.80
Growth arrest and DNA-damage-inducible 45 gamma     3.16       1.06
Cytochrome P450, 2a4 (c)                            1.54       0.50
Major urinary protein-1                             1.89       1.06
RIKEN cDNA 0610010A22 gene                          1.85       0.52
Cytochrome P450, steroid inducible 3a11             1.67       0.75
E4F transcription factor-1                          1.65       0.76
Cytochrome P450, 7b1                                1.64       0.89
Glutathione S-transferase, pi 2                     1.59       0.46
Ferritin light chain-1                              1.61       0.70
NADPH-P450 (cytochrome) oxidoreductase              1.53       0.38

(a) From GenBank database (http://www.ncbi.nlm.nih.gov/entrez/query.
fcgi?db=unigene). (b) Ratio of expression in the Cyp1a2(-/-) compared
with that in the Cyp1a2(+/+) mouse. Results are means of five mice per
line and significantly different at p < 0.05. (b) This may arise, in
part or in total, from the HAT-selective minigene used for the
selection of the transfected ES cells. (c) Also probably recognizing
CYP2A5 cDNA and any other mouse CYP2A cDNA.

Table 2. Hepatic genes significantly expressed to a lower degree in
Cyp1a2(-/-) compared with that in Cyp1a2(+/+) mice.

Description (a)                                     Symbol (a)

Cytochrome P450, 1a2, aromatic compound inducible   Cyp1a2
Insulin-like growth factor binding protein-1        Igfbp1
G0/G1 switch gene-2                                 G0s2
Fatty acid synthase                                 Fasn
Cytochrome P450, 4a14                               Cyp4a14
Stearoyl-coenzyme A desaturase-1                    Scd1
3-Hydroxy-3-methylglutaryl-coenzyme A reductase     Hmgcr
Glucokinase                                         Gk
Fatty acid-binding protein 2, intestinal            Fabp2
Similar to tyrosine aminotransferase
Cytochrome P450, 4a10                               Cyp4a10
UDP-glucose ceramide glucosyltransferase            Ugcg
Protein tyrosine phosphatase, nonreceptor type 16   Ptpn16
Glutamyl aminopeptidase                             Enpep
Phosphoenolpyruvate carboxykinase-1, cytosolic      Pck1
Pre-B-cell leukemia transcription factor 1          Pbx1
Apolipoprotein A-tV                                 Apoa4
Serum amyloid P-component                           Sap
Pyruvate dehydrogenase Elalpha subunit              Pdha1
Farnesyl diphosphate synthetase                     Fdps
Glutamate dehydrogenase                             Glud

Description (a)                                     Accession no. (a)

Cytochrome P450, 1a2, aromatic compound inducible       AA242360
Insulin-like growth factor binding protein-1            W10866
G0/G1 switch gene-2                                     NM_008059
Fatty acid synthase                                     BF531259
Cytochrome P450, 4a14                                   AI893426
Stearoyl-coenzyme A desaturase-1                        AA269438
3-Hydroxy-3-methylglutaryl-coenzyme A reductase         W18347
Glucokinase                                             AI194797
Fatty acid-binding protein 2, intestinal                AA596309
Similar to tyrosine aminotransferase                    AA066836
Cytochrome P450, 4a10                                   AB018421
UDP-glucose ceramide glucosyltransferase                AA116263
Protein tyrosine phosphatase, nonreceptor type 16       AI528560
Glutamyl aminopeptidase                                 AA170635
Phosphoenolpyruvate carboxykinase-1, cytosolic          AA063800
Pre-B-cell leukemia transcription factor 1              W85267
Apolipoprotein A-tV                                     AI385459
Serum amyloid P-component                               AI157330
Pyruvate dehydrogenase Elalpha subunit                  AW106750
Farnesyl diphosphate synthetase                         BE986882
Glutamate dehydrogenase                                 W09330

