Inhaled Crocidolite Mutagenicity in Lung DNA.We used transgenic mice carrying the lacI reporter gene to study the mutagenesis mutagenesis /mu·ta·gen·e·sis/ (mu?tah-jen´e-sis) 1. the production of change. 2. the induction of genetic mutation. mu·ta·gen·e·sis n. pl. potential of asbestos crocidolite crocidolite or blue asbestos Gray-blue to green, highly fibrous (asbestiform) form of the amphibole mineral riebeckite. It has higher tensile strength than chrysotile asbestos. . The animals were exposed by nose-only inhalation to an aerosol containing 5.75 mg/[m.sup.3] crocidolite dust for 6 hr/day and 5 consecutive days. After 1, 4, and 12 weeks, we examined four end points: the cytology of bronchoalveolar lavage, the lung load of crocidolite, the hydrophobic DNA adducts, and the mutations in the lacI reporter gene. Twelve weeks after exposure, nearly 10% of the inhaled fibers remained in the lung (227 [+ or -] 103 ng/mg lung). There was evidence of a typical inflammatory response consisting of multinucleate mul·ti·nu·cle·ate or mul·ti·nu·cle·at·ed adj. Having two or more nuclei. multinuclear, multinucleate cells having more than one nucleus. macrophages Macrophages White blood cells whose job is to destroy invading microorganisms. Listeria monocytogenes avoids being killed and can multiply within the macrophage. at weeks 4 and 12, whereas immediately after the exposure, we observed numerous polymorphonuclear polymorphonuclear /poly·mor·pho·nu·cle·ar/ (-noo´kle-er) having a nucleus so deeply lobed or so divided as to appear to be multiple. pol·y·mor·pho·nu·cle·ar adj. Having a lobed nucleus. neutrophils neutrophils (ner·ō·trōˑ·filz), n.pl white blood cells with cytoplasmic granules that consume harmful bacteria, fungi, and other foreign materials. . The mutant frequency significatively increased during the fourth week after the exposure: 13.5 x [10.sup.-5] in the exposed group versus 6.9 x [10.sup.-5] in the control group. The induction factor, defined by the ratio of checked mutants of exposed mice to checked mutants of control mice, was 1.96. The mutation spectrum of control lung DNA DNA: see nucleic acid. DNA or deoxyribonucleic acid One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes. and exposed lung DNA was similar, suggesting the possible involvement of a DNA repair decrease in crocidolite-treated animals. We used the [sup.32]P-postlabeling method and did not detect any increase of either 5 mC or bulky adduct adduct /ad·duct/ (ah-dukt´) to draw toward the median plane or (in the digits) toward the axial line of a limb. adduct /ad·duct/ (a´dukt) inclusion complex. in treated mice. This is the first study that demonstrates asbestos mutagenicity mutagenicity /mu·ta·ge·nic·i·ty/ (-je-nis´it-e) the property of being able to induce genetic mutation. mutagenicity the property of being able to induce genetic mutation. in vivo after a nose-only inhalation. Key words: adduct, asbestos, crocidolite, lung DNA, lacI gene, macrophage macrophage /mac·ro·phage/ (mak´ro-faj) any of the large, mononuclear, highly phagocytic cells derived from monocytes that occur in the walls of blood vessels (adventitial cells) and in loose connective tissue (histiocytes, phagocytic , mutation, transgenic. Environ Health Perspect 108:341-346 (2000). [Online 23 February 2000] http://ehpnet1.niehs.nih.gov/docs/2000/108p341-346rihn/abstract.html Although the use of asbestos fibers has been banned in most industrialized in·dus·tri·al·ize v. in·dus·tri·al·ized, in·dus·tri·al·iz·ing, in·dus·tri·al·iz·es v.tr. 1. To develop industry in (a country or society, for example). 2. countries, they are still a major environmental, occupational, and personal health concern. Asbestos fibers are considered tumorigenic tu·mor·i·gen·ic adj. Capable of causing tumors. and mutagenic mutagenic inducing genetic mutation. for humans according to the U.S. Registry of Toxic Effects of Chemical Substances Registry of Toxic Effects of Chemical Substances (RTECS) is a database of toxicity information compiled from the open scientific literature without reference to the validity or usefulness of the studies reported. (1). Physical dimension, biopersistence, surface reactivity, and fiber overload are all involved in the pathogenesis of asbestosis asbestosis Lung disease caused by long-term inhalation of asbestos fibres. A pneumoconiosis found primarily in asbestos workers, asbestosis is also seen in people living near asbestos industries. , bronchogenic carcinoma, and mesothelioma Mesothelioma Definition Mesothelioma is an uncommon disease that causes malignant cancer cells to form within the lining of the chest, abdomen, or around the heart. Its primary cause is believed to be exposure to asbestos. [reviewed by Kane (2)]. At the molecular level, oxidative stress and cytokine Cytokine Any of a group of soluble proteins that are released by a cell to send messages which are delivered to the same cell (autocrine), an adjacent cell (paracrine), or a distant cell (endocrine). release by alveolar macrophages (AMs) and neutrophils are invoked in the pathogenesis of these illnesses (2). Asbestos is thought to be a complete carcinogen (3), which means that it has the capability to initiate and promote tumors. Because asbestos fibers are not directly electrophilic, it has been proposed that asbestos is not a mutagenic compound per se (4). In fact, past in vitro studies have shown no mutagenic or weak mutagenic activity of asbestos samples [reviewed by Jaurand (5)]. Using the Salmonella typhimurium TA 102 oxidative stress sensitive strain, Faux et al. (6) showed mutagenicity induced by crocidolite, but not by chrysotile chrysotile: see serpentine. chrysotile Fibrous variety of the magnesium silicate mineral serpentine; it is the most important asbestos mineral. Individual fibres are white and silky, but the aggregate in veins is usually green or yellowish. (chrysotile is the most-used asbestos worldwide). However, the mammalian cell paradigm found mutagenicity for both crocidolite and chrysotile at the [S.sub.1] locus (7) and for 50 [micro]g/mL chrysotile at the HLA-A locus. Nevertheless, no mutagenicity was manifested at the HPRT HPRT Hypoxanthine-guanine phosphoribosyl transferase, see there locus (7-9) with crocidolite fibers. Furthermore, crocidolite induced a loss of heterozygosity Loss of heterozygosity (LOH) in a cell represents the loss of one parent's contribution to part of the cell's genome. LOH can arise via several pathways, including deletion, gene conversion, mitotic recombination and chromosome loss. in vitro at the HLA-A locus (10), as did chrysotile in Big Blue transgenic Rat 2[Lambda] cells (Stratagene, La Jolla, CA) at the [Lambda] locus (11). Although many experiments have been performed in vitro to demonstrate the mutagenicity of asbestos (clastogenic effects and mitotic mitotic pertaining to mitosis. mitotic activity degree to which a cell population is proliferating; used as an index of tumor aggression. abnormalities), there is a lack of in vivo studies to assert this important property. Thus we investigated more extensively the in vivo mutagenesis potential, if any, of asbestos fibers. To our knowledge, no mutagenesis studies have been conducted on whole animals. We used a transgenic mouse system carrying the lacI reporter gene and investigated the effect of crocidolite fibers in a short-term assay. The animals were exposed by nose-only inhalation for 5 days, then four end points were analyzed: the inflammatory response of the lung, the lung burden of fibers, the DNA adduct formation, and the mutation rate as well as the position and the nature of the mutation on the lacI reporter gene induced by crocidolite fibers. Materials and Methods Mice. We obtained transgenic male LacI mice C57/Bl6 (lambda LIZ LIZ Elizabeth LIZ Lisette LIZ Leather Institute of Zimbabwe , BigBlue) from Stratagene. The mice were randomized ran·dom·ize tr.v. ran·dom·ized, ran·dom·iz·ing, ran·dom·iz·es To make random in arrangement, especially in order to control the variables in an experiment. and numbered by tattoo. The animals were