Induction of proinflammatory cytokines and C-reactive protein in human macrophage cell line U937 exposed to air pollution particulates.Exposure to particulate matter air pollution causes inflammatory responses and is associated with the progression of atherosclerosis and increased cardiovascular mortality. Macrophages Macrophages White blood cells whose job is to destroy invading microorganisms. Listeria monocytogenes avoids being killed and can multiply within the macrophage. play a key role in atherogenesis atherogenesis /ath·ero·gen·e·sis/ (-jen´e-sis) formation of atheromatous lesions in arterial walls.atherogen´ic ath·er·o·gen·e·sis n. by releasing proinflammatory cytokines Cytokines Chemicals made by the cells that act on other cells to stimulate or inhibit their function. Cytokines that stimulate growth are called "growth factors. and forming foam cells in subendothelial lesions. The present study quantified the inflammatory response in a human macrophage macrophage /mac·ro·phage/ (mak´ro-faj) any of the large, mononuclear, highly phagocytic cells derived from monocytes that occur in the walls of blood vessels (adventitial cells) and in loose connective tissue (histiocytes, phagocytic cell line (U937) after exposure to an ambient particulate sample from urban dust (UDP UDP (uridine diphosphate): see uracil. (User Datagram Protocol) A protocol within the TCP/IP protocol suite that is used in place of TCP when a reliable delivery is not required. ) and a diesel exhaust particulate (DEP DEP Deposit DEP Deputy DEP Department of Environmental Protection DEP Dependent DEP Departure DEP Depot DEP Deposition DEP deployed (US DoD) DEP Data Execution Prevention (computer security) ). The effect of native UDP and DEP was compared with their corresponding organic extracts (OE-UDP/OE-DEP) and stripped partides (sUDP/sDEP) to clarify their respective roles. Exposure to OE-UDP, OE-DEP, UDP, DEP, and 2,3,7,8-tetrachlorodibenzo-p-dioxin led to a greater increase of interleukin (IL)-8, tumor necrosis tumor necrosis Death of tumor tissue, a common event in aggressive CAs in which the tumor rapidly outgrows its blood supply, resulting in tumor cell death. Cf Apoptosis. factor-[alpha], and cyclooxygenase-2 mRNA expression than did the stripped particles, whereas sUDP, sDEP, UDP, and DEP led to a greater production of C-reactive protein C-Reactive Protein Definition C-reactive protein (CRP) is a protein produced by the liver and found in the blood. Purpose C-reactive protein is not normally found in the blood of healthy people. and IL-6 mRNA. The particles and the organic extract-induced expression of cyclooxygenase-2 and cytochrome cytochrome (sī`təkrōm'), protein containing heme (see coenzyme) that participates in the phase of biochemical respiration called oxidative phosphorylation. P450 (CYP CYP In currencies, this is the abbreviation for the Cyprus Pound. Notes: The currency market, also known as the Foreign Exchange market, is the largest financial market in the world, with a daily average volume of over US $1 trillion. )1a1 was significantly suppressed by co-treatment with an aryl hydrocarbon receptor The Aryl hydrocarbon receptor (AhR) is member of the family of basic-helix-loop-helix transcription factors. AhR is a cytosolic transcription factor that is normally inactive, bound to several co-chaperones. (AhR) antagonist, indicating that these effects are mainly mediated by the organic components, which can activate the AhR and CYP1a1. In contrast, the induction of C-reactive protein and IL-6 seems to be a particle-related effect that is AhR independent. The inflammatory response induced by particulate matter was associated with a subsequent increase of cholesterol accumulation, a hallmark of foam cells. Together, these data illustrate the interaction between particulate matter and the inflammatory response as well as the formation of cholesterol-accumulating foam cells, which are early markers of cardiovascular disease Cardiovascular disease Disease that affects the heart and blood vessels. Mentioned in: Lipoproteins Test cardiovascular disease . Key words: aryl hydrocarbon receptor, cydooxygenase-2, C-reactive protein, cytokines, foam cells, interleukin-8, inflammation, macrophages, particles, 2,3,7,8-tetrachlorodibenzo-p-dioxin. Environ Health Perspect 113:1536-1541 (2005). doi:10.1289/ehp.8094 available via http://dx.doi.org//[Online 21 July 2005] ********** Numerous epidemiologic studies have observed that exposure to particulate matter (PM) air pollution, which occurs in many urban and industrial environments, is associated with an increase of cardiovascular diseases and mortality (Brook et al. 2003; Morris 2001). Although the exact components of PM and the exact mechanism leading to cardiovascular disease and cardiopulmonary disease mortality from exposure to PM are still unknown, several studies have shown that systemic inflammation may be a key step in these pathological processes through inflammatory mediators (Salvi et al. 1999) such as cyclooxygenase-2 (COX-2), interleukin (IL)-1[beta], and tumor necrosis factor-[alpha] (TNF TNF abbr. tumor necrosis factor TNF, n an abbreviation for tumor necrosis f [alpha]), which are among the most important mediators of the inflammatory response (Ross 1999) in the development of atherosclerotic vascular disease atherosclerotic vascular disease Atherosclerosis, see there (Libby 2002). A positive correlation of C-reactive protein (CRP C-reactive protein (CRP) A protein present in blood serum in various abnormal states, like inflammation. Mentioned in: Pelvic Inflammatory Disease CRP, n.pr See C-reactive protein. ) and coronary artery disease coronary artery disease, condition that results when the coronary arteries are narrowed or occluded, most commonly by atherosclerotic deposits of fibrous and fatty tissue. , which could be explained by the atherogenic ath·er·o·gen·ic adj. Initiating, increasing, or accelerating atherogenesis. atherogenic adjective Referring to the ability to initiate or accelerate atherogenesis—the deposition of atheromas, lipids, and effects of chronic inflammation chronic inflammation n. Inflammation that may have a rapid or slow onset but is characterized primarily by its persistence and lack of clear resolution; it occurs when the tissues are unable to overcome the effects of the injuring agent. , is well known (Beck et al. 1999; Mendall et al. 1996). Recently, an association between minor but chronic elevation of serum CRP levels and future major cardiovascular events has been shown (Yeh 2004). Elevated levels of proinflammatory cytokines and CRP play a significant role in the genesis of atherosclerosis and in plaque instability (Libby 2002). CRP activates complement through binding to the Fc[gamma] receptor and enhancing phagocytosis phagocytosis: see endocytosis. Phagocytosis A mechanism by which single cells of the animal kingdom, such as smaller protozoa, engulf and carry particles into the cytoplasm. of low-density lipoprotein low-density lipoprotein n. Abbr. LDL A lipoprotein that contains relatively high amounts of cholesterol and is associated with an increased risk of atherosclerosis and coronary artery disease. , leading to the formation of foam cells (Zwaka et al. 2001), thus directly contributing to the