Description (a)                                     Mean (b)     SD

Cytochrome P450, 1a2, aromatic compound inducible    <0.01     <0.01
Insulin-like growth factor binding protein-1          0.12      0.08
G0/G1 switch gene-2                                   0.20      0.09
Fatty acid synthase                                   0.27      O.15
Cytochrome P450, 4a14                                 0.28      0.26
Stearoyl-coenzyme A desaturase-1                      0.33      0.17
3-Hydroxy-3-methylglutaryl-coenzyme A reductase       0.36      0.25
Glucokinase                                           0.38      0.18
Fatty acid-binding protein 2, intestinal              0.40      0.09
Similar to tyrosine aminotransferase                  0.41      0.22
Cytochrome P450, 4a10                                 0.42      0.15
UDP-glucose ceramide glucosyltransferase              0.45      0.28
Protein tyrosine phosphatase, nonreceptor type 16     0.45      0.37
Glutamyl aminopeptidase                               0.45      0.33
Phosphoenolpyruvate carboxykinase-1, cytosolic        0.47      0.34
Pre-B-cell leukemia transcription factor 1            0.48      0.39
Apolipoprotein A-tV                                   0.54      0.15
Serum amyloid P-component                             0.57      0.27
Pyruvate dehydrogenase Elalpha subunit                0.58      0.19
Farnesyl diphosphate synthetase                       0.58      0.25
Glutamate dehydrogenase                               0.61      0.37

(a) From GenBank database (http://www.ncbi.nlm.nih.gov/entrez/
query.fcgi?db=unigene), (b) Ratio of expression in the Cyp1a2(-/-)
compared with that in the Cyp1a2(+/+) mouse. Results are means of
five mice per line and significantly different at p < 0.05.

Table 3. Hepatic Cyp and other possibly relevant genes whose
expression is not significantly different between the
Cyp1a2(-/-) and Cyp1a2(+/+) mice.

Description (a)                     Symbol (a)        Accession no. (a)

Cytochrome P450, 17                  Cyp17               AA097768
Cytochrome P450, 2a12                Cyp2a12             AA255330
Cytochrome P450, 2610,
  phenobarbital-inducible, type b    Cyp2b10             AI196037
Cytochrome P450, 2c29                Cyp2c29             AI529126
Cytochrome P450, 2d9                 Cyp2d9              AA986388
Cytochrome P450, 2e1,
  ethanol-inducible                  Cyp2e1              AA717630
Cytochrome P450, 2f2                 Cyp2f2              AA242452
Cytochrome P450, 2j6                 Cyp2j6              AI323934
Cytochrome P450, 3a25                Cyp3a25-pending     AA061713
Aryl-hydrocarbon receptor            Ahr                 AA274836
Heme oxygenase (decycling)-1         Hmox1               W08092
Heme oxygenase (decycling)-2         Hmox2               AI428016

Description (a)                     Mean (b)    SD

Cytochrome P450, 17                  0.80      0.19
Cytochrome P450, 2a12                1.00      0.16
Cytochrome P450, 2610,
  phenobarbital-inducible, type b    1.02      0.20
Cytochrome P450, 2c29                1.10      0.37
Cytochrome P450, 2d9                 0.94      0.15
Cytochrome P450, 2e1,
  ethanol-inducible                  0.92      0.43
Cytochrome P450, 2f2                 1.17      0.31
Cytochrome P450, 2j6                 0.72      0.21
Cytochrome P450, 3a25                1.15      0.37
Aryl-hydrocarbon receptor            1.19      0.37
Heme oxygenase (decycling)-1         1.30      0.16
Heme oxygenase (decycling)-2         1.00      0.23

(a) From GenBank database (http://www.ncbi.nlm.nih.gov/entrez/
query.fcgi?db=unigene).

(b) Ratio of expression in the Cyp1a2(-/-)
compared with that in the Cyp1a2(+/+) mouse. Results are means of
five mice per line and not significantly different (p > 0.05).

Table 4. Real-time PCR changes in expression of some
hepatic genes in Cyp1a2(-/-) compared with that in Cyp1a2(+/+) mice.