housed in polycarbonate cages (1/cage) covered with spun-bonded polyester cage filters. The room temperature was 21 [+ or -] 1 [degrees] C, and the pressure was 5 mm [H.sub.2]O above the atmospheric pressure. The humidity ranged from 40 to 60% and a fluorescent light was on for 12 hr/day. The animals were fed with pellet food and water ad libitum. Two-month-old animals were exposed to the crocidolite aerosol; control animals were housed in nose-only exposure tubes without crocidolite during the experiment (6 hr/day for 5 days). We terminated the experiment 1, 4, or 12 weeks after the beginning of the exposure, depending on the animal group. Exposure techniques. The crocidolite sample used in this study came from a batch (gift of R.E.G E.G For Example . Rendall, National Center for Occupational Health, Johannesburg, South Africa) that replaced the original Union Internationale Contre le Cancer (Geneva Geneva, canton and city, Switzerland Geneva (jənē`və), Fr. Genève, canton (1990 pop. 373,019), 109 sq mi (282 sq km), SW Switzerland, surrounding the southwest tip of the Lake of Geneva. , Switzerland) sample when it ran out. The fiber size distribution of the gift batch is extensively described in a previous study (12). The elementary analysis of this crocidolite sample was checked by emission spectroscopy (ICAP (1) (Internet Content Adaptation Protocol) A high-level protocol for requesting services from an Internet-based server. iCAP provides a common format for requesting services using standard HTTP messaging. 61E; Thermo Jarrell Ash, Franklin, MA). The result of the analysis, expressed as the mean of three determinations, in percent, was Mg, 1.49; Si, 22.8; Fe, 30.0; Mn, 0.097; Al, 0.05; Cr, [is less than] 0.002; and Ni, 0.017. The fiber aerosol generator was previously described by Rihn et al. (12). In brief, the fibers were packed into a cylinder and pushed with a Teflon-coated piston on a steel brush. Clean air was provided by a six-bar compressor that delivered a 100-L/min air stream by an inverted inverted reverse in position, direction or order. inverted L block a pattern of local filtration anesthesia commonly used in laparotomy in the ox. cyclone device. The tangential position of the air inlet pipe gave the air flow a helicoidal Hel`i`coid´al a. 1. Same as Helicoid. movement from the top to the bottom of the cell to ensure the aerosol homogeneity. The aerosol concentrations were monitored online by photometry photometry (fōtŏm`ətrē), branch of physics dealing with the measurement of the intensity of a source of light, such as an electric lamp, and with the intensity of light such a source may cast on a surface area. . We used the chamber as previously described by Rihn et al. (12). Briefly, the control process included measurements of the air flow, the depression, the temperature, and the humidity. We transferred all output signals to a computer, which processed sensor information, calculated regulation loops, and dispatched analogical an·a·log·i·cal adj. Of, expressing, composed of, or based on an analogy: the analogical use of a metaphor. an tensions to the regulation valves. A second computer was connected to the first and was used to monitor the inhalation chamber conditions (air flow and relative humidity), the aerosol concentration, and the adjustments of the aerosol generator parameters. The temperature of the atmosphere was maintained between 20 and 22 [degrees] C, the humidity between 40 and 60%, and the air volume exchange (100 L) was 60 times/hr. To avoid contamination of ambient air by inhalation of chamber pollutants, pressures inside the inhalation chamber and the glove box surrounding the chamber were maintained below the room pressure at 5 and 2.5 mm [H.sub.2]O, respectively. Animals were housed in transparent restraining tubes inserted in the inhalation chamber, a stainless concentric cylinder with a 48-tube capacity. The mice were continuously exposed nose only to the crocidolite aerosol (subjects) or to the ambient air (control mice). Small holes in each of the restraining tubes prevented hyperthermal hy·per·ther·mi·a n. Unusually high body temperature. hy per·ther effects. This flow-past design allowed each animal to breathe fresh
crocidolite aerosol of well regulated particle concentration and size at
all times; reinhalation of exhaled test atmosphere was minimized. The
fraction of exhaled air in the chamber was [is less than] 1/1,000 on the
basis of regular mouse breathing (25 mL/min/mouse) (13).Atmosphere control. We determined the concentration of airborne dust by sampling on GF/C filters (Whatman International Ltd., Maidstone, UK) for 5-6 hr at a flow rate of 2 L/min. The sampling head was an open-faced Millipore cassette (Millipore, Bedford, MA). The weight of the filters before and after sampling was corrected according to the weight variations of three unexposed filters. To determine the fiber number, we chose a short sampling period (5-10 sec) to avoid fiber amounts that were too high fiber and to avoid filter overload. We used 0.8-[micro]m mixed ester cellulose membranes to sample the fibers, which were counted by phase-contrast microscopy (12). We assessed the fiber size distribution of either the aerosol or the bulk crocidolite sample by transmission electron microscopy “TEM” redirects here. For other uses, see TEM (disambiguation). Transmission electron microscopy (TEM) is an imaging technique whereby a beam of electrons is transmitted through a specimen, then an image is formed, magnified and directed to appear either (100CX; JEOL JEOL Japan Electron Optics Laboratory Ltd., Tokyo, Japan). For this measurement, the fibers were deposited on a Nucleopore (Millipore) filter covered with a thin layer of carbon. To check the absence of contaminating metals produced by the generator, we also sampled dust on Whatman QM-A filters and analyzed by emission spectroscopy (ICAP 61E; Thermo Jarrell Ash, Franklin, MA). Cytologic, histologic, and ultrastructural examinations. At the end of each time-point, we measured bronchoalveolar liquids by washing the lung 2 times with 500 [micro]L phosphate buffered saline Phosphate buffer saline (abbreviated PBS) is a buffer solution commonly used in biochemistry. It is a salty solution containing sodium chloride, sodium phosphate and potassium phosphate. The buffer helps to maintain a constant pH. solution (pH 7.4). We determined the cell number after Trypan Blue (0.04% w/v) staining, and the nucleated nucleated /nu·cle·at·ed/ (noo´kle-at?id) having a nucleus or nuclei. nu·cle·at·ed adj. Having a nucleus or nuclei. nucleated having a nucleus or nuclei. cells were recorded in triplicate using a Thoma-Weiss counting cell (PolyLabs, Strasbourg, France). In addition, a portion of the bronchoalveolar liquid (100 [micro]L) was spun for 5 min at 29g (Cytospin 2; Shandon, Pittsburgh, PA). The May Grunwald Giemsa staining was then performed and AMs, polymorphonucleated cells (PMC (1) See Portable Media Center. (2) (PCI Mezzanine Card) A PCI-based mezzanine card that is widely adapted to VMEbus, CompactPCI and PCI cards. ), and the lymphocytes (L) were counted. Our results are the mean of three independent measures. For histologic observations, we fixed lung specimens from control and treated animals in Bouin's solution or in 4% (v/v) aqueous formalin formalin /for·ma·lin/ (for´mah-lin) formaldehyde solution. for·ma·lin n. An aqueous solution of formaldehyde that is 37 percent by weight. solution, then embedded in paraffin, sectioned, stained with hematoxylin/eosin, and evaluated by adapting the Wagner scale as described previously (12) with an Ortoplan microscope (Leitz, Wetzlar, Germany). To evaluate the fiber burden in the lungs, we cleaned the frozen left lobe of four control and four treated animals in acetone acetone (ăs`ĭtōn), dimethyl ketone (dīmĕth`əl kē`tōn), or 2-propanone (prō`pənōn), CH3COCH3 to remove the fat, dried them to constant weight, and reduced them to ashes in a low-temperature oven (150 [degrees] C) for 2 hr. The ashes were gently homogenized ho·mog·e·nize v. ho·mog·e·nized, ho·mog·e·niz·ing, ho·mog·e·niz·es v.tr. 1. To make homogeneous. 