development of atherosclerosis. Despite the epidemiologic evidence, experimental verification of the causal relationship among air pollution, CRP, and cardiovascular disease is still limited. In vitro in vitro /in vi·tro/ (in ve´tro) [L.] within a glass; observable in a test tube; in an artificial environment. in vi·tro adj. In an artificial environment outside a living organism. studies show increased levels of proinflammatory cytokines including TNF[alpha], IL-l[beta], IL-6, and IL-8, which have been described in various cell types after exposure to PM (Mathiesen et al. 2004; Monn et al. 2003; Monn and Becker 1999; van Eeden et al. 2001). Acute exposure to diesel exhaust also increased IL-8 production in human airways (Salvi et al. 2000). However, elevated serum levels of CRP, the classic acute-phase protein, has only been found to be associated with exposure to an elevated concentration of PM in humans (Kim et al. 2005; Peters et al. 2001; Pope et al. 2004a; Seaton et al. 1999). Other harmful effects described by these authors involved the triggering of acute vasoconstriction vasoconstriction /vaso·con·stric·tion/ (-kon-strik´shun) decrease in the caliber of blood vessels.vasoconstric´tive va·so·con·stric·tion n. and the development of atherosclerosis. A few animal models have shown the harmful effects of inhalation of air pollutants on cardiovascular functions (Campen et al. 2003; Gordon et al. 1998), as well as on the etiology of atherosclerosis (Suwa et al. 2002). Suwa et al. (2002) showed that exposure of rabbits to P[M.sub.10] (PM with areodynamic diameter [less than or equal to] 10 [micro]m) causes progression of atherosderotic lesions, and a number of alveolar macrophages phagocytosed P[M.sub.10]. Direct effects of PM may occur via components that are able to cross the pulmonary epithelium into the circulation, such as gases, ultrafine particles (Nemmar et al. 2002), and soluble co-pollutants (e.g., polycyclic aromatic hydrocarbons and transition metals). To clarify the contribution of each component of PM in the induction of the inflammatory response, we systematically compared the effects induced by PM derived from different sources such as diesel exhaust particulates (DEP) and urban dust particulates (UDP) with those induced by their organic extracts OEDEP/OE-UDP and the fine particles or coarse fraction, represented by their stripped particles sDEP/sUDP and the ultrafine particles carbon black (CB). The present study provides evidence that the organic components of the native particles DEP and UDP play a major role in mediating the increase of the inflammatory cytokines TNF[alpha], IL-8, and COX-2. We also demonstrate, for the first time, an increased expression of CRP in macrophages induced by the particles that is mediated by the particulate composition rather than their organic components. Materials and Methods Reagents. National Institute of Standards and Technology National Institute of Standards and Technology, governmental agency within the U.S. Dept. of Commerce with the mission of "working with industry to develop and apply technology, measurements, and standards" in the national interest. (NIST (National Institute of Standards & Technology, Washington, DC, www.nist.gov) The standards-defining agency of the U.S. government, formerly the National Bureau of Standards. It is one of three agencies that fall under the Technology Administration (www.technology. ) Standard Reference Material (SRM (1) (Storage Resource Management) The management of the storage resources in an organization in order to avoid duplication of files and to determine space utilization across all servers. ) 1649, an atmospheric particulate material collected in an urban area, and a diesel exhaust particulate sample, NIST SRM 2975, were purchased from NIST (Gaithersburg, MD). CB 95 nm in diameter (FR103) were provided by Degussa (Frankfurt, Germany). We prepared stock solutions of particles by suspending them in autoclaved distilled water and by ultrasonication for 2 min at maximum power (100 W). Particles were used at 2.5, 10, or 40 [micro]g/[cm.sup.2], equivalent to 12.5, 50, or 200 [micro]g/mL. Concentrations are preferentially expressed in micrograms per square centimeter because particles rapidly sediment onto the cell layer. UDP and DEP were extracted by dichloromethane in a soxhlet apparatus. After sonication sonication /son·i·ca·tion/ (son?i-ka´shun) exposure to sound waves; disruption of bacteria by exposure to high-frequency sound waves. son·i·ca·tion n. the extract was filtered (0.45 [micro]m Acrodisc) and concentrated to 1 mL by TurboVap and stored in precleaned amber vials. The extract obtained was dried and then redissolved in dimethylsulfoxide di·meth·yl·sulf·ox·ide n. DMSO. . We used the OE-DEP and OE-UDP at concentrations corresponding to the amount of particles at 10 [micro]g/[cm.sup.2]. 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, > 99% purity) was originally obtained from Dow Chemicals Co. (Midland, MI). Dimethylsulfoxide and phorbol-12-myristate-13-acetate (TPA (Transient Program Area) See transient area. TPA - Transient Program Area ) were obtained from Aldrich Chemical Co. (St. Louis, MO). Other molecular biological reagents were purchased from Qiagen (Valencia, CA) and Roche (Indianapolis, IN). Cell culture and differentiation. We obtained human U937 monocytic cells from the American Tissue Culture Collection (Manassas, VA) and maintained them in RPMI RPMI Rapid Prototyping & Manufacturing Institute RPMI Roswell Park Memorial Institute RPMI Royal Park Memorial Institute (culture medium) 1640 medium containing 10% fetal bovine serum Fetal bovine serum ( or foetal bovine serum) is serum taken from the fetuses of cows. Fetal Bovine Serum (or FBS) is the most widely used serum in the culturing of cells. In some papers the expression foetal calf serum is used. (Gemini, Woodland, CA), 100 U penicillin, and 100 [micro]g/mL streptomycin streptomycin (strĕp'tōmī`sĭn), antibiotic produced by soil bacteria of the genus Streptomyces and active against both gram-positive and gram-negative bacteria (see Gram's stain), including species resistant to other supplemented with 4.5 g/L glucose, 1 mM sodium pyruvate, and 10 mM HEPES HEPES N-2-Hydroxyethylpiperazine-N'-2-Ethanesulfonic Acid . Cell culture was maintained at a cell concentration between 2 x [10.sup.5] and 2 x [10.sup.6] cells/mL For differentiation into macrophages, U937 cells were treated with TPA (5 [micro]g/mL) and allowed to adhere for 48 hr in a 5% C[O.sub.2] tissue culture incubator at 37[degrees]C, after which they were fed with TPA-free medium. Cell viability assay. To assess the effect of particles on viability of U937 macrophages, we used the trypan blue try·pan blue n. An acid dye used for staining of the reticuloendothelial system, the kidney tubules, and cells in tissue culture. trypan blue a supravital stain and a stain for amyloid. exclusion test (McAteer and Davis 1994). A 10-[micro]L portion of re-suspended cell pellet was placed in 190 [micro]L PBS PBS in full Public Broadcasting Service Private, nonprofit U.S. corporation of public television stations. PBS provides its member stations, which are supported by public funds and private contributions rather than by commercials, with educational, cultural, with 