Expression      Mean (a)   SD   Forward primer

Upregulation
  Gadd45g       4.26      2.57  GACCGCTGGCGTCTACGA
  Cyp2a4/2a5    2.40      0.97  TCGAGGAGCGCATCCAA
  Mup1          1.72      0.58  GGGAAACCTFCCAGCTGATG
  Cyp3a11       1.36      0.55  TTAAGAATGTGCTAGTGAAGGAATGTTT
  CypTb1        1.42      0.54  GCTCTCGGCCCTGTFCCT
  Por           1.21      0.34  GCTGCAGGCCCGCTACTA

Downregulation
  Igfbp1        0.09      0.05  CCATCAGCACCTATAGCAGCAT
  G0s2          0.13      0.03  AACGCCAAAGCCAGTCTGA
  Fasn          0.21      0.10  CATTGGTGGTGTGGACATGGT
  Cyp4a14       0.11      0.12  CAAGACCCTCCAGCATTTCC
  Scd1          0.24      0.10  CAACACCATGGCGTFCCA
  Hmgcr         0.37      0.25  CGAGGAAAGACTGTGGTTTGTG
  Gk            0.33      0.05  GCACACGTGGTGCTITFGAG
  Fabp2         0.43      0.13  CCTAGAGACACACACAGCTGAGATC
  Pck1          0.53      0.27  TGTCGGAAGAGGACTTTGAGAAA

Expression       Reverse primer

Upregulation
  Gadd45g        GCACGCAAAAGGTCACATTGT
  Cyp2a4/2a5     GACTGTTCGGCTAAGGTAGAAGGT
  Mup1           GGATTCCATGCTCCTCACATAGT
  Cyp3a11        CATCCTTAGATATTGAGATAGCTTTACTCATTA
  CypTb1         GGGCCATGCCAAGATAAGG
  Por            CGCAGATGTGCACGGAGTT

Downregulation
  Igfbp1         ATTTGTAGATTTCATCTCCTGCTTTCT
  G0s2           CCTTGGCCAGAGGGATCA
  Fasn           GACCGCTTGGGTAATCCATAGAG
  Cyp4a14        GCTCCCCGAGAGACACTGTAA
  Scd1           GGTGGGCGCGGTGAT
  Hmgcr          CGTCAACCATAGCTTCCGTAGTT
  Gk             GCCTTCGGTCCCCAGAGT
  Fabp2          CCAAGCTTCCTCTTCATCACATT
  Pck1           TGCTGAATGGGATGACATACATG

(a) Ratio of expression in the Cyp1a2(-/-) compared with that in
the Cyp1a2(+/+) mouse, relative to that of Actb (forward primer,
GATTACTGCTCTGGCTCCTAGCA; reverse primer, GCCACC-GATCCACACAGAGT).
Results are means [+ or -] SD of three to four Cypla2(-/-) and
three to four Cyp1a2(+/+) mice.

Table 5. Intrahepatocyte versus interstitial fat in the
liver of Cyp1a2(-/-) and Cyp1a2(+/+) mice.

Volume density (%)                                     Cyp1a2(-/-)

Interstitium                                      11.0 [+ or -]  0.54
Glycogen in hepatocytes                           6.59 [+ or -]  1.0
Lipid in the whole liver                          7.84 [+ or -]  1.08
Hepatocyte lipid (in hepatocytes only)            6.38 [+ or -]  1.09
Hepatocyte lipid in whole liver                   5.72 [+ or -]  0.93
Interstitial lipid (in interstitium cells only)   25.6 [+ or -]  2.29
Interstitial lipid in whole liver                 2.19 [+ or -]  0.23

Volume density (%)                Cyp1a2(+/+)           p- value

Interstitium                      9.52 [+ or -] 0.47     0.089
Glycogen in hepatocytes           5.37 [+ or -] 0.85     NS
Lipid in the whole liver
Hepatocyte lipid (in              12.1 [+ or -] 1.63     0.035
  hepatocytes only)               11.7 [+ or -] 1.72     0.012
Hepatocyte lipid in whole liver
Interstitial lipid (in            10.7 [+ or -] 1.58     0.009
  interstitium cells only)        17.6 [+ or -] 2.09     0.02
Interstitial lipid in whole liver 1.35 [+ or -] 0.15     0.004

NS, not significant. The morphometric data from 28 Cyp1a2(-/-) and
28 Cyp1a2(+/+) mice, studied in our laboratory for more than 12
months from a number of different experiments, were combined to
assess the intrahepatocyte versus interstitial lipid stores.