2. a. To reduce to particles and disperse throughout a fluid. b. in ultrapure water by handshaking Signals transmitted back and forth over a communications network that establish a valid connection between two stations. 1. handshaking - Predetermined hardware or software activity designed to establish or maintain two machines or programs in synchronisation. , then filtered over a carbon-covered Nucleopore membrane (25 mm diameter, 0.4 [micro]m pore size). We did not choose ultrasonic treatment because we previously demonstrated that this treatment can change the fiber size distribution (12). The retained particles were covered with a second layer of carbon. Under this prepared filter, five electron microscopy grids were deposited onto the filtering apparatus. Ten milliliters of chloroform chloroform (klôr`əfôrm) or trichloromethane (trī'klôrōmĕth`ān), CHCl3 was filtered through the grids to dissolve the Nucleopore filters and retain the fibers, if any, on the grids. We observed the fibers with the transmission electron microscope (Jeol 100CX) at 33,000x magnification. This technique allowed us to determine the quantity of fibers and the volume and the mass that could be calculated with the knowledge of the density (d = 3.35 g/[cm.sup.3]). Finally, we determined the ratio of the fiber mass to the lung weight (expressed in nanograms per milligram milligram /mil·li·gram/ (mg) (mil´i-gram) one thousandth (10-3) of a gram. mil·li·gram n. Abbr. mg A metric unit of mass equal to one thousandth (10-3) of a gram. lung). Lung DNA extraction, in vitro packaging, and mutation analysis. We prepared high-molecular-weight lung DNA from a small piece of lung (100 mg) according to the protocol developed by Stratagene (14). After homogenization homogenization (həmŏj'ənəzā`shən), process in which a mixture is made uniform throughout. Generally this procedure involves reducing the size of the particles of one component of the mixture and dispersing them evenly (six strokes in a dounce) using Rnace-it buffer (Stratagene), the DNA samples were phenol/chloroform extracted, then we carefully ethanol precipitated the samples and resuspended them in 500 [micro]L TE (Tris-HCl, 10 mmol, EDTA EDTA: see chelating agents. 1 mmol, pH = 8.0). Before packaging, the DNA was electrophoresed in 1.5% agarose gel to check the size and control the absence of a smear below 50 kB. We recovered the lambda-shuttle vector in viable phage phage: see bacteriophage. phage - A program that modifies other programs or databases in unauthorised ways; especially one that propagates a virus or Trojan horse. See also worm, mockingbird. The analogy, of course, is with phage viruses in biology. by incubating the extracted DNA (approximately 50 [micro]g) with the terminase and the phage proteins contained in the Transpack (Stratagene) as described by the manufacturer. We matched control and exposed animals for each packaging reaction. The average of plaques per packaging reaction was 38,000, and varied from 19,000 to 69,000. There was no statistical difference for transformation efficiency between control and exposed animals. The in vitro packaged phages were adsorbed on E. coli SCS-8 cells and screened for blue mutant plaques on 625 [cm.sup.2] NYZ agar plates containing 1.5 mg X-gal/ml top agar. The plaque density varied from 8,000 to 10,000 per assay tray. We applied internal color sensitivity control (CM0, CM1, CM2, and CM3; Stratagene) for each plating. Incubation lasted between 16 and 20 hr and the blue mutants were screened using a red filter. We confirmed the phenotype of each mutant plaque by phage replating at low density in the presence of X-gal. The phage was further isolated by coring the plaque and resuspending the phage in the buffer described in Stratagene's protocol (14). We extracted DNA and amplified it with the appropriate primers of the lacI gene for further sequencing (forward direction 1781: GACACCATCGAATGGTGAAAAC; reverse direction 1780: CCGCTCACAATTCCACACAACAT). The lacI gene of 60 phages from both control and exposed mice was entirely sequenced using the six primer sets recommended in the BigBlue protocol (14) to determine the distribution of the mutations. We determined the sequences using the Abi prism dye terminator cycle sequencing ready reaction kit (Perkin Elmer Biosystems, Foster City, CA) on a 373A sequencer See MIDI sequencer. (music) sequencer - Any system for recording and/or playback of music via a programmable memory which stores music not as audio data, but as some representation of notes. (Perkin Elmer Biosystems). Screening for bulky adducts and determination of m5dC level in DNA. We detected hydrophobic DNA adducts using the [[sup.32]P]-postlabeling method, which had not previously been used, to check the presence of DNA adducts in asbestos studies. Briefly, the DNA was digested into 3'-phosphonucleosides by micrococcal nuclease and spleen phosphodiesterase phosphodiesterase /phos·pho·di·es·ter·ase/ (-di-es´ter-as) any of a group of enzymes that catalyze the hydrolytic cleavage of an ester linkage in a phosphoric acid compound containing two such ester linkages. . Adducts were privileged versus normal nucleotides by nuclease nuclease /nu·cle·ase/ (noo´kle-as) any of a group of enzymes that split nucleic acids into nucleotides and other products. nu·cle·ase n. [P.sub.1] enrichment. We postlabeled the adducts using [[Gamma] [sup.32]P]-adenosine triphosphate triphosphate /tri·phos·phate/ (tri-fos´fat) a salt containing three phosphate radicals. tri·phos·phate n. A salt or ester containing three phosphate groups. (ATP ATP: see adenosine triphosphate. ATP in full adenosine triphosphate Organic compound, substrate in many enzyme-catalyzed reactions (see catalysis) in the cells of animals, plants, and microorganisms. ) and [T.sub.4] polynucleotide polynucleotide /poly·nu·cleo·tide/ (-noo´kle-o-tid) any polymer of mononucleotides. pol·y·nu·cle·o·tide n. kinase, as described previously (15). The adducts were chromatographed on PEI-cellulose thin-layer plates using four solvents: Na[H.sub.2][PO.sub.4] 2.3 M, pH = 5.7; urea 6.25 M, lithium formate formate /for·mate/ (for´mat) a salt of formic acid. for·mate n. A compound, such as a salt or ester of formic acid, that contains the HCOO- radical. 3.25 M, pH = 3.5; urea 7.5 M, lithium formate 4.25 M, pH= 3.5; and Na[H.sub.2][PO.sub.4] 1.7 M. For the m5dC determination, we hydrolyzed the DNA into 3'-phosphonucleosides that were labeled directly with [Gamma][sup.32]P]-ATP. The resulting [[sup.32]P]-5',3'-diphosphonucleosides were further hydrolyzed into [[sup.32]P]-5'-monophosphate nucleosides by nuclease [P.sub.1]. The labeled mononucleotides were separated on cellulose plates (F1440; Schleicher and Schull, Dassel, Germany) and revealed using the solvents as previously mentioned (15). We used radioautography to detect the labeled nucleotides and we evaluated the radioactivity using a Bio-Imager Bas2000 analyzer (Fuji, Tokyo, Japan). Results Measurement of the fiber concentration in the chamber and in the lung of the mice. We measured the dust concentrations in the chamber by sampling onto glass filters 6 hr/day, as described in "Materials and Methods." The dust concentration mean was 5.75 [+ or -] 0.87 mg/[m.sup.3]. The average fiber density was 1,875 [+ or -] 1,216 fibers/[cm.sup.3] (n = 24) when we considered only the fibers [is greater than] 5 [micro]m in length and [is less than] 3 [micro]m in diameter. The fiber size distribution was similar to that of a previous study (12). The proportion of fiber that met Stanton's criteria (16) did not vary over the experiment time and remained [is less than] 3% of the overall fibers; thus the crocidolite aerosol used in our study was mainly composed of short fibers (Table 1). The elementary fiber analysis either in the inhalation chamber or in the mice lungs did not show any difference as compared to the initial crocidolite sample (data not shown). Table 1. Size distribution of the fibers in the exposed animals and of the crocidolite aerosol.
5 [micro]m
L < 5 < L < 20
Sample [micro]m [micro]m
Treated, 1 week(b) 86.3 [+ or -] 5.0 13.6 [+ or -] 4.9
Treated, 12 weeks(b) 86.6 [+ or -] 2.0 13.1 [+ or -] 2.1
Aerosol(c) 91.1 8.4
L > 20 Stanton's
Sample [micro]m fiber(a)
Treated, 1 week(b) 0.2 [+ or -] 0.3 2.9 [+ or -] 1.7
Treated, 12 weeks(b) 0.3 [+ or -] 0.2 2.1 [+ or -] 0.6
Aerosol(c) 0.4 2.3
Sample L/D ratio
Treated, 1 week(b) 19.15 [+ or -] 2.39
Treated, 12 weeks(b) 19.88 [+ or -] 1.44
Aerosol(c) -
Abbreviations: D, diameter; L, length. (a) L > 8 [micro]m, D < 0.25 [micro]m. (b) n = 4; Rihn et al. (12) shows the precise aerosol description. (c) Typical fiber size distribution of an aerosol sample. We checked the lung fiber content in four control and four exposed mice 1 week and 12 weeks after the intoxication. No fibers were detected in control mice after either 1 or 12 weeks. Indeed, the measured mass of fiber was [is less than] 1 ng/mg lung (Table 2). In contrast, exposed animals had an average of 693 [+ or -] 496 ng fibers/mg lung corresponding to 1.63 x [10.sup.6] ([+ or -] 1.19 x [10.sup.6]) fibers/mg lung 1 week after the intoxication. Twelve weeks later, the lung content was still 227 [+ or -] 103 ng/mg corresponding to 0.62 x [10.sup.6]; ([+ or -] 0.21 x [10.sup.6]) fibers/mg lung. When considering normal breathing of 25 mL/min air, on average, 17.1 and 6.6% of the total inhaled fibers (estimated approximately to 84.4 x [10.sup.6]) lasted 1 and 12 weeks, respectively, in the mice lung after the intoxication. The average of the length-on-diameter ratio was 19.15 and 19.88 at 1 and 12 weeks after the exposure, respectively (p [is greater than] 0.05). Moreover, the fiber size distribution remained unchanged in the lung after 12 weeks and was similar to the fiber size distribution of the aerosol sample (Table 1).
Table 2. Fiber load in lung.
Mice group(a) Lung weight (mg)
Control, 1 week 8.28 [+ or -] 0.55
Treated, 1 week 8.86 [+ or -] 1.16
Control, 12 weeks 9.38 [+ or -] 0.86
Treated, 12 weeks 8.95 [+ or -] 0.09
Mice group(a) Fiber number
Control, 1 week Not detectable
Treated, 1 week 1.63 x [10.sup.6] ([+ or -] 1.19 x [10.sup.6])
Control, 12 weeks Not detectable
Treated, 12 weeks 0.62 x [10.sup.6] ([+ or -] 0.21 x [10.sup.6])
Fiber mass
Mice group(a) (ng/mg) Wagner scale
Control, 1 week < 1 -
Treated, 1 week 693 [+ or -] 496 -
Control, 12 weeks < 1 1.0 [+ or -] 0.0
Treated, 12 weeks 227 [+ or -] 103 1.7 [+ or -] 0.5
(a) n = 4 for each group. Cellular responses of the bronchoalveolar liquids. Table 3 shows the cellular response of the 1-, 4-, and 12-week series. One week after the intoxication, the number of viable cells elevated dramatically because of a huge increase of PMCs and lymphocytes. However, the number of AMs with two nuclei was approximately 13 times higher in the treated group as compared to the control group. In addition, syncitia composed of three or more macrophages appeared in the exposed group. Table 3. Cellular response of the bronchoalveolar liquid after 1, 4, and 12 weeks after exposure. Week Group AM1 AM2 1 Control 49,000 [+ or -] 19,800 230 [+ or -] 190 1 Treated 41,100 [+ or -] 20,000 3,100 [+ or -] 2,100(*) 4 Control 43,700 [+ or -] 24,100 320 [+ or -] 190 4 Treated 32,800 [+ or -] 10,900 1,900 [+ or -] 600(*) 12 Control 20,900 [+ or -] 11,900 120 [+ or -] 100 12 Treated 44,900 [+ or -] 13,400 900 [+ or -] 280(*) Week AM3 PMC 1 0 [+ or -] 0 490 [+ or -] 550 1 800 [+ or -] 700(*) 380,000 [+ or -] 390,000(*) 4 0 [+ or -] 0 690 [+ or -] 1,000 4 340 [+ or -] 160(*) 260 [+ or -] 320 12 0 [+ or -] 0 50 [+ or -] 40 12 130 [+ or -] 100(*) 120 [+ or -] 70 Week Lymphocytes Viable cells 1 230 [+ or -] 270 50,000 [+ or -] 20,400 1 4,400 [+ or -] 3,000(*) 437,000 [+ or -] 390,000(*) 4 270 [+ or -] 530 45,000 [+ or -] 24,300 4 220 [+ or -] 240 34,400 [+ or -] 11,900 12 0 [+ or -] 0 21,500 [+ or -] 11,400 12 50 [+ or -] 60 46,100 [+ or -] 13,700(*) AM1, AM2, and AM3 are alveolar macrophage with one, two, and three or more nuclei, respectively. (*) Significant at p < 0.05 calculated using the Student's t-test (n = 9; three independent measures per animal). Four weeks after the intoxication, only AMs with two or more nuclei were increased. Twelve weeks after the intoxication, the number of AMs was still increased and the AM population was responsible for the increase in total viable cells. The averages of Wagner scores were 1.0 and 1.7 for control and exposed mice, respectively, indicating an alveolar alveolar /al·ve·o·lar/ (al-ve´o-lar) [L. alveolaris ] pertaining to an alveolus. al·ve·o·lar adj. Relating to an alveolus. inflammatory response but no fibrosis in the lung (Table 2). Mutant frequency and mutation spectrum determinations. More than one million genetically independent events were analyzed for each mouse set. We used approximately 55-60 transpack reactions for each time point. The mutant frequency significantly increased 4 weeks after the intoxication: 13.5 x [10.sup.-5] [+ or -] 1.7 x [10.sup.-5] in the exposed group versus 6.9 x [10.sup.-5] [+ or -] 1.1 x [10.sup.-5] in the control group (Table 4). The induction factor, defined by the ratio of checked mutants to exposed mice versus checked mutants of control mice, was 1.96 (p [is less than] 0.05). In contrast, 1 and 12 weeks after the intoxication, the mutant frequencies of both mice groups were not significantly different. Table 4. Results of the in vivo mutagenesis assay using lung DNA. Week, group, Plaques mouse ID (n) Mutant frequency One week Control 1 413,130 0.000073 2 367,230 0.000114 3 575,510 0.000075 Mean [+ or -] SD 0.000087 [+ or -] 0.000023 Total plaques 1,355,870 Exposed 4 333,700 0.000093 5 366,620 0.000074 6 423,310 0.000076 Mean [+ or -] SD 0.000081 [+ or -] 0.000010 Total plaques 1,123,630 Four weeks Control 7 350,130 0.000080 8 359,040 0.000058 9 350,410 0.000068 Mean [+ or -] SD 0.000069(*) [+ or -] 0.000011 Total plaques 1,059,580 Exposed 10 409,920 0.000154 11 370,850 0.000124 12 221,880 0.000126 Mean [+ or -] SD 0.000135(*) [+ or -] 0.000017 Total plaques 1,002,650 Twelve weeks Control 13 336,380 0.000134 14 353,870 0.000065 15 364,650 0.000058 Mean [+ or -] SD 0.000086 [+ or -] 0.000042 Total plaques 1,054,900 Exposed 16 351,230 0.000068 17 337,200 0.000184 18 343,500 0.000079 Mean [+ or -] SD 0.000110 [+ or -] 0.000064 Total plaques 1,031,910 (*) Significant (p < 0.01, t-test). We determined the mutation spectrum 4 weeks after the exposure for 60 mutant plaques that were sequenced in both groups. Considering the 60 lacI genes from mutant plaques sequenced for each group, there were no significant differences between control and exposed mice, as mentioned in Table 5. Table 5. Mutation spectrum. Mutation type Control Treated Transition G:C ?? A:T 11 (18.3) 15 (25.4) A:T ?? G:C 4 (6.6) 2 (3.4) Transversion A:T ?? T:A 0 (0) 1 (1.7) A:T ?? C:G 2 (3.3) 1 (1.7) G:C ?? T:A 8 (13.3) 7 (11.9) G:C ?? C:G 1 (1.7) 2 (3.4) Insertion/deletion 30 (50.0) 31 (52.5) Complex 4 (6.7) 1 (1.7) Total 60 60 Mutations on CpC sites 10 (16.7) 17 (28.3) The percentage is indicated in parentheses See parenthesis. parentheses - See left parenthesis, right parenthesis. . We located the mutation positions for both groups (Figure 1). No difference appeared in the location between exposed and control mice (65 and 62 mutations determined, respectively). Similarly, there were no differences in either the 1-week or the 12-week groups (data not shown). [Figure 1 ILLUSTRATION OMITTED] Bulky adducts and methylation methylation, n a phase-II detoxification pathway in the liver; methyl groups combine with toxins to rid the body of various substances. methylation (meth´ status. The formation of bulky DNA adducts was ruled out by the [[sup.32]P] postlabeling method (15). As shown in Figure 2A and B, there was no difference in the DNA adduct profiles: both exhibited the same adducts, i.e., I-compounds generated by the endogenous metabolism. A slight decrease in the total amount of these I-compounds was detected: 160 versus 60 per [10.sup.9] nucleotides for control and treated mice, respectively. In addition, the [m.sub.5]dC/dC ratios measured in lung DNA were 3.0 [+ or -] 0.7 (n = 16) in control mice versus 3.5 [+ or -] 0.4 (n = 16) for the exposed mice. There was no statistical difference in the [m.sup.5]dC/dC ratio (p [is less than] 0.01) because it was assessed by radioactivity counting of [m.sup.5]dC and dC spots on thin-layer chromatography by phosphorimaging. [Figure 2 ILLUSTRATION OMITTED] Discussion The cumulated dose of asbestos administrated in our study by inhalation was low (5.75 mg/[m.sup.3] for 5 days) as compared to previous long-term assays on rodents (10-50 mg/[m.sup.3] for 200-500 days) (17). Taking into account the average ventilation volume of a mouse, the total inhaled dose of inhaled dust was 0.26 mg/mouse, approximately corresponding to [is less than] 0.5% of the average inhaled dose in classical long-term assays. However, it is remarkable that 6.6% of the inhaled dose was still in the lung 12 weeks after the end of the intoxication. Contrary to other studies, there was no overload effect in our study because [is less than] 10% (~ 9 x [10.sup.6]) of the total inhaled fibers was present in the lung 4 weeks after the inhalation when the mutagenic effect was significant. The Wagner scores of both groups were similar, indicating that the crocidolite dose was far below the maximum tolerated dose and thus avoiding overload effects (18). Moreover, the length/diameter ratio and the size distribution of the fibers deposited in the lung were similar 1 and 12 weeks after a 5-day exposure (Table 1). This similarity shows that in this period of time all fibers, whatever the size, had the same probability to be cleared, which contrasts with long-term assays in which short fibers are removed from the lung more rapidly than long fibers (19). It would be interesting to study the mutagenic effect of an asbestos batch composed mainly of long fibers ([is greater than] 20 [micro]m). Coin et al. (19) showed that chrysotile long fibers, which are more carcinogenic carcinogenic having a capacity for carcinogenesis. (16), remained for at least 6 months in the lung after a short treatment comparable to the present study. Asbestos fibers induce chromosomal changes in human cultured cell lines. Crocidolite and chrysotile (2 mg/[cm.sup.2]) induced anaphase anaphase /ana·phase/ (an´ah-faz) the third stage of division of the nucleus in either meiosis or mitosis. an·a·phase n. aberrations and abnormal mitoses in human immortalized mesothelial mesothelial pertaining to the mesothelium. mesothelial cells cover all serous membranes and normally found in fluid samples aspirated from the pleural or peritoneal cavities. cell lines (20). In human lymphocytes, chromosome and chromatid chromatid (krō`mətəd): see chromosome; crossing over. breaks have also been reported, as well as polyploidy Polyploidy The occurrence of related forms possessing chromosome numbers which are multiples of a basic number (n), the haploid number. Forms having 3n chromosomes are triploids; 4n, tetraploids; 5n, pentaploids, and so on. , provided that the dose was higher than 2 x [10.sup.5] fibers/[cm.sup.2] (approximately 5 fibers/cell) (5). This dose is higher as compared to the dose used in vivo in the present study. Considering a total lung area of 700 [cm.sup.2] for a 3-month-old mouse (13) and a total number of alveolar type I and II cells of 26 x [10.sup.6], the number of fibers per cell can be estimated 4 weeks after the intoxication as 0.35 fibers/cell. This value is not surprising because generally the doses needed to show in vitro effects are higher than those needed to show in vivo effects. After our study, we can conclude that mutations occur using a dose below the dose necessary for chromosome abnormalities. Asbestos fibers also induce binucleation, which is a consequence of mitotic abnormalities in pleural Pleural Pleural refers to the pleura or membrane that enfolds the lungs. Mentioned in: Pneumothorax pleural emanating from or pertaining to the pleura. mesothelial cells and macrophages. In the current study, binucleated bi·nu·cle·ate also bi·nu·cle·at·ed or bi·nu·cle·ar adj. Having two nuclei. Adj. 1. binucleated - having two nuclei binuclear, binucleate and multinucleated multinucleated characterized by having more than one nucleus per cell. multinucleated giant cell see giant cell. AMs, known as biomarkers of fiber burden, increase significantly after 4 and 12 weeks: these results were similar to those published previously (12). The first in vitro gene mutation assay (i.e., the Salmonella typhimurium assay) was not relevant for testing the mutagenicity of crocidolite. An improvement of the Ames test using the TA102 strain showed a mutagenic potential of 50 [micro]g/[cm.sup.2] crocidolite because of its sensitivity to oxidative damage (6). The hypoxanthine hypoxanthine /hy·po·xan·thine/ (-zan´then) a purine base formed as an intermediate in the degradation of purines and purine nucleosides to uric acid and in the salvage of free purines. Complexed with ribose it is inosine. guanine guanine (gwä`nēn), organic base of the purine family. It was reported (1846) to be in the guano of birds; later (1879–84) it was established as one of the major constituents of nucleic acids. phosphoribosyl transferase transferase /trans·fer·ase/ (trans´fer-as) a class of enzymes that transfer a chemical group from one compound to another. trans·fer·ase n. locus (HPRT) has been investigated in rat liver, Chinese ovary ovary, ductless gland of the female in which the ova (female reproductive cells) are produced. In vertebrate animals the ovary also secretes the sex hormones estrogen and progesterone, which control the development of the sexual organs and the secondary sexual , or human--hamster fibroblasts Fibroblasts A type of cell found in connective tissue; produces collagen. Mentioned in: Skin Grafting , but a mutagenic effect of crocidolite could not be demonstrated for any of the the cell systems used [reviewed by Jaurand (4)]. Therefore, it appears that the BigBlue transgenic system allows a more realistic picture of the genotoxic genotoxic /ge·no·tox·ic/ (je´no-tok?sik) damaging to DNA: pertaining to agents known to damage DNA, thereby causing mutations, which can result in cancer. ge·no·tox·ic adj. effects of an asbestos exposure in vivo. In such studies, a nonessential non·es·sen·tial adj. Being a substance required for normal functioning but not needed in the diet because the body can synthesize it. and silent gene, the so-called reporter gene, was used for mutation studies. With this latter system, each point mutation is detected in contrast to assays based on the HPRT locus, which are generally phenotypic end points. Recently, however, Park and Aust (21) improved the HPRT locus assay by using [hprt.sup.-] and [gpt.sup.+] G12 cells where the transgenic got gene is located on an autosomal chromosome, making this assay useful for asbestos mutagenicity testing. The improved assay showed a 2-fold increase of the mutant frequency with a 6-[micro]g/mL dose of crocidolite. Recent studies using transgenic rodents exposed to benzo[a]pyrene compared the mutant frequencies in both hprt and lacI genes. The lacI genes were 40 times more sensitive to a 150-mg/kg benzo[a]pyrene treatment in splenic splenic /splen·ic/ (splen´ik) pertaining to the spleen. splen·ic adj. Of, in, near, or relating to the spleen. splenic pertaining to the spleen. T cells (22). Such disparity could be due to the phenotypic expression of the concerned gene. In fact, lacI does not require in vivo expression, whereas the resistant 6-thioguanine phenotype ([hprt.sup.-]) is required in T cells. Other factors could be the different rate of benzo[a]pyrene adduct formation and repair processes in both genes. The lacI is a silent gene in the mouse; it is possible that the repair, before translation, is involved in a more efficient manner in the hprt gene. Therefore, it appears that a nonexpressed lacI transgene transgene a gene that has been incorporated into the genome of another organism. is more appropriate to study the genotoxicity Genotoxic substances are a type of carcinogen, specifically those capable of causing genetic mutation and of contributing to the development of tumors. This includes both certain chemical compounds and certain types of radiation. of compounds or particles such as asbestos than other end points based on the loss of heterozygosity of the HLA HLA human leukocyte antigens. HLA abbr. human leukocyte antigen HLA (human leuckocyte antigen) locus or [hprt.sup.-] phenotyping. In our study, we sequenced the lacI gene using the six primer sets in [is greater than] 60 mutant colonies isolated from exposed and control mice that represented [is greater than] 576,000 sequenced bases. We assessed the nature and the position of each mutation. The mutation frequency of control mice in our study varied from 6.9 x [10.sup.-5] to 8.7 x [10.sup.-5]. These values are slightly higher than the spontaneous mutant frequency determined in lung by de Boer et al. (23). This variation could be due to differences in the experimental conditions (e.g., the age of the mouse, the plating density, or DNA extraction). Table 5 and Figure 1 show that the mutation spectrum is similar in both groups, suggesting that the increased number of mutations could be due to an oxidative stress directed randomly against all nucleotides rather than to a direct and specific mutagenic effect of fibers, as is seen for initiating compounds such as o-anisidine and benzo[a]pyrene. The reactive oxygen species reactive oxygen species, n molecules and ions of oxygen that have an unpaired electron, thus rendering them extremely reactive. Many cellular structures are susceptible to attack by ROS contributing to cancer, heart disease, and cerebrovascular disease. (ROS ROS, n.pr See reactive oxygen species. ) could be produced by the macrophages and neutrophils burst, as assumed by Hei et al. (24), or by extracellular compounds due to fiber surface reactivity (25-27). ROS induce mostly deletions and insertions (28); Lezon-Geyda et al. (11) used an in vitro assay based on the same principle (10). Moreover, the BigBlue test is unable to detect large insertions and deletions of DNA because these phenomena change the size of the [Lambda] phage genome, which cannot be packaged. However an in vitro adaptation of the BigBlue system, using cultured Rat 2 [Lambda] fibroblasts, allowed Lezon-Geyda et al. (11) to demonstrate a 2.5-fold increase of the mitotic recombination recombination, process of "shuffling" of genes by which new combinations can be generated. In recombination through sexual reproduction, the offspring's complete set of genes differs from that of either parent, being rather a combination of genes from both parents. after a 6-[micro]g/mL treatment of crocidolite, thus making this test useful for insertion/deletion studies. Although the possibility of mutations through large insertions and deletions cannot be excluded in our test conditions, and because we found a clear increase of the mutant frequency, the exact mutation frequency due to asbestos is probably underestimated. It is also possible that asbestos impaired the repair potential of the cells, as shown by Okayasu et al. (29). An 8-[micro]g/mL dose of chrysotile decreased the cell survival and the double strand repair efficiency of double strand repair deficiency cells (xrs-5) as compared to wild-type cells (Chinese hamster ovary cell Chinese Hamster Ovary cells (CHO cells) are a cell line derived from Chinese Hamster ovary cells. They are often used in biological and medical research. They were introduced in the 1960s and are used in a cultured monolayer in culture flasks. ). The repair potential of DNA was not verified in the present study. Regardless of the mechanism involved, one can hypothesize hy·poth·e·size v. hy·poth·e·sized, hy·poth·e·siz·ing, hy·poth·e·siz·es v.tr. To assert as a hypothesis. v.intr. To form a hypothesis. that the mutant frequency must have increased because of oxidative stress above the repair ability of lung DNA. McGavran et al. (30) showed that a short-term chrysotile exposure (4 mg/[m.sup.3]) induced cellular proliferation, as assessed by in vivo [[sup.3]H]-thymidine incorporation, in epithelial as well as interstitial lung cells. Adamson (31) reported similar findings in lung cells after a single intratracheal administration of 0.1 mg crocidolite. Adamson (31) showed a proliferation of mesothelial and fibroblast fibroblast /fi·bro·blast/ (fi´bro-blast) 1. an immature fiber-producing cell of connective tissue capable of differentiating into chondroblast, collagenoblast, or osteoblast. 2. cells that peaked at 2% labeled nuclei and lasted for 3 weeks. Such an effect was also reported on mesothelial cells in Fischer 344 rats exposed to 8 mg/[m.sup.3] crocidolite for 20 days (32). Using our experimental design (a moderate dose of 0.26 mg crocidolite for 5 days and a physiologic route for the toxicant toxicant /tox·i·cant/ (tok´si-kant) 1. poisonous. 2. poison. tox·i·cant n. 1. A poison or poisonous agent. 2. An intoxicant. adj. ), one can hypothesize that a proliferation occurred in lung. Mitogenic factors released in the milieu (33,34) by the oxidative stress may fix the mutations shown 4 weeks after the crocidolite exposure. The decrease of the mutant frequency in the exposed mice of the 12-week series could be explained by epithelial regeneration and restored DNA repair after the acute exposure period. The induced cell death could also explain the normalization In relational database management, a process that breaks down data into record groups for efficient processing. There are six stages. By the third stage (third normal form), data are identified only by the key field in their record. of the mutant frequency seen after 12 weeks. Indeed, as demonstrated by Broaddus et al. (25), a fiber dose of 5 [micro]g/mL induced apoptosis on mesothelial cells in a ROS-induction manner because the apoptosis process was inhibited by extracellular catalase catalase /cat·a·lase/ (kat´ah-las) a hemoprotein enzyme that catalyzes the decomposition of hydrogen peroxide to water and oxygen, protecting cells. and superoxide dismutase enzymes. Adachi et al. (35) reported an increase of d[OH.sub.8]dG after an in vitro coincubation of deionized de·i·on·ize tr.v. de·i·on·ized, de·i·on·iz·ing, de·i·on·iz·es To remove ions from (a solution) using an ion-exchange process. de·i crocidolite and DNA. Furthermore, Takeuchi and Morimoto (36) showed an increase of this modified nucleotide in HL60 human cells treated with crocidolite and phorbol phorbol /phor·bol/ (for´bol) a polycyclic alcohol occurring in croton oil; it is the parent compound of the phorbol esters. phorbol ester myristate My`ris´tate n. 1. (Chem.) A salt of myristic acid. acetate, a strong mitogenic factor as well as an inducer inducer /in·duc·er/ (in-dldbomacs´er) a molecule that causes a cell or organism to accelerate synthesis of an enzyme or sequence of enzymes in response to a developmental signal. in·duc·er n. of ROS. However, they measured the total cell DNA, which could have been contaminated by mitochondrial DNA. d[OH.sub.8]dG is an early indicator of mitochondrial DNA injury (37). Future studies should determine the d[OH.sub.8]dG level in both nuclear and mitochondrial DNA. In our study, the mutation spectra of both groups of animals showed no statistical difference in the involvement of CpG sites (Table 5). Because mitochondrial DNA represents [is less than] 1% of total DNA, our results were not able to reveal a specific increase of this kind of mutation on dG nucleosides therein. We did not find an excess of adducts in the present study in exposed mice. This is not surprising because the [[sup.32]P]-postlabeling method detects only the bulky adducts. Inversely, the number of bulky adducts per genome seems more important in the control mice as compared to exposed animals: a similar finding was already noted by Randerath et al. (38), who found a gradual depletion of I-compounds during carcinogenesis car·ci·no·gen·e·sis n. The production of cancer. carcinogenesis production of cancer. biological carcinogenesis viruses and some parasites are capable of initiating neoplasia. in rodents. Howden and Faux (39) reported the presence of DNA adducts by using a fluorescence technique and demonstrated the role of lipid peroxidation products as malondialdehyde. This in vitro paradigm, however, was far from the physiological conditions. Moreover, the [[sup.32]p]-postlabeling method is more sensitive and detected only I-compounds using all in vivo paradigm in both exposed and control animals. Conclusions We demonstrated a significant increase of the mutant frequency (approximately twice that of the control) of lung DNA for the first time in crocidolite-exposed mice as compared to nonexposed mice. Our study is the first attempt to quantify and qualify the mutagenic potential in vivo with respect to a physiologically based and controlled mode of exposure (nose-only inhalation) without overload and with the respect to AM clearance of fibers. Our study shows that mutagenesis is an early event in fiber intoxication, which could be evoked in cell transformation due to asbestos fibers. In addition, a low dose of fibers, as compared to previous studies, is sufficient to observe mutagenesis in situ in lung DNA. The mice paradigm developed in this study should now be experienced with man-made mineral fiber with (e.g., ceramic fibers) and without (e.g., glass fiber) known carcinogenic potential in rodents. It would also be useful to measure the mutant frequency in vivo using asbestos of various sizes to correlate, if possible, the mutagenic and the carcinogenic potential of fibers in vivo. REFERENCES AND NOTES (1.) National Institute for Occupational Safety and Health National Institute for Occupational Safety and Health, n.pr an institute of the Centers for Disease Control and Prevention that is responsible for assuring safe and healthful working conditions and for developing standards of safety and health. . Asbestos, Crocidolide. Accession No. CI 6479000. Registry of Toxic Effects of Chemical Substances [CD-ROM CD-ROM: see compact disc. CD-ROM in full compact disc read-only memory Type of computer storage medium that is read optically (e.g., by a laser). ]. Hamilton, Ontario, Canada:Canadian Centre for Occupational Health and Safety The Canadian Centre for Occupational Health and Safety (CCOHS) is the agency of the federal Government of Canada which seeks to promote safe and healthy workplaces and prevent work-related injuries and illnesses. , December 1999. (2.) Kane AB. Mechanism of fiber carcinogenesis. IARC Sci Publ 140:11-34 (1996). (3.) Barrett JC, Lamb PW, Wiseman RW. Multiple mechanisms for the carcinogenic effects of asbestos and other mineral fibers. Environ Health Perspect 81:81 (1989). (4.) Jaurand MC. Mechanisms of fiber-induced genotoxicity. Environ Health Perspect 105(suppl 5):1073-1084 (1997). (5.) Jaurand MC. Mechanisms of fibre carcinogenesis. IARC Sci Publ 140:55-71 (1996). (6.) Faux SP, Howden PJ, Levy LS. Iron-dependent formation of 8-hydroxydeoxyguanosine in isolated DNA and mutagenicity in Salmonella typhimurium TA102 induced by crocidolite. Carcinogenesis 15:1749-1751 (1994). (7.) Hei TK, Piao CQ, He ZY, Vannais D, Waldren CA. Chrysotile fiber is a strong mutagen mutagen: see mutation. mutagen Any agent capable of altering a cell's genetic makeup by changing the structure of the hereditary material, DNA. Many forms of electromagnetic radiation (e.g. in mammalian cells. Cancer Res 52:6305-6309 (1992). (8.) Kenne K, Ljungquist S, Ringertz NR. Effects of asbestos fibers on cell division, cell survival, and formation of thioguanine-resistant mutants in Chinese hamster ovary cell. Environ Res 39:448-464 (1986). (9.) Reiss B, Solomon S, Tong C, Levenstein M, Rosenberg SH, Williams GM. Absence of mutagenic activity of three forms of asbestos in liver epithelial cells. Environ Res 27:389-397 (1982). (10.) Both K, Turner DR, Henderson DW. Loss of heterozygosity in asbestos-induced mutations in a human mesothelioma cell line. Environ Mol Mutagen 26:67-71 (1995). (11.) Lezon-Geyda K, Jaime CM, Godbold JH, Savransky EF, Hope A, Kheiri SA, Dzmura ZM, Uehara H, Johnson EM, Fasy TM. Chrysotile asbestos fibers mediate homologous recombination in Rat2 lambda fibroblasts: implications for carcinogenesis. Mutat Res 361:113-120 (1996). (12.) Rihn B, Kauffer E, Martin P, Coulais C, Villa M, Bottin MC, Vigneron vigneron a cultivator of grape vines; viticulturist. See also: Wine JC, Edorh A, Martinet mar·ti·net n. 1. A rigid military disciplinarian. 2. One who demands absolute adherence to forms and rules. [After Jean Martinet (died 1672), French army officer. N. Short-term crocidolite inhalation studies in mice: validation of an inhalation chamber. Toxicology 109:147-156 (1996). (13.) Brewer NR Respiratory physiology. In: The Mouse in Biomedical Research, Vol 3: Normative Biology, Immunology, and Husbandry (Foster HL, Small JD, Fox JG, ads). New York:Academic Press, 1983;252-256. (14.) Stratagene. Big Blue[R] Transgenic Mouse Mutagenesis Assay System, Instruction Manual. La Jolla, CA: Strategene, August 1992. (15.) Rihn B, Edorh A, Coulais C, Bottin MC, Keith G. Ethylene glycol monobutyl ether has neither epigenetic epigenetic /epi·ge·net·ic/ (-je-net´ik) 1. pertaining to epigenesis. 2. altering the activity of genes without changing their structure. nor genotoxic effects in acute treated rats, in subchronic treated v-Ha-ras transgenic mice. Occup Hyg 2:237-249 (1996). (16.) Stanton MF, Layard M, Tegeris A, Miller E, May M, Morgan E, Smith A. Relation of particle dimension to carcinogenicity carcinogenicity /car·ci·no·ge·nic·i·ty/ (kahr?si-no-je-nis´i-te) the ability or tendency to produce cancer. carcinogenicity the ability or tendency to produce cancer. in amphibole asbestoses and other fibrous minerals. J Natl Cancer Inst 67(5):965-975 (1981). (17.) WHO. Asbestos and Other Natural Mineral Fibers. Environmental Health Criteria 53. Geneva:World Health Organization, 1986;69-107. (18.) Oberdorster G. Pulmonary carcinogenicity of inhaled particles and the maximum tolerated dose. Environ Health Perspect 105(suppl 5):1347-1355 (1997). (19.) Coin PG, Osornio-Vargas AR, Roggli VL, Brody AR Pulmonary fibrogenesis after three consecutive inhalation exposures to chrysotile asbestos. Am J Respir Crit Care Mad 154:1511-1519(1996). (20.) Pelin K, Husgafvel-Pursiainen K, Vallas M, Vanhala E, Linnainmaa K. Cytotoxicity and anaphase aberrations induced by mineral fibers in cultured human mesothelial cells. Toxicol In Vitro 6:445-450 (1992). (21.) Park S-H, Aust AE. Participation of iron and nitric oxide in the mutagenicity of asbestos in [hgprt.sup.-], [gpt.sup.+] Chinese hamster V79 cells. Cancer Res 58:1144-1148 (1998). (22.) Skopek TR, Kort KL, Marino DR, Mittal LV, Umbenhauer DR, Laws GM, Adams SP. Mutagenic response of the endogenous hprt gene and lacI transgene in benzo[a]pyrene treated Big Blue B6C3[F.sub.1] mice. Environ Mol Mutagen 28:376-384 (1996). (23.) de Boer JG, Provost S, Gorelick N, Tindall K, Glickman BW. Spontaneous mutation in lacI transgenic mice: a comparison of tissues. Mutagenesis 13:109-114 (1998). (24.) Hei TK, Wu LJ, Piao CQ. Malignant transformation of immortalized human bronchial epithelial cells by asbestos fibers. Environ Health Perspect 105(suppl) 5:1085-1088 (1997). (25.) Broaddus VC, Yang L, Scavo LM, Ernst JD, Boylan AM. Crocidolite asbestos induces apoptosis of pleural mesothelial cells: role of reactive oxygen species and poly(ADP-ribosyl) polymerase. Environ Health Perspect 105(suppl 5):1147-1152 (1997). (26.) Simeonova PP, Toriumi W, Kommineni C, Erkan M, Munson AE, Rom WN, Luster MI. Molecular regulation of IL-6 activation by asbestos in lung epithelial cells: role of reactive oxygen species. J Immunol 159:3921-3928 (1997). (27.) Schapira RM, Ghio AJ, Effros RM, Morrisey J, Dawson CA, Hacker AD. Hydroxyl radicals are formed in the rat lung after asbestos instillation in vivo. Am J Respir Cell Mol Biol 10:573-579 (1994). (28.) Hsie AW, Xu Z, Yu Y, Sonier MA, Hrelia P. Molecular analysis of reactive oxygen-species-induced mammalian gene mutation. Teratogen teratogen /ter·a·to·gen/ (ter´ah-to-jen) any agent or factor that induces or increases the incidence of abnormal prenatal development.teratogen´ic te·rat·o·gen n. Carcinog Mutagen 10:115-124 (1990). (29.) Okayasu R, Takahashi S, Yamada S, Hei TK, Ulrich RL. Asbestos and double strand breaks. Cancer Res 59:298-300 (1999). (30.) McGavran PD, Moore LB, Brody AR. Inhalation of chrysotile asbestos induces rapid cellular proliferation in small pulmonary vessels of mice and rats. Am J Pathol 136:695-705 (1990). (31.) Adamson IY. Early mesothelial cell proliferation after asbestos exposure: in vivo and in vitro studies. Environ Health Perspect 105(suppl 5):1205-1208 (1997). (32.) BeruBe KA, Quinlan TR, Moulton G, Hemenway D, O'Shaughnessy P, Vacek P, Mossman BT. Comparative proliferative and histopathologic changes in rat lungs after inhalation of chrysotile or crocidolite asbestos. Toxicol Appl Pharmacol 137:67 74(1996). (33.) Osier osier (ō`zhər): see willow. M, Baggs RB, Oberdorster G. Intratracheal instillation versus intratracheal inhalation: influence of cytokines on inflammatory response. Environ Health Perspect 105(suppl 5):1265-1271 (1997). (34.) Finkelstein JN, Johnston C, Barrett T, Oberdorster G. Particulate-cell interactions and pulmonary cytokine expression. Environ Health Perspect 105(suppl 5):1179-1182 (1997). (35.) Adachi S, Yoshida S, Kawamura K, Takahashi M, Uchida H, Odagiri Y, Takemoto K. DNA damage and mesothelioma by crocidolite, with special reference to the presence of iron inside and outside of asbestos fiber. Carcinogenesis 15:753-758 (1994). (36.) Takeuchi T, Morimoto K. Crocidolite asbestos increased 8-hydroxydeoxyguanosine levels in cellular DNA of a human promyelocytic leukemia cell line, HL60. Carcinogenesis 15:635-639 (1994). (37.) Salazar JJ, Van Houten B. Preferential mitochondrial DNA injury caused by glucose oxidase as a steady generator of hydrogen peroxide in human fibroblasts. Mutat Res 385:139-149 (1997). (38.) Randerath K, Chang J, Randerath E. Age dependent DNA modifications (I-compounds): effects of carcinogenesis and oxidative stress. In: Oxidative Stress and Aging (Cutler RG, Packer L , Bertram J, Mori A, eds). Basel:Birkhauser Verlag, 1995;77-87. (39.) Howden PJ, Faux SP. Fibre-induced lipid peroxidation leads to DNA adduct formation in Salmonella typhimurium TA104 and rat lung fibroblasts. Carcinogenesis 17:413-419 (1996). Address correspondence to B. Rihn, Institut National de Recherche et de Securite Avenue de Bourgogne, BP 27 54501 Vandoeuvre Cedex, France. Telephone: 33 383 502 062. Fax: 33 383 508 711. E-mail: rihn@inrs.fr We thank C. Marry, L. Delsaut, M. Villa, and C. Dubon for excellent technical assistance and C. Saliou for critical reading. This study was partially supported by a grant (SE000482) of the Fondation pour la Recherche Medicale. Received 27 July 1999; accepted 9 November 1999. Bertrand Rihn,(1) Catherine Coulais,(1) Edmond Kauffer,(1) Marie-Claire Bottin,(1) Patrick Martin,(1) Francois Yvon,(1) Jean Claude Vigneron,(1) Stephane Binet,(1) Nathalie Monhoven,(2) Guy Steiblen,(3) and Gerard Keith(3) (1) Institut National de Recherche et de Securite, Vandoeuvre, France (2) Laboratoire de Biologie Moleculaire de l'Hopital Central de Nancy, Nancy, France (3) Unite Propre de Recherche 9002 du CNRS CNRS Centre National de la Recherche Scientifique (National Center for Scientific Research, France) CNRS Centro Nacional de Referencia Para El Sida (Argentinean National Reference Center for Aids) , Strasbourg, France |
|
||||||||||||||

per·ther
Printer friendly
Cite/link
Email
Feedback
Reader Opinion