200 [micro]L trypan blue (0.5% dilution in 0.85% NaCl) added. After 5 min we loaded 10 [micro]L of the cell suspension into a hemocytometer hemocytometer /he·mo·cy·tom·e·ter/ (-si-tom´e-ter) hemacytometer. he·mo·cy·tom·e·ter n. An instrument for counting the blood cells in a measured volume of blood. and determined the proportion of nonviable nonviable /non·vi·a·ble/ (-vi´ah-b'l) not capable of living. non·vi·a·ble adj. Not capable of living or developing independently. Used especially of an embryo or fetus. to viable cells. Cellular cholesterol and protein determinations. We extracted free and esterified cholesterol (total cholesterol) directly from macrophage monolayers in situ In place. When something is "in situ," it is in its original location. in the cell culture dish. After the indicated time of treatment, each PBS-washed monolayer mon·o·lay·er n. 1. A film or layer one molecule thick formed at the interface between water and either oil or air by a substance such as a partially esterified fatty acid that contains both hydrophobic and hydrophilic groups in the same was scraped off in 400 [micro]L RI PA buffer and incubated for 30 min on ice. Unsoluble material was removed by centrifugation Centrifugation A mechanical method of separating immiscible liquids or solids from liquids by the application of centrifugal force. This force can be very great, and separations which proceed slowly by gravity can be speeded up enormously in centrifugal at 12,000 x g for 20 min at 4[degrees]C and aliquots were used for protein determination according to Bradford (1976). We determined the amount of free and esterified cholesterol (total cholesterol) using a colorimetric col·or·im·e·ter n. 1. Any of various instruments used to determine or specify colors, as by comparison with spectroscopic or visual standards. 2. method (Roche) in the presence of cholesterol oxidase oxidase /ox·i·dase/ (ok´si-das) any enzyme of the class of oxidoreductases in which molecular oxygen is the hydrogen acceptor. ox·i·dase n. and cholesterol esterase cholesterol esterase /cho·les·ter·ol es·ter·ase/ (kah-les´ter-ol es´ter-as) acid lipase; an enzyme that catalyzes the hydrolytic cleavage of cholesterol and other sterol esters and triglycerides. and then measured the absorbance absorbance /ab·sor·bance/ (-sor´bans) 1. in analytical chemistry, a measure of the light that a solution does not transmit compared to a pure solution. Symbol . 2. at 405 nm. Quantitative real-time reverse transcription-PCR. We isolated total RNA RNA: see nucleic acid. RNA in full ribonucleic acid One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic from U937 cells using a high-pure RNA isolation kit (Roche) and carried out cDNA synthesis as previously described (Vogel et al. 2004b). Quantitative detection of [[beta]-actin and differentially expressed genes was performed with a LightCycler Instrument (Roche Diagnostics, Mannheim, Germany) using the QuantiTect SYBR Green PCR PCR polymerase chain reaction. PCR abbr. polymerase chain reaction Polymerase chain reaction (PCR) Kit (Qiagen) according to the manufacturer's instructions. DNA-free total RNA (1.0 [micro]g) was reverse-transcribed using 4 U Omniscript reverse transcriptase Reverse transcriptase Any of the deoxyribonucleic acid (DNA) polymerases present in particles of retroviruses which are able to carry out DNA synthesis using an RNA template. (RT; Qiagen) and 1 [micro]g [oligo(dT).sub.15] in a final volume of 40 [micro]L. The primers for each gene (Table 1) were designed on the basis of the respective cDNA or mRNA sequences using OLIGO primer analysis software provided by Steve Rozen and Whitehead Institute/MIT Center for Genome Research (Rosen and Skaletsky 2000), so that the targets were 100-200 bp in length. PCR amplification was carried out in a total volume of 20 [micro]L, containing 2 [micro]L cDNA, 10 [micro]L 2xQuantiTect SYBR Green PCR Master Mix, and 0.2 [micro]M of each primer. The PCR cycling conditions were 95[degrees]C for 15 min followed by 40 cycles of 94[degrees]C for 15 sec, 60[degrees]C for 20 sec, and 72[degrees]C for 10 sec. We performed detection of the fluorescent product at the end of the 72[degrees]C extension period. We ran negative controls concomitantly to confirm that the samples were not cross-contaminated. A sample with DNase- and RNase-free water instead of RNA was concomitantly examined for each of the reaction units described above. To confirm the amplification specificity, we subjected the PCR products to melting curve analysis. We performed all PCR assays in triplicate. The intra-assay variability was < 7%. For quantification we analyzed data with the LightCycler analysis software. The variables were examined for one-sided Student's t test. The results are given as the mean [+ or -] the SDs of the mean. Antibodies and Western blotting. Monoclonal anti-human CRP antibody was purchased from Sigma Chemical Co. Rabbit polyclonal polyclonal /poly·clo·nal/ (-klon´'l) 1. derived from different cells. 2. pertaining to several clones. polyclonal derived from different cells; pertaining to several clones. anti-human actin and a horseradish horseradish Hardy perennial plant (Armoracia lapathifolia) of the mustard family, native to Mediterranean lands and grown throughout the temperate zones. Its hotly pungent, fleshy root is used as a condiment and is traditionally considered medicinal. peroxidase-conjugated secondary antibody were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). We separated whole-cell proteins on a 10% SDS-polyacrylamide gel and blotted them onto a PVDF PVDF polyvinylidene difluoride (polyvinylidene fluoride) membrane (Immuno-Blot; BioRad, Hercules, CA). The antigen-antibody complexes were visualized using the chemoluminescence substrate SuperSignal West Pico (Pierce, Rockford, IL) as recommended by the manufacturer. For quantitative analysis Quantitative Analysis A security analysis that uses financial information derived from company annual reports and income statements to evaluate an investment decision. Notes: , we quantified respective bands using a ChemiImager 4400 (Alpha Innotech Corp., San Leandro, CA). Statistical analysis. All experiments were repeated a minimum of 3 times and results were expressed as mean [+ or -] SD. We determined statistical differences using Student's t test and for the analysis of the significance between pairs of mean values, we used the Bonferroni post-hoc test. Results Dose-dependent effect of DEP and UDP on inflammatory factors and CYP1a1 expression. To address the dose-dependent effect of the particles, we studied the mRNA expression of inflammatory factors and CYP1a1 24 hr after treatment with various concentrations of DEP and UDP. As shown in Table 2, treatment of U937 macrophages with the native particles of DEP or UDP in the range of 2.5, 10, or 40 [micro]g/[cm.sup.2] cell culture area led to dose-dependent mRNA induction of COX-2, TNF[alpha], IL-6, IL-8, CRP, C/EBP[beta] (CCAAT/ enhancer binding protein), and CYP1a1. Except for COX-2, the UDP-induced expression on these genes was more prominent than the effect of DEP. All parameters were significantly induced by UDP at the low concentration of 2.5 [micro]g/[cm.sup.2]. In contrast, COX-2, IL-6, C/EBP[beta], and CRP were significantly increased