REFERENCES

Akhtar RA, Reddy AB, Maywood ES, Clayton JD, King VM, Smith AG, et al. 2002. Circadian circadian /cir·ca·di·an/ (ser-ka´de-an) denoting a 24-hour period; see under rhythm.

cir·ca·di·an
adj.
Relating to biological variations or rhythms with a cycle of about 24 hours.
 cycling of the mouse liver transcriptome The transcriptome is the set of all messenger RNA (mRNA) molecules, or "transcripts", produced in one or a population of cells. The term can be applied to the total set of transcripts in a given organism, or to the specific subset of transcripts present in a particular cell type. , as revealed by cDNA microarray, is driven by the suprachiasmatic nucleus suprachiasmatic nucleus

anatomic nucleus which innervates the pineal gland; thought to play a part in the management of circadian rhythms.
. Curr Biol 12:540-550.

Buters JT, Tang BK, Pineau T, Gelboin HV, Kimura S, Gonzalez FJ. 1996. Role of CYP1A2 in caffeine pharmacokinetics and metabolism: studies using mice deficient in CYP1A2. Pharmacogenetics Pharmacogenetics Definition

Pharmacogenetics is the study of how the actions of and reactions to drugs vary with the patient's genes.
Description
 6:291-296.

Camus-Randon AM, Raffalli F, Bereziat JC, McGregor D, Konstandi M, Lang MA. 1996. Liver injury and expression of cytochromes P450: evidence that regulation of CYP2A5 is different from that of other major xenobiotic-metabolizing CYP enzymes. Toxicol Appl Pharmacol 136:140-148.

Dalton TP, Dieter MZ, Matlib RS, Childs NL, Shertzer HG, Genter MB, et al. 2000a. Targeted knockout of Cyp1a1 gene does not alter hepatic constitutive expression of other genes in the mouse [Ah] battery. Biochem Biophys Res Commun 267:184-189.

Dalton TP, Miller ML, Wu X, Menon A, Cianciolo E, McKinnon RA, et al. 2000b. Refining the mouse chromosomal location of Calm, the major gene associated with susceptibility to cadmium-induced testicular testicular /tes·tic·u·lar/ (tes-tik´u-lar) pertaining to a testis.

tes·tic·u·lar
adj.
Of or relating to a testicle or testis.



testicular

pertaining to the testis.
 necrosis. Pharmacogenetics 10:141-151.

DeRisi JL, Iyer VR, Brown PO. 1997. Exploring the metabolic and genetic control of gene expression on a genomic scale. Science 276:680-686.

Dorne JL, Walton K, Renwick AG. 2001. Uncertainty factors for chemical risk assessment. Human variability in the pharmacokinetics of CYP1A2 probe substrates. Food Chem Toxicol 39:681-696.

Eaton DL, Gallagher EP, Bammler TK, Kunze KL. 1995. Role of cytochrome P450 1A2 in chemical carcinogenesis car·ci·no·gen·e·sis
n.
The production of cancer.



carcinogenesis

production of cancer.


biological carcinogenesis
viruses and some parasites are capable of initiating neoplasia.
: implications for human variability in expression and enzyme activity Enzyme activity
A measure of the ability of an enzyme to catalyze a specific reaction.

Mentioned in: Glucose-6-Phosphate Dehydrogenase Deficiency
. Pharmacogenetics 5:259-274.

Eisen MB, Brown PO. 1999. DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 arrays for analysis of gene expression. Meth Enzymol 303-179-205.

Fornace AJ Jr, Nebert DW, Hollander MC, Luethy JD, Papathanasiou M, Fargnoli J, et al. 1989. Mammalian genes coordinately regulated by growth arrest signals and DNA-damaging agents. Mol Cell Biol 9:4196-4203.

Heilmann L J, Sheen YY, Bigelow SW, Nebert DW. 1988. The trout P450 IA1. cDNA and deduced protein sequence, expression in liver, and evolutionary significance. DNA 7:379-387.

Hollander MC, Kovalsky O, Salvador JM, Kim KE, Patterson AD, Haines DC, et al. 2001. Dimethylbenzanthracene carcinogenesis in Gadd45a-null mice is associated with decreased DNA repair and increased mutation frequency. Cancer Res 61:2487-2491.

Joseph SB, Laffitte BA, Patel PH, Watson MA, Matsukuma KE, Walczak R, et al. 2002. Direct and indirect mechanisms for regulation of fatty acid synthase gene expression by liver X receptors. J Biol Chem 277:11019-11025.

Kimura S, Kawabe M, Ward JM, Morishima H, Kadlubar FF, Hammons G J, et al. 1999. CYP1A2 is not the primary enzyme responsible for 4-aminobiphenyl-induced hepatocarcinogen, esis in mice Carcinogenesis 20:1825-1830.

Lavery DJ, Lopez-Molina L, Margueron R, Fleury-Olela F, Conquet F, et al. 1999. Circadian expression of the steroid 15a-hydroxylase (Cyp2a4) and coumarin 7-hydroxylase (Cyp2a5) genes in mouse liver is regulated by the PAR leucine-zipper transcription factor DBP DBP Diastolic Blood Pressure
DBP Development Bank of the Philippines
DBP Database Project (Visual Studio File Extension)
DBP DNA Binding Protein
DBP Disinfection Byproduct
DBP Deutsche Bundespost
. Mol Cell Biol 19:6488--6499.

Le Marchand L, Franke AA, Custer L, Wilkens LR, Cooney RV. 1997. Lifestyle and nutritional correlates of cytochrome CYP1A2 activity: inverse associations with plasma lutein lutein /lu·te·in/ (-in)
1. a lipochrome from the corpus luteum, fat cells, and egg yolk.

2. any lipochrome.


lu·te·in
n.
1.
 and ([alpha]-tocopherol. Pharmacogenetics 7:11-19.

Liang HC, Li H, McKinnon RA, Duffy JJ, Potter SS, Puga A, et al. 1996. Cyp1a2(-/-) null mutant mice develop normally but show deficient drug metabolism Drug Metabolism/Interactions Definition

Drug metabolism is the process by which the body breaks down and converts medication into active chemical substances.
Precautions

Drugs can interact with other drugs, foods, and beverages.
. Proc Natl Acad Sci U S A 93:1671-1676.

Liang HC, McKinnon RA, Nebert DW. 1997. Sensitivity of CYP1A1 mRNA inducibility by dioxin is the same in Cyp1a2(+/+) wild-type and Cyp1a2(-/-) null mutant mice. Biochem Pharmacol 54:1127-1131.

Nebert DW. 1997. Polymorphisms in drug-metabolizing enzymes: what is their clinical significance and why do they exist? Am J Hum Genet genet: see civet.  60:265-271.

Nebert DW, Dalton TP, Stuart GW, Carvan MJ III. 2000a. "Gene-swap knock-in" cassette in mice to study allelic al·lele  
n.
One member of a pair or series of genes that occupy a specific position on a specific chromosome.



[German Allel, short for Allelomorph, allelomorph, from English
 differences in human genes. Ann NY Acad Sci 919:148-170.

Nebert DW, Dieter MZ. 2000. The evolution of drug metabolism. Pharmacology 61:124-135.

Nebert DW, Duffy JJ. 1997. How knockout mouse lines will be used to study the role of drug-metabolizing enzymes and their receptors during reproduction and development, and in environmental toxicity, cancer, and oxidative stress. Biochem Pharmacol 53:249-254.

Nebert DW, McKinnon RA, Puga A. 1996. Human drug-metabolizing enzyme polymorphisms: effects on risk of toxicity and cancer. DNA Cell Biol 15:273-280.

Nebert DW, Nelson DR, Coon coon: see raccoon.  M J, Estabrook RW, Feyereisen R, Fujii-Kuriyama Y, et al. 1991. The P450 superfamily superfamily /su·per·fam·i·ly/ (soo´per-fam?i-le)
1. a taxonomic category between an order and a family.