only at 10 or 40 [micro]g/[cm.sup.2] DEP. The most conspicuous effect of UDP was found in the case of IL-8 (31.6-fold), whereas DEP showed the strongest effect on CRP expression (19.7-fold). To estimate the toxic potency, we compared the effects of DEP and UDP with various concentrations of TCDD, which has been shown to be an efficient inducer inducer /in·duc·er/ (in-dldbomacs´er) a molecule that causes a cell or organism to accelerate synthesis of an enzyme or sequence of enzymes in response to a developmental signal. in·duc·er n. of inflammatory factors and foam-cell formation in U937 macrophages. Except for IL-6, which was downregulated by TCDD, we observed concentration-dependent increases of COX-2, TNF[alpha], and IL-8, showing a 5.1-, 2.8-, and 2.5-fold increase, respectively, at the lowest concentration of TCDD tested (0.1 nM). CRP was also significantly increased at higher concentrations of TCDD (1 and 10 nM), which correlated with the induction of C/EBP[beta]. Evaluation of cytotoxicity of DEP and UDP. Cytotoxic effects on U937 macrophages were measured for DEP, UDP, sDEP, sUDP, as well as for their corresponding extracts OE-DEP and OE-UDP. The viability of cells cultured in medium alone with 100 [micro]L PBS added served as control. After incubating the cells with particles or extracts for 24 hr at 37[degrees]C, we determined cytotoxicity by trypan blue exclusion test. Cell death in the unexposed U937 macrophages was 8% (Figure 1). In U937 macrophages treated with 2.5 or 10 [micro]g/[cm.sup.2] DEP, UDP, sDEP, sUDP, OE-DEP, or OE-UDP, no significant effect on cell viability compared to control cells was found (data not shown). However, at the highest dose of 40 [micro]g/[cm.sup.2], treatment with DEP as well as with UDP led to a significant increase of the number of dead cells by 7 and 10%, respectively (Figure 1). [FIGURE 1 OMITTED] Effect of organic compounds in DEP- and UDP-induced expression of proinflammatory marker genes COX-2, TNF[alpha], and IL-8. Macrophages involved in atherosclerotic lesions are a primary source of inflammatory cytokines. Cytokines can contribute to initiation and progression of atherosclerotic lesions by triggering multiple cellular functions such as leukocyte leukocyte (l `kəsīt'): see blood. leukocyte or white blood cell or white corpuscle recruitment and synthesis/ degradation of extracellular matrix extracellular matrix (eksˈ·tr [FIGURE 2 OMITTED] Role of the particles on DEP--and UDP-induced expression of CRP and IL-6. CRP participates in the systemic response to inflammation and is an important cardiovascular risk factor. Elevated concentrations of PM have been shown to be associated with increases of serum CRP levels in men (Peters et al. 2001; Pope et al. 2004b). In the present study we observed a 6- and 13-fold increase of CRP mRNA expression after exposure to 10 [micro]g/[cm.sup.2] DEP or 10 [micro]g/[cm.sup.2] UDP for 24 hr, respectively (Figure 3). Treatment with DEP or sDEP resulted in similar induction rates of CRP mRNA (6-fold), but OE-DEP had a significantly lesser effect (2.5-fold) on CRP mRNA expression than DEP or sDEP (Figure 3A). sUDP led to significantly higher induction (22-fold) of CRP mRNA than did UDP or the organic compounds OE-UDP (3-fold) (Figure 3B). [FIGURE 3 OMITTED] To test whether elevated mRNA levels correspond with increased accumulation of the CRP protein, we performed Western blots. In whole-cell protein of U937 macrophages, we observed 3- to 4-fold higher protein levels of CRP in DEP-, UDP-, sDEP-, and sUDP-treated cells compared to control, OEDEP-, or OE-UDP-treated cells (Figure 4). [FIGURE 4 OMITTED] IL-6 has been shown to be elevated after exposure to particles in macrophages in numerous studies (e.g., Monn and Becker 1999) and is the most potent inflammatory cytokine Cytokine Any of a group of soluble proteins that are released by a cell to send messages which are delivered to the same cell (autocrine), an adjacent cell (paracrine), or a distant cell (endocrine). for the induction of human CRP. We found that after 24 hr, DEP, UDP, and their corresponding stripped particles significantly increased the mRNA level of IL-6 by 5- and 7-fold, respectively (Figure 3). However, similar to the results found for CRP, the organic compounds OE-DEP or OE-UDP did not significantly induce mRNA expression of IL-6 (Figure 3). Treatment with CB (10 [micro]g/[cm.sup.2]) had no significant effect on the mRNA expression of IL-6. Only the CRP mRNA level was slightly elevated after exposure to CB; however, the effect was not statistically significant (Figure 3A). The fact that treatment with TCDD, OE-DEP, or OE-UDP did not increase IL-6 and led to only a moderate increase of CRP mRNA expression compared to sDEP, sUDP, DEP, or UDP suggests that particles rather than the co-pollutants mediate the increase of CRP and IL-6. Effect of various inhibitors on DEP-and UDP-mediated CRP and COX-2 induction. CRP induction by DEP, UDP, sDEP, or sUDP was blocked by about 75% after pretreatment pretreatment, n the protocols required before beginning therapy, usually of a diagnostic nature; before treatment. pretreatment estimate, n See predetermination. for 15 min with 100 [micro]g/mL aggregated IgG, which blocks binding to the Fc[gamma] receptor. Preincubation for 15 min with 100 nM wortmannin, which inhibits Fc[gamma] receptor-dependent ingestion ingestion /in·ges·tion/ (-chun) the taking of food, drugs, etc., into the body by mouth. in·ges·tion n. 1. The act of taking food and drink into the body by the mouth. 2. and activation, blocked the induction of CRP mediated by DEP, UDP, sDEP, and sUDP by about 50% (Figure 5). Neither aggregated IgG nor wortmannin led to a significant inhibition of DEP-or UDP-mediated COX-2 induction (Figure 6). Conversely, the aryl ar·yl n. An organic radical derived from an aromatic compound by the removal of one hydrogen atom. hydrocarbon hydroxylase (AhR) antagonist luteolin had no significant effect on the particle-induced expression of CRP (Figure 5). However, the induction of COX-2 mediated by DEP/UDP, as well as their organic extracts, was significantly suppressed (50%) by luteolin (Figure 6). [FIGURES 5-6 OMITTED] DEP-and UDP-induced CYP1a1 mRNA level The CYP1a1 mRNA level increased 40-fold in DEP-treated (10 [micro]g/[cm.sup.2]) cells, whereas the organic extract OE-DEP led to a markedly higher increase of 170-fold in comparison to control cells. Exposure to 10 [micro]g/[cm.sup.2] UDP- or OE-UDP led to about 100-fold elevated levels of CYP1a1 mRNA after 24 hr of treatment. The stripped particles sUDP had still significant effects and increased CYP1a1 mRNA levels by 20-fold (Figure 7). [FIGURE 7 OMITTED] To test the role of the AhR in OE-DEP-and OE-UDP-mediated increase of CYP1a1, we co-treated cells with the AhR antagonist luteolin (10 [micro]M) and OE-DEP or OE-UDP for 24 hr. Co-treatment with luteolin (10 [micro]M) inhibited OE-DEP-and OE-UDP-mediated CYP1a1 induction by about 50%, which indicates the involvement of the AhR in this process. As a positive control, cells were treated with 10 nM TCDD for 24 hr and co-treated with luteolin. TCDD led to a 110-fold increase of CYP1a1 mRNA level, which was inhibited by 95% after co-treatment with luteolin (Figure 7). Stimulation of cholesterol accumulation in U937 macrophages by UDP and DEP. Foam cells are primarily macrophages laden with cholesterol ester-rich cytoplasmic cytoplasmic pertaining to or included in cytoplasm. cytoplasmic inclusions include secretory inclusions (enzymes, acids, proteins, mucosubstances), nutritive inclusions (glycogen, lipids), pigment granules (melanin, lipofuscin, lipid inclusions. To quantify total amount of cholesterol in U937 macrophages, we used a colorimetric method in the presence of cholesterol oxidase and cholesterol esterase. Exposure for 5 days to 10 [micro]g/[cm.sup.2] DEP as well as to UDP stimulated the accumulation of cholesterol by 2-and 2.5-fold, respectively (Figure 8). Both organic extracts OE-DEP or OE-UDP increased the amount of cholesterol by about 2.3-fold above control. The stripped particles sDEP and sUDP did not significantly increase the amount of cholesterol in U937 macrophages compared to control cells (Figure 8). Results from cholesterol assay were consistent with findings from Oil Red O staining (data not shown). [FIGURE 8 OMITTED] Discussion There is strong evidence from epidemiologic and animal studies that exposure to air pollution particulates play a role in the development of cardiovascular diseases such as atherosclerosis and heart diseases (Pope et al. 2004; Suwa et al. 2002). DEP and UDP, which are the most important components of P[M.sub.2.5] (PM with aerodynamic diameter [less than or equal to] 2.5 [micro]m) and P[M.sub.10], respectively, in many urban areas, have been suspected. The results presented in this study show that diesel particles as well as urban dust cause the induction of several proinflammatory factors such as COX-2, TNF[alpha], C/EBP[beta], IL-6, and IL-8 in human macrophages. Exposure to these partides also results in a significant elevation ofCRP mRNA and protein levels in U937 macrophages. We used U937-derived macrophages because these cells are frequently used to develop foam cells after treatment with modified low density protein (Martens et al. 1998) and as described earlier by exposure to environmental toxicants like TCDD (Vogel et al. 2004a). Concomitant with induction of inflammatory factors, the accumulation of total cholesterol was significantly increased in DEP-or UDP-treated macrophages. Cholesterol accumulation in macrophages is a hallmark of foam-cell formation indicating early lesion of atherosclerosis (Linton and Fazio 2003). Thus, the particle-mediated inflammatory response and subsequent formation of foam cells may contribute directly to the progression of atherosclerosis and other cardiovascular events. Several studies have shown that the toxicity of PM might be linked to the generation of reactive oxygen species reactive oxygen species, n molecules and ions of oxygen that have an unpaired electron, thus rendering them extremely reactive. Many cellular structures are susceptible to attack by ROS contributing to cancer, heart disease, and cerebrovascular disease. (ROS ROS, n.pr See reactive oxygen species. ) in the lungs (Tao et al. 2003), which can be detected by their electron spin resonance electron spin resonance (ESR) or electron paramagnetic resonance (EPR) Technique of spectroscopic analysis (see spectroscopy) used to identify paramagnetic substances (see signals (Kadiiska et al. 1997). ROS might also play a role in promoting a state of systemic inflammation. In the current study we performed experiments to estimate the signaling mechanisms of the proinflammatory response induced by DEP or UDP using human monocyte-derived macrophages. Organic compounds like polyaromatic hydrocarbons (PAH PAH, PAHA aminohippuric acid. PAH abbr. para-aminohippuric acid PAH 1 Polycyclic aromatic hydrocarbon, see there 2. Pulmonary artery HTN ) adsorbed on UDP, and especially DEP, which induce CYP1a1 gene expression (Figure 7) seemed to be mainly involved in the response of inflammatory factors such as COX-2, IL-8, and TNF[alpha]. Besides COX-2 and TNF[alpha], we observed, for the first time, a dose-dependent increase of IL-8 mRNA level in cells treated with the AhR ligand TCDD. Results of this study show that the organic extract of OE-DEP is significantly more effective at inducing COX-2, IL-8, and TNF[alpha] than its native particle DEP, whereas OE-UDP led to a similar increase compared to its native particle UDP. These results suggest that the organic co-pollutants are highly adsorbed by DEP and thus less bioavailable compared to UDP. The stripped particles of both diesel and urban dust had significantly less effect on the induction of COX-2, [L-8, and TNF[alpha]. To analyze the contribution of AhR-activating compounds, we co-treated cells with the AhR antagonist luteolin and the particles or their organic extracts. Our results (Figures 5-7) clearly show that luteolin is more effective in suppressing COX-2 or CYP1a1 than CRPin all samples. In turn, both IgG and wortmannin were much better inhibitors of CRP than COX-2. These results indicate that the solvent extraction Solvent extraction A technique, also called liquid extraction, for separating the components of a liquid solution. This technique depends upon the selective dissolving of one or more constituents of the solution into a suitable immiscible liquid solvent. procedure could effectively separate the AhR agonists (i.e., luteolin inhibited components) from the particles. Furthermore, the stripped particles showed properties different from the solvent extracts in that affected cells showed high mRNA expression of CRP by treatment with stripped or native particles but not with organic extracts (Figure 3). We have previously shown that dioxin-type chemicals are powerful inducers of inflammation in U937 macrophages (Vogel et al. 2004a), and therefore it is logical to explain the action of solvent extracts to activate COX-2. However, the finding that stripped particles from air pollutants selectively activate CRP is new. It is known that insoluble, fine particles have the property to affect Fc[gamma] receptor activity on the macrophage membrane and thereby trigger the process of phagocytosis and uptake of low-density lipoprotein (Kleinman et al. 2003; Lug et al. 2005; Ohtsuka et al. 2000; Swanson and Hoppe 2004; Zwaka et al. 2001). The notion that the stripped particles are also acting through the Fc[gamma] receptor is supported by our observation that aggregated IgG, the specific ligand for Fc[gamma] receptor, is effective in suppressing the same cell response indicates that the phagocytosis of those particles is the key event accompanying the Fc[gamma] receptor stimulating action of sDEP and sDEP, since phosphatidylinositol 3-kinase, which is sensitive to wortmannin, is a crucial factor mediating phagocytosis of macrophages (Song et al. 2004). Activation of Fc[gamma] receptor by aggregated IgG might also trigger inhibitory signaling pathways that suppress the effects of particles on the expression of CRP. The effect of the ultrafine CB on CRP expression was rather small, which indicates that not only the chemical components of the PM but also other factors such as surface properties and shape affect toxicity. One interesting aspect is that the timing of particle-mediated induction of CRP was correlated with elevated levels of IL-6 mRNA, which can mediate transcriptional activation of CRP. Both CRP and IL-6 induction by PM were blocked by aggregated IgG or wortmannin, which inhibits Fc[gamma] receptor-dependent ingestion and activation. Neither aggregated IgG nor wortmannin led to a significant inhibition of DEPor UDP-induced COX-2, TNF[alpha], or IL-8. The close relationship between IL-6 and CRP has been pointed out by many scientists (e.g., Monton and Torres 1998), but in most cases CRP production is carried out in liver as a result of stimulation by circulating IL-6. The fact that IL-6 acts as an autocrine autocrine /au·to·crine/ (-krin) denoting a mode of hormone action in which a hormone binds to receptors on and affects the function of the cell type that produced it. au·to·crine adj. factor to stimulate CRP production in macrophages is not well known; however, the increased synthesis and secretion of CRP, IL-6, and soluble IL-6 receptor by macrophage-derived foam cells in the arterial intima intima /in·ti·ma/ (in´ti-mah) 1. innermost. 2. tunica intima vasorum.in´timal in·ti·ma n. pl. has been demonstrated (Ballou and Lozanski 1992; Jones et al. 1999; Libby 2002; Lusis 2000; Ross 1999). Recent studies also show that binding of C/EBP[beta] is critical for induction of CRP expression (Agrawal et al. 2003), which could explain the increase of CRP by TCDD, as TCDD induces the expression of C/EBPb (Vogel et al. 2004a; Vogel and Matsumura 2003) but not IL-6 (Table 2). According to Du Clos and Mold (2004), CRP acts through Fc[gamma] receptor to play important roles in infection, inflammation, and autoimmune diseases Autoimmune diseases A group of diseases, like rheumatoid arthritis and systemic lupus erythematosus, in which immune cells turn on the body, attacking various tissues and organs. Mentioned in: Complement Deficiencies, Premature Menopause . This phenomenon of action of stripped particles deserves close attention in the future. In conclusion, we have shown that air pollution particles have two major classes of toxic components. One is the dioxin-type AhR agonist, which is extractable by solvents, and the other type is the stripped particle, which elicits a different pattern of mRNA activation from that induced by dioxin-type chemicals. These findings may contribute to a better understanding of the differential toxicity of various constituents and sources of PM, including their chemical/biological components alone or in combination with PM. Further research is necessary to fully elucidate this mechanism of differential toxicity. Other relevant sources of PM should be collected and tested, such as those from the combustion of alternative fuels, and evaluated for their potential contribution as risk factors for cardiovascular disease in both urban and rural environments. REFERENCES Agrawal A, Cha-Molstad H, Samols B, Kushner I. 2003. Overexpressed nuclear factor-kappaB can participate in endogenous C-reactive protein induction, and enhances the effects of C/EBPbeta and signal transducer and activator of transcription-3. Immunology. 108:539-547. Ballou SP, Lozanski (3. 1992. Induction of inflammatory cytokine release from cultured human monocytes monocytes, n.pl the largest of the white blood cells. They have one nucleus and a large amount of grayish-blue cytoplasm. Develop into macrophages and both consume foreign material and alert T cells to its presence. by C-reactive protein. Cytokine 4:361-368. Beck MO, Silveire SP, Friedman R, Clausell N, Gross JL. 1999. Asymptomatic coronary artery disease is associated with cardiac autonomic neuropathy autonomic neuropathy Neurology A symptom complex caused by damage to autonomic nerves Etiology DM, alcohol use, traumatic nerve injury, anticholinergics Clinical Abdominal bloating, heat intolerance, N&V, impotence, diarrhea, constipation, orthostatic vertigo, and diabetic nephropathy diabetic nephropathy (n Bradford MM. 1976. A rapid and sensitive method for the quantitation of microgram microgram /mi·cro·gram/ (µg) (mi´kro-gram) one millionth (10-6) of a gram. mi·cro·gram n. Abbr. quantities of protein utiilizing the principle of protein-dye binding. Anal Biochem 72:248-254. Brook RD, Brook JR, Rajagopalan S. 2003. Air pollution: the "heart" of the problem. Curr Hypertens Res 5:32-39. Dampen M J, McDonald JD, Gigliotti AP, Seilkop SK, Reed MD, Benson JM. 2003. Cardiovascular effects of inhaled diesel exhaust in spontaneously hypertensive hypertensive /hy·per·ten·sive/ (-ten´siv) 1. characterized by increased tension or pressure. 2. an agent that causes hypertension. 3. a person with hypertension. rats. Cardiovasc Toxicol 3:353-361. Du Clos TW, Mold C. 2004. C-reactive protein: an activator of innate immunity and a modulator Modulator Any device or circuit by means of which a desired signal is impressed upon a higher-frequency periodic wave known as a carrier. The process is called modulation. The modulator may vary the amplitude, frequency, or phase of the carrier. of adaptive immunity. Immunol Res 30:281-278. Gordon T, Nadziejko C, Schlesinger R, Chen LC. 1998. Pulmonary and cardiovascular effects of acute exposure to concentrated ambient particulate matter in rats. Toxicol Lett 96-97:285-288. Jones SA, Novick D, Horiuchi S, Yamamoto N, Szalai AJ, Fuller (3M. 1999. C-reactive protein: a physiological activator of interleukin 6 receptor shedding. J Exp Med 189:599-604. Kadiiska MB, Mason RP, Dreher KL, Costa DL, Ghio AJ. 1997. In rive rive v. rived, riv·en also rived, riv·ing, rives v.tr. 1. To rend or tear apart. 2. To break into pieces, as by a blow; cleave or split asunder. 3. evidence of free radical formation in the rat lung after exposure to an emission source air pollution particle. Chem Res Toxicol 10:1104-1108. Kim JY, Chen JC, Boyce PD, Christiani D. 2005. Exposure to welding fumes fumes odorous gases and other volatile materials; inhalation of irritating fumes causes coughing and, if sufficiently severe, irreversible pulmonary edema. is associated with acute systemic inflammatory responses. Occup Environ Meal 62:157-163. Kleinman MT, Hyde DM, Bufalino C, Basbaum C, Bhalla DK, Mautz WJ. 2003. Toxicity of chemical components of fine particles inhaled by aged rats: effects of concentration. J Air Waste Manage Assoc 53:1080-1087. Libby P. 2002. Inflammation in atherosclerosis. Nature 420:868-874. Linton MF, Fazio S. 2803. Macrephages, inflammation, and atherosclerosis. Int J Obes Relat Metab Disord 27(suppl 3):S35-S40. Luo Y, Tucker SC, Casadevall A. 2005. Fc- and complement-receptor activation stimulates cell cycle progression of macrophage cells from g1 to s. J Immunol 174:7226-7233. Lusis AJ. 2000. Atheresclerosis. Nature 487:233-241. Martens JS, Reiner NE, Herrera-Velit P, Steinbrecher UP. 1998. Phosphatidylinosltol 3-kinase is involved in the induction of macrophage growth by oxidized oxidized having been modified by the process of oxidation. oxidized cellulose see absorbable cellulose. low density lipoprotein Low density lipoprotein (LDL) A fraction of total serum lipids, the so called "bad" cholesterol. Mentioned in: Hypercholesterolemia . J Biol Chem 273:4915-4920. Mathiesen M, Pedersen EK, Bjorseth O, Egeberg KW, Swersen T. 2004. Heating of indoor dust causes reduction in its ability to stimulate release of IL-8 and TNF[alpha] in vitro compared to non-heated dust. Indoor Air 14:226-234. McAteer, Davis JM. 1994. Basic cell culture: a practical approach, basic cell culture and the maintenance of cell lines. In: Basic Cell Culture: A Practical Approach (Davis JM, ed). New York:Oxford University Press. Mendall MA, Patel P, Ballam L, Strachan D, Northfield TC. 1996. C reactive protein C reactive protein Lab medicine A 120 kD polypeptide of the pentraxin family which is produced by the liver during inflammation and detectable in serum in various conditions particularly during acute immune responses, named for its ability to bind the C and its relation to cardiovascular risk factors: a population based cross sectional study. BMJ BMJ n abbr (= British Medical Journal) → vom BMA herausgegebene Zeitschrift 312:1081-1065. Monn C, Becket S. 1999. Cytotoxiclty and induction of proinflammatory cytokines from human monocytes exposed to fine (P[M.sub.2.5]) and coarse particles (P[M.sub.10-2.5]) in outdoor and indoor air. Texicol Appl Pharmacol 155:245-252. Monn C, Naef R, Keller T. 2003. Reactions of macrephages exposed to particles <10 [micro]m. Environ Res 91:35-44. Monton C, Torres A. 1998. Lung inflammatory response in pneumonia. Monaldi Arch Chest Dis 53:56-63. Morris RD. 2001. Airborne particulates and hospital admission for cardiovascular disease: a quantitative review of the evidence. Environ Health Perspect 109:495-580. Nemmar A, Hoot PH, Vanquickenborne B, Dinsdale D, Thomeer M, Hoylaerts MF, et al. 2002. Passage of inhaled particles into the blood circulation in humans. Circulation 105:411-414. Ohtsuka Y, Clarke RW, Mitzner W, Brunson K, Jakab GJ, Kleeborger SR. 2000. Interstrain variation in murine murine /mu·rine/ (mur´en) pertaining to, derived from, or characteristic of mice or rats. mu·rine adj. susceptibility to inhaled acid-coated particles. Am J Physiol Lung Cell Mol Physiol 278:469-476. Peters A, Frohlich M, Boring A, Immervoll T, Wichmann HE, Hutchinson WL, et al. 2001. Particulate air pollution is associated with an acute phase response acute phase response n. A group of physiologic changes that occur shortly after the onset of an infection or other inflammatory process and include an increase in the blood level of various proteins, especially C-reactive protein, fever, and other in men; results from the MONICA-Augsburg Study. Eur Heart J 22:1198-1204. Pope CA III, Burner RT, Thurston GD, Thun MJ, Calle EE, Krewski D, et al. 2004a. Cardiovascular mortality and long-term exposure to particulate air pollution: epidemiological evidence of general pathophysiological pathways of disease. Circulation 109:71-77. Pope CA III, Hansen ML, Long RW, Nielsen KR, Eatough NL, Wilson WE, et al. 2034b. Ambient particulate air pollution, heart rate variability Heart rate variability (HRV) is a measure of variations in the heart rate. It is usually calculated by analysing the time series of beat-to-beat intervals from ECG or arterial pressure tracings. , and blood markers of inflammation in a panel of elderly subjects. Environ Health Perspect 112:339--344. Rosen S, Skaletsky HJ. 2000. Primer3 on the WWW WWW or W3: see World Wide Web. (World Wide Web) The common host name for a Web server. The "www-dot" prefix on Web addresses is widely used to provide a recognizable way of identifying a Web site. for general users and for biologist programmers. In: Bioinformatics Methods and Protocols: Methods in Molecular Biology (Krawetz S, Misener S, eds). Totowa, NJ:Humana Press, 365-386. Ross R. 1999. Atherosclerosis-an inflammatory disease. N Engl J Med 340:115-126 Salvi S, Blomberg A, Rudell B, Kelly F, Sandstrom T, Holgate ST, et al. 1999. Acute inflammatory responses in the ainNays and peripheral blood after short-term exposure to diesel exhaust in healthy human volunteers. Am J Respir Crit Care Med 159:702-709. Salvi SS, Nordenhall C, Blomberg A, Rudell B, Pourazar J, Kelly F J, et al. 2000. Acute exposure to diesel exhaust increases IL-8 and GRO-alpha production in healthy human airways. Am J Respir Crit Care Med 181:550-557. Seaton A, Soutar A, Crawford V, Elton R, McNerlan S, Cherrie J, et al. 1999. Particulate air pollution and the blood. Thorax thorax, body division found in certain animals. In humans and other mammals it lies between the neck and abdomen and is also called the chest. The skeletal frame of the thorax is formed by the sternum (breastbone) and ribs in front and the dorsal vertebrae in back. 54:1027-1032. Song X, Tanaka S, Cox D, Lee SD. 2034. Fcgamma receptor signaling in primary human micreglia: differential roles of PI-3K and Ras/ERK MAPK MAPK Mitogen-Activated Protein Kinase MAPK Map Kinase pathways in phagocytosis and chemokine chemokine /che·mo·kine/ (ke´mo-kin) any of a group of low molecular weight cytokines identified on the basis of their ability to induce chemotaxis or chemokinesis in leukocytes (or in particular populations of leukocytes) in inflammation. induction. J Leukoc Biol 75:1147-1155. Suwa T, Hogg JC, Quinlan KB, Ohgami A, Vincent R, van Eeden SF. 2002. Particulate air pollution induces progression of atheroscleresis. J Am Coll Cardiol 39:935-942. Swanson JA, Hoppe AD. 2004. The coordination of signaling during Fc receptor-mediated phagecytosis. J Leukoc Biol 76:1093-1103. Tao F, Bonzalez-Flecha B, Kobzik L. 2003. Reactive oxygen species in pulmonary inflammation by ambient particulates. Free Rad Biol Med. 35:327-340. van Eeden SF, Tan WC, Suwa T, Mukae H, Terashima T, Fujii T, et al. 2001. Cytokines involved in the systemic inflammatory response induced by exposure to particulate matter air pollutants (P[M.sub.10]). Am J Respir Crit Care Med 164:826-838. Vogel CF, Sciullo E, Matsumura F. 2034a. Activation of inflammatory mediators and potential role of Ah-recepter ligands in foam cell formation. Cardiovasc Toxicol 4:363-374. Vogel CF, Sciullo E, Park S, Liedtke C, Trautwein C, Matsumura F. 2004b. Dioxin increases C/EBPbeta transcription by activating cAMP/protein kinase A. J Biol Chem 279:8886-8894. Vogel CF, Matsumura F. 2003. Interaction of 2,3,7,8-tetra-chlorodibenzo-p-dioxin (TCDD) with induced adipocyte adipocyte /ad·i·po·cyte/ (-sit?) fat cell. ad·i·po·cyte n. See fat cell. adipocyte differentiation in mouse embryonic fibroblasts Fibroblasts A type of cell found in connective tissue; produces collagen. Mentioned in: Skin Grafting (MEFs) involves tyrosine kinase c-Src. Biochem Pharmacol 66:1231-1244. Yeh ET. 2004. CRP as a mediator of disease. Circulation 109 (suppl 1): ll11-ll14. Zwaka TP, Hembach V, Torzewski J. 2001. C-reactive protein-mediated low density lipopretein uptake by macrophages: implications for atherosclerosis. Circulation 103:1194-1197. Christoph Franz Adam Vogel, (1) Eric Sciullo, (1) Pat Wong, (1) Paul Kuzmicky, (1) Norman Kado, (1,2) and Fumio Matsumura (1,3) (1) Department of Environmental Toxicology, University of California, Davis The University of California, Davis, commonly known as UC Davis, is one of the ten campuses of the University of California, and was established as the University Farm in 1905. , California, USA; (2) California Environmental Protection Agency The California Environmental Protection Agency (Cal/EPA) was created in 1991 by Governor Pete Wilson, through an executive order.[1] The agency combined six board, departments, and offices into one cabinet-level office:[2]
Table 1. Primer for quantitative real-time PCR analyses.
Gene Forward primer (5'-3') Reverse primer (5'-3')
[beta]-actin GGACTTCGAGCAAGAGATGG AGCACTGTGTTGGCGTACAG
C/EBP[beta] GACAAGCACAGCGACGAGTA AGCTGCTCCACCTTCTTCTG
COX-2 TGAAACCCACTCCAAACACA GAGAAGGCTTCCCAGCTTTT
CRP ATACACTGTGGGGGCAGAAG CCGCCAAGATAGATGGTGTT
CYP1a1 TAGACACTGATCTGGCTGCAG GGGAAGGCTCCATCAGCATC
IL-6 GAACTCCTTCTCCACAAGCG TTTTCTGCCAGTGCCTCTTT
IL-8 CTGCGCCAACACAGAAATTA ATTGCATCTGGCAACCCTAC
TNF[alpha] CAGAGGGAAGAGTTCCCCAG CCTTGGTCTGGTAGGAGACG
Table 2. Dose-dependent effect of DEP and UDP on COX-2, TNF[alpha],
IL-6, IL-8, C/EBP[beta], CRP, and CYP1a1 mRNA expression compared
to the dose-dependent effect of TCDD.
DEP ([micro]g/[cm.sup.2])
Gene 0.1 1.0
COX-2 1.6 [+ or -] 0.5 (ns) 5.9 [+ or -] 1.1
TNF[alpha] 1.8 [+ or -] 0.2 3.8 [+ or -] 0.6
IL-6 1.3 [+ or -] 0.4 (ns) 3.5 [+ or -] 0.9
IL-8 2.3 [+ or -] 0.5 7.5 [+ or -] 1.2
C/EBP[beta] 1.5 [+ or -] 0.4 (ns) 2.2 [+ or -] 0.6
CRP 1.4 [+ or -] 1.0 (ns) 6.1 [+ or -] 1.1
CYP1a1 8.6 [+ or -] 0.8 37.9 [+ or -] 2.1
DEP DEP
([micro]g/[cm.sup.2]) ([micro]g/[cm.sup.2])
Gene 10.0 2.5
COX-2 19.5 [+ or -] 2.4 3.4 [+ or -] 0.4
TNF[alpha] 8.5 [+ or -] 1.2 2.2 [+ or -] 0 .2
IL-6 4.2 [+ or -] 0.9 2.0 [+ or -] 0.3
IL-8 11.6 [+ or -] 0.7 2.8 [+ or -] 0.4
C/EBP[beta] 3.7 [+ or -] 0.8 1.8 [+ or -] 0.2
CRP 19.7 [+ or -] 3 .1 2.1 [+ or -] 0.4
CYP1a1 68.5 [+ or -] 4.0 28.5 [+ or -] 3.1
UDP UDP
([micro]g/[cm.sup.2]) ([micro]g/[cm.sup.2])
Gene 10 40
COX-2 6.8 [+ or -] 1.2 12.2 [+ or -] 2.1
TNF[alpha] 6.9 [+ or -] 1.6 16.1 [+ or -] 1.1
IL-6 4.8 [+ or -] 1.2 6.5 [+ or -] 0.8
IL-8 13.5 [+ or -] 2.1 31.6 [+ or -] 3.1
C/EBP[beta] 2.5 [+ or -] 0.3 4.8 [+ or -] 1.0
CRP 13.4 [+ or -] 1.1 21.8 [+ or -] 2.1
CYP1a1 110.5 [+ or -] 11.2 137.0 [+ or -] 9.8
TCDD (nM)
Gene 2.5 10
COX-2 5.1 [+ or -] 1.0 22.8 [+ or -] 2.1
TNF[alpha] 2.8 [+ or -] 0.3 6.8 [+ or -] 1.1
IL-6 1.1 [+ or -] 0.4 (ns) 0.7 [+ or -] 0.5 (ns)
IL-8 2.5 [+ or -] 0.2 14.5 [+ or -] 1.4
C/EBP[beta] 1.6 [+ or -] 1.1 (ns) 2.1 [+ or -] 0.3
CRP 1.2 [+ or -] 0.7 (ns) 2.3 [+ or -] 0.4
CYP1a1 18.8 [+ or -] 2.1 120.5 [+ or -] 11.0
TCDD (nM)
Gene 40
COX-2 43.4 [+ or -] 5.1
TNF[alpha] 7.8 [+ or -] 1.5
IL-6 0.5 [+ or -] 0.2 *
IL-8 19.7 [+ or -] 2.2
C/EBP[beta] 3.4 [+ or -] 0.6
CRP 3.8 [+ or -] 0.5
CYP1a1 250.8 [+ or -] 22.5
ns, not significant. U937 macrophages were treated with 2.5, 10,
or 40 [micro]g/[cm.sup.2] DEP or UDP. As a positive control, cells
were treated with 0.1, 1.0, or 10 nM TCDD for 24 hr and mRNA was
analyzed by real-time RT-PCR. Control cells received 1% PBS or 0.1%
dimethylsulfoxide. Results are normalized to P-actin and given as
fold increase of them RNA levels in treated cells versus controls
(= 1). Values are given as mean [+ or -] SD of triplicates of three
independent experiments. All values significantly increased compared
to control cells (p < 0.05) unless otherwise noted.
* Significantly lower than in control cells (p < 0.05)
|
|
||||||||||||||||||

`kəsīt')
Printer friendly
Cite/link
Email
Feedback
Reader Opinion