2.
: update on new sequences, gene mapping, and recommended nomenclature. DNA Cell Biol 10:1-14.

Nebert DW, Roe AL, Dieter MZ, Soils WA, Yang Y, Dalton TP. 2000b. Role of the aromatic hydrocarbon receptor and [Ah] gene battery in the oxidative stress response, cell cycle control, and apoptosis. Biochem Pharmacol 59:65-85.

Nebert DW, Russell DW. 2002. Clinical importance of the cytochromes P450. Lancet 360:1155-1162.

Negishi M, Lindberg R, Burkhart B, Ichikawa T, Honkakoski P, Lang M. 1989. Mouse steroid 15[alpha]-hydroxylase gene family: identification of type II P450(15(z) as coumarin 7-hydroxylase. Biochemistry 28:4169-4172.

Pelkonen O. 2002. Cross-talk between signal transduction systems and cytochrome P450 regulation. Pharmacologist 44(2)(suppl 1):A142.

Peters JM, Morishima H, Ward JM, Coakley CJ, Kimura S, Gonzalez FJ. 1999. Role of CYP1A2 in the toxicity of long-term phenacetin feeding in mice. Toxicol Sci 50:62-69.

Pineau T, Fernandez-Salguero P, Lee SS, McPhail T, Ward JM, Gonzalez FJ. 1995. Neonatal lethality associated with respiratory distress Respiratory distress
A condition in which patients with lung disease are not able to get enough oxygen.

Mentioned in: Lung Cancer, Non-Small Cell
 in mice lacking cytochrome P450 1A2. Proc Natl Acad Sci U S A 92:5134-5136.

Shertzer HG, Dalton TP, Talaska G, Nebert DW. 2002. Decrease in 4-aminobiphenyl-induced methemoglobinemia in Cyp1a2(-/-) knockout mice. Toxicol Appl Pharmacol 161:32-37.

Sinclair PR, Gorman N, Dalton T, Walton HS, Bement W J, Sinclair JF, et al. 1996. Uroporphyria produced in mice by iron and 5-aminolaevulinic acid does not occur in Cyp1a2(-/-) null mutant mice. Biochem J 330:149-153.

Sinclair PR, Gorman N, Walton HS, Bement W J, Dalton TP, Sinclair JF, et al. 2000. CYP1A2 is essential in murine murine /mu·rine/ (mur´en) pertaining to, derived from, or characteristic of mice or rats.

mu·rine
adj.
 uroporphyria caused by hexachlorobenzene and iron. Toxicol Appl Pharmacol 162:60-67.

Smith AG, Clothier B, Carthew P, Childs NL, Sinclair PR, Nebert DW, et al. 2001. Protection of the Cyp1a2(-/-) null mouse against uroporphyria and hepatic injury following exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin. Toxicol Appl Pharmacol 173:89-98.

Turton NJ, Judah DJ, Riley J, Davies R, Lipson D, Styles JA, et al. 2001. Gene expression and amplification in breast carcinoma cells with intrinsic and acquired doxorubicin doxorubicin /doxo·ru·bi·cin/ (dok?so-roo´bi-sin) an antineoplastic antibiotic, produced by Streptomyces peucetius, which binds to DNA and inhibits nucleic acid synthesis; used as the hydrochloride salt and as a liposome-encased  resistance. Oncogene oncogene

Gene that can cause cancer. It is a sequence of DNA that has been altered or mutated from its original form, the proto-oncogene (see mutation). Proto-oncogenes promote the specialization and division of normal cells.
 20:1300-1306.

van der Lugt N, Maandag ER, te Riele H, Laird PW, Berns A. 1991. A pgk::hprtfusion as a selectable marker for targeting of genes in mouse embryonic stem cells: disruption of the T-cell receptor 5-chain-encoding gene. Gene 105:263-267.

Wastl UM, Rossmanith W, Lang MA, Camus-Randon AM, Grasl-Kraupp B, Bursch W, et al. 1998. Expression of cytochrome P450 2A5 in preneoplastic and neoplastic neoplastic /neo·plas·tic/ (ne?o-plas´tik)
1. pertaining to a neoplasm.

2. pertaining to neoplasia.


neoplastic

pertaining to neoplasia or a neoplasm.
 mouse liver lesions. Mol Carcinog 22:229-234.

Yeagley D, Guo S, Unterman T, Quinn PG. 2001. Gene-and activation-specific mechanisms for insulin inhibition of basal and glucocorticoid-induced insulin-like growth factor binding protein-1 and phosphoenolpyruvate carboxykinase transcription. Roles of forkhead and insulin response sequences. J Biol Chem 276:33705-33710.

Zaccaro C, Sweitzer S, Pipino S, Gorman N, Sinclair PR, Sinclair JF, et al. 2001. Role of cytochrome P450 1A2 in bilirubin degradation, studies in Cyp1a2(-/-) mutant mice. Biochem Pharmacol 61:843-849.

This article was previously published in the inaugural Toxicogenomics Section of EHP EHP
abbr.
1. effective horsepower

2. electric horsepower
.

Address correspondence to D.W. Nebert, Dept. of Environmental Health, University of Cincinnati The University of Cincinnati is a coeducational public research university in Cincinnati, Ohio. Ranked as one of America’s top 25 public research universities and in the top 50 of all American research universities,[2]  Medical Center, PO Box 670056, Cincinnati, OH, USA 45267. Telephone: (513) 558-4347. Fax: (513) 558 0925. E-mail: dan.nebert@uc.edu

We thank B. Clothier, C. Travis, A. Andringa, and colleagues for help.

This work was funded in part by National Institutes of Health grants R01 ES06321 and P30 ES06096 (T.P.D., D.W.N.).

Received 9 August 2002; accepted 20 November 2002.

Andrew G. Smith, (1) Reginald Davies, (1) Timothy P. Dalton? Marian L. Miller? David Judah, (1) Joan Riley, (1) Timothy Gant, (1) and Daniel W. Nebert (2)

(1) MRC Toxicology Unit, Hodgkin Building, University of Leicester History
The University was founded as Leicestershire and Rutland College in 1918. The site for the University was donated by a local textile manufacturer, Thomas Fielding Johnson, in order to create a living memorial for those who lost their lives in World War I.
, Leicester, United Kingdom; (2) Department of Environmental Health and Center for Environmental Genetics, University of Cincinnati Medical Center, Cincinnati, Ohio, USA
COPYRIGHT 2003 National Institute of Environmental Health Sciences
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2003, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Author:Nebert, Daniel W.
Publication:Environmental Health Perspectives
Date:May 15, 2003
Words:7277
Previous Article:Gene expression profiles associated with inflammation, fibrosis, and cholestasis in mouse liver after griseofulvin. (Article).
Next Article:Development of a DNA microarray for toxicology based on hepatotoxin-regulated sequences. (Article).



Related Articles
Applications of Gene Arrays in Environmental Toxicology: Fingerprints of Gene Regulation Associated with Cadmium Chloride, Benzo(a)pyrene, and...
Progress in the Application of DNA Microarrays? (Reviews).
Application of toxicogenomic analysis to risk assessment of delayed long-term effects of multiple chemicals, including endocrine disruptors in human...
Gene expression profiles associated with inflammation, fibrosis, and cholestasis in mouse liver after griseofulvin. (Article).
Benzene's adverse effects: microarrays reveal breadth of toxicity.(Science Selections)
Mechanisms of benzene-induced hematotoxicity and leukemogenicity: cDNA microarray analyses using mouse bone marrow tissue.(Toxicogenomics)
Overview of an interlaboratory collaboration on evaluating the effects of model hepatotoxicants on hepatic gene expression.(Genomics and Risk...
Quantitative PCR deconstruction of discrepancies between results reported by different hybridization platforms.(Genomics and Risk Assessment:...
Subchronic exposure to TCDD, PeCDF, PCB126, and PCB153: effect on hepatic gene expression.(Toxicogenomics)
Recent applications of DNA microarray technology to toxicology and ecotoxicology.

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles