Increased influence of genetic variation on PON1 activity in neonates.PON (Passive Optical Network) An optical point-to-multipoint access network. There are no optical repeaters or other active devices in a PON, hence the name "passive. 1 (paraoxonase-1) detoxifies organophosphates by cleavage of active oxons before they have a chance to inhibit cholinesterases. The corresponding gene PON1 has common polymorphisms in both the promoter (-909, -162, -108) and the coding region The coding region of a gene is the portion of DNA that is transcribed into mRNA and translated into proteins. This does not include such regions as a recognition site, initiator sequence, or termination sequence, only the region that will directly code for amino acid linkage. (L55M, Q192R). The five PON1 genotypes were determined for maternal blood (n = 402) and cord blood cord blood n. Blood present in the umbilical vessels at the time of delivery. (n = 229) as part of a study of the effects of organophosphate pesticide organophosphate pesticide A phosphorus-rich organic compound–eg, parathion, that contain a halide which phosphorylates cholinesterase and irreversibly inhibits its activity Management Atropine, pralidoxime exposure on infant growth and neurodevelopment. PON1 enzymatic activities were determined for a majority of subjects. The population contained Caucasians, Caribbean Hispanics, and African Americans. PON1 activity was strongly dependent upon the promoter alleles in both maternal and cord blood. For example, PON1 activities for position -108 CC, CT, and TT mothers were 146, 128, and 109 arylesterase U/mL (analysis of variance, p < 0.0001), whereas the same PON1 activities for the respective cord bloods were 49.0, 32.4, and 23.2 U/mL (p < 0.0001). Compared with adults, neonates had lower PON1 activity, implying reduced capacity to detoxify de·tox·i·fy v. 1. To counteract or destroy the toxic properties of a substance. 2. To remove the effects of poison from something, such as the blood. 3. organophosphates. In addition there was a larger difference in activity between genotype groups in neonates than in adults. Because the five polymorphisms in PON1 occur in a short stretch of DNA DNA: see nucleic acid. DNA or deoxyribonucleic acid One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes. , they were tested for linkage disequilibrium linkage disequilibrium n. The nonrandom association between two or more alleles such that certain combinations of alleles are more likely to occur together on a chromosome than other combinations of alleles. (LD). Significant LD was found among all three promoter polymorphisms as well as between promoter polymorphisms and L55M, with the strongest LD for Caucasians and the weakest for African Americans. The Caribbean Hispanics fall between these two groups. Surprisingly, significant LD also was observed between the promoter polymorphisms and C31 IS in PON2. LD between the promoter polymorphisms and Q192R was not significant. Key words: children, chlorpyrifos, linkage disequilibrium, neonate neonate /neo·nate/ (ne´o-nat) newborn infant. ne·o·nate n. A neonatal infant. neonate a newborn animal. , pesticide, polymorphism polymorphism, of minerals, property of crystallizing in two or more distinct forms. Calcium carbonate is dimorphous (two forms), crystallizing as calcite or aragonite. Titanium dioxide is trimorphous; its three forms are brookite, anatase (or octahedrite), and rutile. , PON1, pregnancy. Environ Health Perspect 111:1403-1410 (2003). doi:10.1289/ehp.6105 available via http://dx.doi.org/[Online 7 May 2003] ********** Chlorpyrifos, an insecticide implicated im·pli·cate tr.v. im·pli·cat·ed, im·pli·cat·ing, im·pli·cates 1. To involve or connect intimately or incriminatingly: evidence that implicates others in the plot. 2. as a developmental neurotoxin neurotoxin /neu·ro·tox·in/ (noor´o-tok?sin) a substance that is poisonous or destructive to nerve tissue. neu·ro·tox·in n. See neurolysin. in animals (Shih et al. 1998), has been used routinely in the homes of urban populations in the United States United States, officially United States of America, republic (2005 est. pop. 295,734,000), 3,539,227 sq mi (9,166,598 sq km), North America. The United States is the world's third largest country in population and the fourth largest country in area. . The biochemical contributions of metabolizing enzymes to the neurotoxic neurotoxic pertaining to or emanating from a neurotoxin. neurotoxic state a case of poisoning by a neurotoxin. neurotoxic adjective potential of chlorpyrifos and other organophosphates remain subjects of active investigation (Sams et al. 2000; Costa et al. 1999; Furlong et al. 2000). Specifically, after activation of chlorpyrifos to the reactive oxon, the oxon may be detoxified by PON1 (paraoxonase-1) before it has the chance to inactivate in·ac·ti·vate v. 1. To render nonfunctional. 2. To make quiescent. in·ac ti·va acetylcholinesterase acetylcholinesterase /ac·e·tyl·cho·lin·es·ter·ase/ (AChE) (-ko?li-nes´ter-as) an enzyme present in the central nervous system, particularly in nervous tissue, muscle, and red cells, that catalyzes the hydrolysis of acetylcholine to in the peripheral nervous
system peripheral nervous system: see nervous system. (PNS Peripheral nervous system (PNS)One of the two major divisions of the nervous system. PNS nerves link the central nervous system with sensory organs, muscles, blood vessels, and glands. ) and central nervous system (CNS See Continuous net settlement. CNS See continuous net settlement (CNS). ). PON1, which is associated with high-density lipid lipoprotein lipoprotein (lĭp'əprō`tēn), any organic compound that is composed of both protein and the various fatty substances classed as lipids, including fatty acids and steroids such as cholesterol. (HDL (Hardware Description Language) A language used to describe the functions of an electronic circuit for documentation, simulation or logic synthesis (or all three). Although many proprietary HDLs have been developed, Verilog and VHDL are the major standards. ), also functions to cleave cleat, cleave claw of any cloven-footed animal. oxidized oxidized having been modified by the process of oxidation. oxidized cellulose see absorbable cellulose. lipids in low-density lipid lipoprotein (LDL LDL - ["LDL: A Logic-Based Data-Language", S. Tsur et al, Proc VLDB 1986, Kyoto Japan, Aug 1986, pp.33-41]. ) as well as in HDL (Aviram et al. 1998, 2000). PON1 also has an arylesterase activity (Gan et al. 1991). HDL levels and PON1 activities are somewhat elevated during pregnancy (Roy et al. 1994). As part of the continuing effort of the Mount Sinai Children's Environmental Health Center to prospectively assess the neurodevelopmental risks associated with chlorpyrifos exposure in an inner-city population in New York City New York City: see New York, city. New York City City (pop., 2000: 8,008,278), southeastern New York, at the mouth of the Hudson River. The largest city in the U.S. , we investigated the genetic determinants of chlorpyrifos metabolism in a population of ethnically diverse mothers and their neonates. In this study, we examined the hypothesis that genetic factors may be more crucial in determining risk in neonates than in adults of various ethnicities. The PON1 gene has been fully characterized (Clendenning et al. 1996) and has been found to be a member of a multigene family multigene family see gene cluster. of three linked genes, PON1 (MIM MIM Metal Injection Molding MIM Mendelian Inheritance in Man MIM Mobile Instant-Messaging MIM Man in the Middle MIM Multilateral Initiative on Malaria MIM Metal-Insulator-Metal MIM Master of International Management MIM Made in Mexico 168820), PON3 (MIM 602720), and PON2 (MIM 602447) (OMIM OMIM Online Mendelian Inheritance in Man Online genetics The electronic–Web site-www.ncbi.nlm.mih.gov/omim version of Mendelian Inheritance in Man, a curated database See MIM catalog. 2002), in that order (Primo-Parmo et al. 1996; Entrez Chromosome Map 2002). Human PON1 had long been recognized to be polymorphic polymorphic - polymorphism based both on large differences in serum PON1 activity (Geldmacher-von Mallinckrodt et al. 1983) and on the phosphodiesterase/ arylesterase activity ratio for different substrates, including organophosphate organophosphate /or·ga·no·phos·phate/ (or?gah-no-fos´fat) an organic ester of phosphoric or thiophosphoric acid; such compounds are powerful acetylcholinesterase inhibitors and are used as insecticides and nerve gases. oxons derived from pesticides and direct-acting cholinesterase inhibitors such as the nerve gas nerve gas, any of several poison gases intended for military use, e.g., tabun, sarin, soman, and VX. Nerve gases were first developed by Germany during World War II but were not used at that time. sarin sarin (zärēn`), volatile liquid used as a nerve gas. It boils at 147°C; but evaporates quickly at room temperature; its vapor is colorless and odorless. (Davies et al. 1996). The purified isozymes retained these differences in organophosphate hydrolysis hydrolysis (hīdrŏl`ĭsĭs), chemical reaction of a compound with water, usually resulting in the formation of one or more new compounds. activity normalized to arylesterase activity (Smolen et al. 1991). PON1 contains two common polymorphisms in the coding region, Q192R (Adkins et al. 1993; Humbert et al. 1993) and L55M (Garin et al. 1997), and three common polymorphisms in the promoter at -909, -162 and -108 (Leviev and James 2000; Brophy et al. 2001a, 2001b). Promoter variants in PON1 affect the level of expression by more than 2-fold (Boright et al. 1998; Brophy et al. 2001a, 2001b). Q192R affects the relative rate of hydrolysis of certain organophosphate substrates compared with phenyl phenyl (fĕn`əl), C6H5, organic free radical or alkyl group derived from benzene by removing one hydrogen atom. acetate by as much as an order of magnitude A change in quantity or volume as measured by the decimal point. For example, from tens to hundreds is one order of magnitude. Tens to thousands is two orders of magnitude; tens to millions is three orders of magnitude, etc. but has only a small effect on chlorpyrifos oxon/phenylacetate rate of hydrolysis (Davies et al. 1996). The L55M polymorphism has been found to affect lipid peroxidation Lipid peroxidation refers to the oxidative degradation of lipids. It is the process whereby free radicals "steal" electrons from the lipids in cell membranes, resulting in cell damage. This process proceeds by a free radical chain reaction mechanism. (Malin et al. 2001) and PON1 protein stability (Leviev et al. 2001), although the recent work on promoter mutations has suggested that the apparent effect of the L55M polymorphism on enzyme concentration also may be due to linkage disequilibrium (LD) with one of the promoter variants (Brophy et al. 2001b). Toxicity of chlorpyrifos is inversely related to serum PON1 activity. Intravenous injection Noun 1. intravenous injection - an injection into a vein fix - something craved, especially an intravenous injection of a narcotic drug; "she needed a fix of chocolate" of PON1 before challenge by chlorpyrifos is protective in the rat (Costa et al. 1990). PON1 knockout mice were more susceptible to chlorpyrifos toxicity (Shih et al. 1998), and the toxicity was alleviated by intraperitoneal injection of purified PON1, with the 192RR (homozygous ho·mo·zy·gous adj. Having the same alleles at one or more gene loci on homologous chromosome segments. Homozygous Identical genes controlling a specified inherited trait. ) enzyme providing better protection than 192QQ (Li et al. 2000). Using the rat model, Attenberry et al. (1997) have demonstrated that the age-related decrease in susceptibility to chlorpyrifos CNS toxicity is not due to either the rate of activation to the oxon or to the reactivity of the oxon in the CNS but is entirely due to age-related differences in the detoxification Detoxification Definition Detoxification is one of the more widely used treatments and concepts in alternative medicine. It is based on the principle that illnesses can be caused by the accumulation of toxic substances (toxins) in the body. of the oxon. Developing human fetuses have much lower protective PON1 activities than do adults, with the level in cord blood being severalfold sev·er·al·fold adj. 1. Having several parts or members. 2. Being several times as much or as many. sev lower (Mueller et al. 1983). Furthermore, both chlorpyrifos and chlorpyrifos oxon can cross the placenta placenta (pləsĕn`tə) or afterbirth, organ that develops in the uterus during pregnancy. It is a unique characteristic of the higher (or placental) mammals. In humans it is a thick mass, about 7 in. . Subcutaneous delivery of a high dose of chlorpyrifos to pregnant rats led to significant (30-49%) inhibition of fetal acetylcholinesterase activity (Chanda and Pope 1996). Thus, both fetuses and very young children may be more susceptible to pesticide exposure compared with adults. Lower PON1 activities may reflect increased risk after acute or chronic exposure to chlorpyrifos in utero in utero (in u´ter-o) [L.] within the uterus. in u·ter·o adj. In the uterus. in utero adv. and in the neonatal period Noun 1. neonatal period - the first 28 days of life time of life - a period of time during which a person is normally in a particular life state . Using maternal and cord blood, we have carried out a systematic study of the origin and extent of variation in PON1 activities in our population of three racial/ethnic groups comprising the majority of many inner-city populations: Caucasians, African Americans, and Caribbean Hispanics. Specifically, we address genotype-phenotype relationships for all five polymorphisms and note differences among these three racial/ethnic groups, highlighting the differences between mothers and neonates. We also address LD among the five polymorphisms, noting differences among of three racial/ethnic groups that will affect inference of haplotypes. Subjects and Methods Study Population This study is part of an ongoing prospective study of the effect of pesticide exposure on infant growth and neurodevelopment conducted at the Mount Sinai School of Medicine
Mount Sinai School of Medicine is a medical school found in the borough of Manhattan in New York City. . The study protocol was approved by the institutional review board. A total of 479 pregnant women scheduled to deliver at Mount Sinai Hospital Mount Sinai Hospital can refer to:
PCR abbr. polymerase chain reaction Polymerase chain reaction (PCR) ), it cannot be used because it inhibits and destabilizes PON1. Plasma was separated immediately (within 24 hr) by two cycles of centrifugation Centrifugation A mechanical method of separating immiscible liquids or solids from liquids by the application of centrifugal force. This force can be very great, and separations which proceed slowly by gravity can be speeded up enormously in centrifugal . Three aliquots of maternal plasma and three aliquots of cord blood plasma were frozen at -70[degrees]C, one for determination of PON1. The buffy coat buf·fy coat n. The upper, lighter portion of the blood clot occurring when coagulation is delayed or when blood has been centrifuged. Buffy coat was separated from the red blood cells Red blood cells Cells that carry hemoglobin (the molecule that transports oxygen) and help remove wastes from tissues throughout the body. Mentioned in: Bone Marrow Transplantation red blood cells , and DNA was extracted and purified using a QIAamp blood kit (Qiagen, Valencia, CA) as described by the manufacturer. Genotyping All PCR reactions were assembled using standard precautions in an ultraviolet-irradiated hood in a room dedicated to this purpose to prevent carryover contamination. The PON1 -909G [right arrow] C, L55M, and Q192R and the PON2 C311S genotypes were determined by the clamp-dependent allele-specific PCR (CD-ASPCR) method of Germer and Higuchi (1999). Real-time PCR methods was selected because it is a single-tube assay and offers high throughput. The primer sequences for genotyping were as follows: -909G [right arrow] C: G (sense), 5'-TGCCTCT-GTACAACCATGTC-3'; C (sense), 5'-CGGCGGGGGCGGTGCCTC-TGTACAACCATGTG-3'; reverse, 5'-CATGGAGCAAATCATTCACAG-3'. L55M: M, 5'-GGCAGAAACTGGCTC-TGAAGACA-3'; 5'-CGGCGGGG-GCGCGGCAGAAACTGGCTCTGA AGACT; reverse, 5'-CACTCACAGA-GCTAATGAAAGCC-3'. Q192R: Q, 5'-TATTTTCTTGACCCC-TACTTACA-3'; R, 5'-CGGCGGGGG GCGGGGCTTTCTTGACCCCTAC TTACG-3'; reverse, 5'-CTTCACTT-GGACTATAGTAGACAA-3'. PON2 C311S: S, 5'-CGGCGGCGGC-CGCATCCA-3'; C, 5'-TCCGCA-TCCA-GAACATTCTATG-3'; reverse, 5'-ACACTGAGGCTACAGAACTT-CC-3'. The -108C [right arrow] T and -162A [right arrow] G genotypes were determined by restriction fragment length polymorphism restriction fragment length polymorphism n. Abbr. RFLP Intraspecies variations in the length of DNA fragments generated by the action of restriction enzymes and caused by mutations that alter the sites at which these enzymes act, changing analysis of PCR products (Brophy et al. 2001 a). For -108C [right arrow] T, heminested PCR was performed first with the primers 5'-TG-GGCGCAGACACC-GACGGG-3' and 5'-GCCCAGCTAGCTGCCGACCC-3' and after 1,000-fold dilution with 5'TGGGCGCAGACACCGACGGG-3' and 5'-CTAGCTGCCGACCCGGCCCA-GAGGGG-3'. The products were digested with BstXI. For -162A [right arrow] G, the primers were 5 '-CCAGGTGCACAGAAGGCG-3' and 5'-GCTCCTGCGGTGGGGGCTGA-3', and the restriction endonuclease restriction endonuclease one of over 200 enzymes isolated from bacteria that cleave any DNA molecule at specific sites which are usually palindromes of 4 to 10 or so nucleotides to yield a collection of restriction DNA fragments that can be separated, usually by electrophoresis in was BstUI. For each coded sample, genotypes were entered into the laboratory database and verified by a second investigator. PON1 Assay The hydrolysis of phenylacetate to acetic acid acetic acid (əsē`tĭk), CH3CO2H, colorless liquid that has a characteristic pungent odor, boils at 118°C;, and is miscible with water in all proportions; it is a weak organic carboxylic acid (see carboxyl group). and phenol phenol (fē`nōl), C6H5OH, a colorless, crystalline solid that melts at about 41°C;, boils at 182°C;, and is soluble in ethanol and ether and somewhat soluble in water. , measured by absorbance absorbance /ab·sor·bance/ (-sor´bans) 1. in analytical chemistry, a measure of the light that a solution does not transmit compared to a pure solution. Symbol . 2. maximum [A.sub.270], was used to determine human plasma PON1 activity using the standard definition of units (Furlong et al. 1989). The molar extinction coefficient of phenol is 1,310. On the order of 5% of the PON1 activity in plasma may be due to serum cholinesterase cholinesterase /cho·lin·es·ter·ase/ (-es´ter-as) serum cholinesterase, pseudocholinesterase; an enzyme that catalyzes the hydrolytic cleavage of the acyl group from various esters of choline and some related compounds; determination of and serum albumin serum albumin n. See seralbumin. (Gan et al. 1991). This contribution was minimized by performing the assays at high pH. A cholinesterase inhibitor, in this case eserine eserine see physostigmine. sulfate sulfate, chemical compound containing the sulfate (SO4) radical. Sulfates are salts or esters of sulfuric acid, H2SO4, formed by replacing one or both of the hydrogens with a metal (e.g., sodium) or a radical (e.g., ammonium or ethyl). , is also necessary for specificity. The assay was first performed as described in a Hewlett-Packard diode array spectrophotometer spectrophotometer, instrument for measuring and comparing the intensities of common spectral lines in the spectra of two different sources of light. See photometry; spectroscope; spectrum. (Agilent, Palo Alto Palo Alto, city, California Palo Alto (păl`ō ăl`tō), city (1990 pop. 55,900), Santa Clara co., W Calif.; inc. 1894. Although primarily residential, Palo Alto has aerospace, electronics, and advanced research industries. , CA) equipped with a cell holder equipped with a thermostat. The assay was then adapted to 96-well format for high throughput and replication. A buffer solution (1.2x) was prepared as 12 [micro]M Tris-HCl (pH 8.0), 1.2 [micro]M Ca[Cl.sub.2], 6 [micro]M EDTA, and 4.8 [micro]M eserine sulfate. Individual plasma samples were diluted 333-fold by addition of 3 [micro]L plasma per milliliter milliliter /mil·li·li·ter/ (mL) (-le?ter) one thousandth (10-3) of a liter. mil·li·li·ter n. Abbr. phosphate-buffered saline. Phenylacetate was dissolved in water at 36 mM (10x) immediately before use and mixed with nine parts buffer. Two hundred microliters of this mixture were added to each well. Twenty-microliter aliquots of diluted plasma were placed in individual wells. The plates were incubated at 37[degrees]C in a Bio-Tek PowerwaveX microplate reader (Bio-Tek, Winooska, VT). The increase in [A.sub.270] was followed over time. The slope of the kinetic curve determined by the instrument software was used to calculate the rate of hydrolysis of phenylacetate. Blanks included both samples lacking plasma and samples with plasma but lacking substrate. The measurements of individual samples were reproducible within 10%, mostly limited by the serum dilution step. Statistical Analysis The genetic influence of PON1 polymorphisms on PON1 activity was analyzed by analysis of variance. Because of limited serum availability for enzymatic activity determinations, a total of 390 maternal and 189 neonate data sets were analyzed. Log transformation of the enzyme activity Enzyme activity A measure of the ability of an enzyme to catalyze a specific reaction. Mentioned in: Glucose-6-Phosphate Dehydrogenase Deficiency was performed to improve normality. Linear regression Linear regression A statistical technique for fitting a straight line to a set of data points. was used to assess age-adjusted trends in genotypic effects on PON1 phenotypes. These relationships were examined separately in mothers and neonates as well as by race/ethnicity. LD was calculated as D' based on Lewontin, which ranges from 0 (no LD) to 1 or -1 (complete LD) (Lewontin 1988). The EH (estimating haplotype-frequency) linkage utility program (Terwilliger and Ott 1994) was used to determine chi-square statistics and p-values for tests of allelic al·lele n. One member of a pair or series of genes that occupy a specific position on a specific chromosome. [German Allel, short for Allelomorph, allelomorph, from English association between polymorphic markers. To assess independent and group effects of polymorphisms on PON1 activity, linear and multivariable regression models were used to determine the independent and group contributions of the coding and promoter polymorphisms to phenotypic expression based on Brophy et al. (2001b). All p-values are two-sided. Statistical tests were performed using SAS (1) (SAS Institute Inc., Cary, NC, www.sas.com) A software company that specializes in data warehousing and decision support software based on the SAS System. Founded in 1976, SAS is one of the world's largest privately held software companies. See SAS System. (SAS Institute 2001). Results PON Allele Frequencies Single nucleotide polymorphism Noun 1. single nucleotide polymorphism - (genetics) genetic variation in a DNA sequence that occurs when a single nucleotide in a genome is altered; SNPs are usually considered to be point mutations that have been evolutionarily successful enough to recur in a (SNP SNP Scottish National Party Noun 1. SNP - (genetics) genetic variation in a DNA sequence that occurs when a single nucleotide in a genome is altered; SNPs are usually considered to be point mutations that have been evolutionarily ) frequencies were obtained for the five common PON1 polymorphisms and for one common PON2 polymorphism (Table 1). The promoter alleles are named in the sense direction. Although the allele frequencies varied substantially among race/ethnicity groups, each of the six polymorphisms has a minor allele frequency of at least 11% in all of the ethnic groups. PON1 Genotypes and PON1 Activity The maternal geometric mean (mathematics) geometric mean - The Nth root of the product of N numbers. If each number in a list of numbers was replaced with their geometric mean, then multiplying them all together would still give the same result. PON1 activity was independent of race/ethnicity, with mean values of 123, 131, and 130 U/mL for African Americans, Caucasians, and Caribbean Hispanics, respectively (p = 0.08). Effects of maternal genotypes and race/ethnicity on maternal PON 1 activity are summarized in Table 2. Overall, a statistically significant (p [less than or equal to] 0.02) difference in PON1 activity was found among genotypes of each of the three promoter polymorphisms as well as L55M. The Q192R polymorphism did not influence PON1 activity with phenylacetate. When examined by race/ethnicity independently, L55M was not a significant predictor (p = 0.14) in Caucasian mothers, whereas the promoter polymorphisms were not significant predictors in African-American mothers (p [greater than or equal to] 0.16). All four polymorphisms remained significant predictors of PON1 activity in Caribbean-Hispanic mothers (p [less than or equal to] 0.05). For neonates, the geometric mean PON1 activity was dependent on race/ ethnicity: 44.4 (referent), 33.3 (p < 0.002), and 25.4 (p < 0.0001) U/mL for African Americans, Caribbean Hispanics, and Caucasians, respectively. Effects of neonate genotypes and race/ethnicity on neonate PON1 activity are summarized in Table 3. Similar to the mothers, the three promoter polymorphisms as well as L55M (but not Q192R) were significantly associated with PON1 activity (p < 0.0001). Unlike the mothers, these associations were apparent in all three race/ethnicity groups (p = 0.02). Figure 1 compares the genetic influences of the three promoter and L55M polymorphisms on PON1 activity in mothers and their neonates (all race/ethnicities combined). There was a striking difference in the PON1 activities, with the neonates having a geometric mean 4.1-fold lower. In addition, the genetic influence in neonates appears to be stronger, with no polymorphisms affecting maternal PON1 activity by more than 35% but with both -108 (and -909) and L55M polymorphisms affecting PON1 activity by more than 2-fold in neonates. [lFIGURE 1 OMITTED] PON Linkage Disequilibrium: Important Alleles Affecting PON1 Activity Pairwise LD calculations for the five polymorphisms and three race/ethnicities, reported as D' and chi-square with associated p-values, are presented in Table 4. In all three race/ethnicities, the promoter polymorphisms are in nearly complete LD with one another (D' [greater than or equal to] 0.9, p < 0.0001). The promoter polymorphisms are also in significant LD with L55M, but more so for Caucasians than for African Americans. L55M and Q192R are in LD in Caucasians but not in African Americans. On the other hand, the promoter polymorphisms -108C [right arrow] T and -909 G [right arrow] C are in significant LD with Q192R in African-Americans but not in Caucasians. Interestingly, strong LD is observed between PON2 C311S and the PON1 promoter polymorphisms in all race/ethnicities, with the strongest linkage in Caucasians. In all of these cases, values for Caribbean Hispanics fall between those for Caucasians and African Americans. Analysis of conditional variance (adjusted for the other polymorphisms based on Brophy et al. 2001 b) showed that maternal -108 C [right arrow] T and L55M polymorphisms contributed 12 and 4%, 1 and 9%, and 17 and 12% of the total variance, respectively, for Caucasians, African Americans, and Caribbean Hispanics. A similar analysis of conditional variance for neonates showed that the -108C [right arrow] T and L55M polymorphisms contributed 53 and 44%, 8 and 3%, and 19 and 10% of the total variance, respectively, for Caucasians, African Americans, and Caribbean Hispanics. Table 5 shows the maternal PON1 activities for the nine possible -108C [right arrow] T and L55M genotypes. Using -108CC, 55LL as referent, all three L55M genotypes of -108 TT were significantly different, with decreasing PON1 activity trend from 55LL (126.6 U/mL) to 55LM (116.1 U/mL) to 55MM (105.1 U/mL). With the same referent, only the -108 TT genotype of 55MM was significantly different, although the sample sizes were low (7 and 9) for the other -108 genotypes. Discussion PON1 Allele Frequencies In this study we have investigated the effect of genotype, as reflected by all of these five common PON1 polymorphisms, on phenotype, as reflected by PON1 activity. The subjects were pregnant women and their neonates at risk of prenatal exposure to chlorpyrifos in the home. The subjects included Caucasians, African Americans, and Caribbean Hispanics. The observed frequencies (Table 1) for the 192R allele allele (əlēl`): see genetics. allele Any one of two or more alternative forms of a gene that may occur alternatively at a given site on a chromosome. among Caucasians and African Americans were consistent with previous studies [e.g., 0.28 for Caucasians compared with 0.27-0.31 in several previous studies (Davies et al. 1996; Leviev and James 2000; Brophy et al. 200lb)]. The allele frequencies for all five PON1 SNPs and for PON2 S311C among Caribbean Hispanics in New York City fell between the values for Caucasians and African Americans, with allele frequencies consistent with similar Caucasian and African-American derivation. This study was the first to include all of these polymorphisms and these race/ethnicities in a study of PON1 activity in mothers and their neonates. PON1 Genotypes and PON1 Activity: Increased Genotypic Influence in Neonates It has been known for many years that neonates have much lower PON1 activities than adults (Mueller et al. 1983). We have confirmed this observation for each of the race/ethnicities (Tables 2 and 3, Figure 1). Specifically, the mean PON1 activity in maternal blood was 4.6, 3.6, and 2.6 times greater than the mean PON1 activity in cord blood for Caucasians, Caribbean Hispanics, and African Americans, respectively. Again, the data for Caribbean Hispanics fall between Caucasians and African Americans. For all groups, however, the results suggest a potentially greater degree of susceptibility of a fetus or newborn to the toxic effects of organophosphates. Effects of functional polymorphisms in the coding region of a gene (e.g., L55M and Q192R) normally remain constant throughout the life of an individual. Polymorphisms in the promoter region of a gene (e.g., -909, -168, -108)can affect the level of transcription. We hypothesized that transcription factor interactions with the promoter may vary throughout life. PON1 activity differed among genotypes for promoter polymorphisms, as exemplified by -108C [right arrow] T, and the functional polymorphism L55M. A significant effect of Q192R on PON1 activity was found in one large recent study (Brophy et al. 2001b). Our results for all race/ethnicities individually as well as combined agree with a second recent study showing no significant effect (Leviev and James 2000), but this lack of effect may be due to smaller sample size. In our combined maternal population, the -108 CC and -108 TT homozygotes as well as the 55LL and 55MM homozygotes had approximately 15% greater and lesser activities than the corresponding heterozygotes, respectively. The effect of the promoter polymorphisms in African-American mothers did not reach the level of significance, probably because of sample size considering the lower minor allele frequency. Another study found 20 and 12% for the -108 and L55M polymorphisms, respectively (Leviev and James and 20%, respectively (Brophy et al. 200lb). All of these results are similar and are strikingly different from our results with cord blood. In particular, in our combined neonate population, the -108CC and -108 TT homozygotes as well as the 55LL and 55MM homozygotes had approximately 51 and 40% greater and 28 and 47% lesser activities than the corresponding heterozygores, respectively. Thus, not only is the average potential risk to a fetus or newborn from organophosphate exposure greater than in the adult, the range of protection afforded by PON1 is more dependent on genotype than in the adult, with the -108 TT and the 55MM homozygotes having PON1 activities 5.8- and 7.8-fold lower than the average adult, respectively. PON Linkage Disequilibrium: Important Alleles Affecting PON1 Activity As previously observed (Leviev and James 2000; Brophy et al. 2001b), the promoter polymorphisms were in significant LD (Table 4). Examination of maternal PON1 activity and genotypes confirmed that nearly all of the contribution of these polymorphisms to PON1 activity could be determined by analyzing the -108 polymorphism. The LD extends to L55M and -108 C [right arrow] T, but is less than among the promoter polymorphisms, with D' varying from 0.42 to 0.51 depending on race/ ethnicity. After correction for LD, Leviev and James (2000) and Brophy et al. (200lb) found that the -108CT polymorphism accounted for 24.7 and 22.8%, respectively, of the variance in PON1 for Caucasians. They also found that L55M accounted for 4.4-4.6 or 4.1% of the variance, respectively. Our data for Caucasian mothers were qualitatively consistent, with conditional variances attributable to -108C [right arrow] T being greater than that attributable to L55M, at 12 and 4%, respectively, after adjustment for the other polymorphisms. In Table 5, PON1 activity for all three L55M genotypes combined with -108 TT were significantly different from the referent (55LL, -108 CC, p < 0.02) and decreased from 126.6 (55LL) to 116.1 (55ML) to 105.1 (55MM) U/mL. Although the number of neonates was smaller than the number of mothers, the conditional variance attributable to genes was greater, and both polymorphisms again contributed significantly. Taken together, these data suggest that analysis of both -108 C [right arrow] T and L55M PON1 genotypes is required to infer phenotype from genotype. LD for Q192R depended strongly on race/ethnicity, with D' to -108 C [right arrow] T being -0.93 (p < 0.0001) in Caucasians and -0.18 (not significant) in African Americans. The reverse was seen for L55M and Q192R, with D' being -0.43 (10 < 0.01) in African Americans and 0.16 (not significant) in Caucasians. As expected, D' values for Caribbean Hispanics fell between those for Caucasians and African Americans. Although Q192R had no significant effect on PON1 activity as measured using phenyl acetate as the substrate, this polymorphism affects substrate specificity and thus affects the enzymatic activity with other substrates, such as chlorpyrifos oxon, both in vitro in vitro /in vi·tro/ (in ve´tro) [L.] within a glass; observable in a test tube; in an artificial environment. in vi·tro adj. In an artificial environment outside a living organism. and in vivo in vivo /in vi·vo/ (ve´vo) [L.] within the living body. in vi·vo adj. Within a living organism. in vivo adv. (Furlong et al. 2000). Therefore, for other substrates, Q192R genotype must also be determined to infer phenotype from genotype, and the race/ethnicity dependence of LD must be taken into account. Linkage disequilibrium depends on local recombination recombination, process of "shuffling" of genes by which new combinations can be generated. In recombination through sexual reproduction, the offspring's complete set of genes differs from that of either parent, being rather a combination of genes from both parents. rate (Taillon-Miller et al. 2000), population structure, and the number of generations since the mutation (polymorphism) arose (Slatkin 1999). There has been a significant debate over the size of the DNA blocks exhibiting LD (Reich et al. 2001; Dunning et al. 2000; Abecasis et al. 2001). In this study we also looked at LD between the PON1 polymorphisms and PON2 C311S located 97.2 kb away from Q192R and more distant from the other PON1 polymorphisms. PON2 C311S exhibits significant LD only in Caucasians for PON1 L55M (D' = -0.43, p < 0.05) and no linkage for PON1 Q192R. However, PON2 C311S was highly linked to PON1 -108C [right arrow] T in all three race/ethnicities. It is of interest to note that both PON1 (Imai et al. 2000) and PON2 (Sanghera et al. 1998) polymorphisms have been linked to cardiovascular disease Cardiovascular disease Disease that affects the heart and blood vessels. Mentioned in: Lipoproteins Test cardiovascular disease , although a mechanism for PON2 action has not been demonstrated (Mackness et al. 1999). The LD demonstrated in this work may facilitate similar epidemiologic analyses.
Table 1. Allele frequencies of PON genotypes.
Mother
Gene,
position Caucasian African American Hispanic
and allele (n = 82) (n = 117) (n = 203)
PON1
-909
G 0.38 0.84 0.61
C 0.62 0.16 0.39
-162
A 0.20 0.42 0.26
G 0.80 0.58 0.74
-108
C 0.38 0.85 0.65
T 0.62 0.15 0.35
55
L 0.54 0.79 0.71
M 0.46 0.21 0.29
192
Q 0.73 0.37 0.54
R 0.27 0.63 0.46
PON2
311
S 0.80 0.79 0.77
C 0.20 0.21 0.23
Neonate
Gene,
position Caucasian African American Hispanic
and allele (n = 56) (n = 66) (n = 107)
PON1
-909
G 0.42 0.88 0.65
C 0.58 0.12 0.35
-162
A 0.18 0.42 0.25
G 0.82 0.58 0.75
-108
C 0.44 0.89 0.67
T 0.56 0.11 0.33
55
L 0.58 0.81 0.78
M 0.42 0.19 0.22
192
Q 0.76 0.30 0.50
R 0.24 0.70 0.50
PON2
311
S 0.75 0.73 0.77
C 0.25 0.27 0.23
Table 2. Maternal PON1 polymorphism frequencies, enzyme activities,
and p-values for trend.
Caucasian (n = 78)
Mean PON1
Position and enzyme activity p-Value
genotype % (n) (SD) (trend) (a)
-909
GG 15 (12) 160.5 (16.3)
CG 45 (35) 135.0 (33.2) p = 0.0009
CC 40 (31) 122.5 (29.1)
-162
AA 8 (6) 159.5 (17.2)
AG 24 (19) 139.5 (26.6) p = 0.02
GG 68 (53) 129.0 (33.5)
-108
CC 14 (11) 161.6 (16.6)
CT 46 (36) 134.0 (27.8) p = 0.001
TT 40 (31) 124.0 (35.1)
55
LL 33 (26) 139.8 (28.6)
LM 42 (33) 133.3 (45.5) p = 0.14
MM 24 (19) 126.9 (34.3)
192
QQ 55 (43) 138.1 (33.4)
QR 35 (27) 130.6 (31.0) p = 0.22
RR 10 (8) 122.7 (24.7)
African American (n = 112)
Mean PON1
Position and enzyme activity p-Value
genotype % (n) (SD) (trend) (a)
-909
GG 72 (80) 129.0 (28.5)
CG 24 (27) 123.0 (29.0) p = 0.28
CC 4 (4) 120.8 (40.9)
-162
AA 21 (23) 128.5 (31.4)
AG 43 (48) 130.1 (27.2) p = 0.35
GG 36 (40) 122.5 (29.8)
-108
CC 72 (81) 129.1 (28.3)
CT 25 (28) 122.4 (28.8) p = 0.16
TT 3 (3) 113.9 (46.9)
55
LL 58 (65) 134.0 (27.5)
LM 39 (44) 118.8 (27.7) p = 0.001
MM 3 (3) 96.5 (32.3)
192
QQ 14 (16) 116.8 (32.5)
QR 44 (49) 133.2 (31.2) p = 0.67
RR 42 (47) 124.1 (23.7)
Hispanic (n = 200)
Mean PON1
Position and enzyme activity p-Value
genotype % (n) (SD) (trend) (a)
-909
GG 38 (76) 148.4 (34.6)
CG 47 (93) 134.1 (32.6) p < 0.0001
CC 16 (31) 109.7 (33.8)
-162
AA 7 (13) 146.6 (42.6)
AG 39 (78) 139.9 (33.1) p = 0.05
GG 55 (109) 131.4 (36.6)
-108
CC 44 (88) 150.9 (34.6)
CT 42 (84) 129.9 (28.7) p < 0.0001
TT 14 (28) 105.7 (35.8)
55
LL 51 (101) 149.3 (31.7)
LM 43 (85) 123.9 (35.2) p < 0.0001
MM 7 (14) 110.1 (29.8)
192
QQ 29 (57) 134.1 (42.1)
QR 51 (101) 137.0 (33.9) p = 0.55
RR 21 (42) 134.8 (31.7)
Combined (n = 390)
Mean PON1
Position and enzyme activity p-Value
genotype % (n) (SE) (b) (trend) (a)
-909
GG 43 (168) 143.7 (2.7)
CG 40 (155) 130.6 (2.7) p < 0.0001
CC 17 (66) 111.4 (4.1)
-162
AA 10 (42) 140.7 (5.2)
AG 37 (145) 136.4 (2.9) p = 0.02
GG 52 (202) 127.5 (2.4)
-108
CC 46 (180) 145.9 (2.6)
CT 38 (148) 127.9 (2.7) p < 0.0001
TT 16 (62) 109.3 (4.1)
55
LL 49 (192) 143.5 (2.4)
LM 42 (162) 124.2 (2.6) p = <0.0001
MM 9 (36) 114.6 (5.4)
192
QQ 30 (116) 131.7 (3.2)
QR 45 (177) 134.2 (2.7) p = 0.74
RR 25 (97) 129.4 (3.6)
(a) p-Value for trend on log-transformed values. (b) Least-squares
means adjusted for mother's race/ethnicity.
Table 3. Neonate PON1 polymorphism frequencies, enzyme activities, and
p-values for trend.
Caucasian (n = 47)
Mean PON1
Position and enzyme activity p-Value
genotype % (n) (SD) (trend) (a)
-909
GG 15 (7) 41.8 (12.4)
CG 53 (25) 32.2 (18.2) p < 0.0001
CC 32 (15) 18.5 (7.7)
-162
AA 2 (1) 63.1
AG 32 (15) 38.5 (20.5) p = 0.0004
GG 66 (31) 23.7 (10.7)
-108
CC 17 (8) 50.5 (23.1)
CT 51 (24) 28.8 (11.0) p < 0.0001
TT 32 (15) 18.5 (7.7)
55
LL 32 (15) 41.0 (21.1)
LM 51 (24) 27.5 (9.1) p < 0.0001
MM 17 (8) 12.5 (5.6)
192
QQ 64 (30) 28.4 (14.9)
QR 30 (14) 30.9 (21.7) p = 0.50
RR 6 (3) 30.0 (8.2)
African American (n = 51)
Mean PON1
Position and enzyme activity p-Value
genotype % (n) (SD) (trend) (a)
-909
GG 75 (38) 52.4 (23.9)
CG 25 (13) 36.4 (12.8) p = 0.005
CC -- --
-162
AA 18 (9) 51.8
AG 48 (24) 53.2 (29.3) p = 0.08
GG 34 (17) 40.2 (11.4)
-108
CC 76 (39) 51.8 (23.8)
CT 24 (12) 36.8 (13.3) p = 0.01
TT -- --
55
LL 71 (36) 52.0 (22.5)
LM 25 (13) 40.7 (21.7) p = 0.004
MM 4 (2) 29.6 (15.3)
192
QQ 8 (4) 47.5 (29.8)
QR 43 (22) 48.5 (27.6) p = 0.59
RR 49 (25) 48.2 (17.0)
Hispanic (n = 91)
Mean PON1
Position and enzyme activity p-Value
genotype % (n) (SD) (trend) (a)
-909
GG 40 (36) 42.8 (14.9)
CG 51 (46) 37.6 (23.9) p = 0.006
CC 10 (9) 37.6 (23.9)
-162
AA 7 (7) 45.7
AG 41 (37) 41.3 (15.9) p = 0.02
GG 52 (47) 34.9 (24.1)
-108
CC 48 (43) 46.3 (23.5)
CT 41 (37) 33.2 (13.9) p = 0.0004
TT 11 (10) 37.6 (23.9)
55
LL 60 (55) 42.8 (21.9)
LM 35 (32) 33.0 (15.3) p = 0.0007
MM 4 (4) 19.0 (19.4)
192
QQ 25 (23) 40.3 (20.5)
QR 53 (48) 39.1 (22.5) p = 0.33
RR 22 (20) 34.1 (14.9)
Combined (n = 189)
Mean PON1
Position and enzyme activity p-Value
genotype % (n) (SE) (trend) (a)
-909
GG 43 (81) 47.1 (2.2)
CG 44 (84) 35.8 (2.1) p < 0.0001
CC 13 (24) 35.8 (2.1)
-162
AA 8 (17) 49.7
AG 40 (76) 44.3 (2.3) p < 0.0001
GG 50 (95) 32.3 (2.1)
-108
CC 48 (90) 49.0 (2.0)
CT 39 (73) 32.4 (2.2) p < 0.0001
TT 13 (25) 35.8 (2.1)
55
LL 56 (106) 45.6 (1.9)
LM 36 (69) 32.6 (2.4) p < 0.0001
MM 7 (14) 17.2 (5.3)
192
QQ 30 (57) 39.2 (2.9)
QR 44 (84) 39.4 (2.3) p = 0.08
RR 25 (48) 36.6 (3.1)
(a) p-Value for trend on log-transformed values. (b) Least-squares
means adjusted for neonate's race/ethnicity.
Table 4. Tests of LD between maternal PON polymorphisms: D',
chi-square, and associated p-values.
Position: PON1 -909
D' Chi-square (p)
Caucasian
-108 0.92 119.38 (p < 0.0001)
-909
-162
55
192
African American
-108 0.97 126.06 (p < 0.0001)
-909
-162
55
192
Hispanic
-108 0.90 213.47 (p < 0.0001)
-909
-162
55
192
Position: -162
D' Chi-square (p)
Caucasian
-108 -1.00 51.44 (p < 0.0001)
-909 -1.00 52.83 (p < 0.0001)
-162
55
192
African American
-108 -0.90 20.73 (p < 0.0001)
-909 -1.00 28.23 (p < 0.0001)
-162
55
192
Hispanic
-108 -1.00 61.33 (p < 0.0001)
-909 -1.00 73.61 (p < 0.0001)
-162
55
192
Position: 55
D' Chi-square (p)
Caucasian
-108 0.50 12.71 (p < 0.001)
-909 0.60 18.82 (p < 0.0001)
-162 -1.00 30.99 (p < 0.0001)
55
192
African American
-108 0.42 11.45 (p < 0.001)
-909 0.35 8.41 (p < 0.01)
-162 -0.44 4.71 (p < 0.05)
55
192
Hispanic
-108 0.51 38.22 (p < 0.0001)
-909 0.47 24.77 (p < 0.0001)
-162 -0.72 15.24 (p < 0.0001)
55
192
Position: 192
D' Chi-square (p)
Caucasian
-108 0.16 0.40 (p = NS)
-909 0.02 0.01 (p = NS)
-162 -0.77 5.88 (p < 0.02)
55 -0.93 33.85 (p < 0.0001)
192
African American
-108 -0.43 7.49 (p < 0.01)
-909 -0.34 4.99 (p < 0.05)
-162 -0.11 1.06 (p = NS)
55 -0.18 1.72 (p = NS)
192
Hispanic
-108 -0.29 8.76 (p < 0.01)
-909 -0.22 5.02 (p < 0.05)
-162 -0.15 1.23 (p = NS)
55 -0.50 18.72 (p < 0.0001)
192
Position: PON2 -311
D' Chi-square (p)
Caucasian
-108 -0.82 32.08 (p < 0.0001)
-909 -0.88 38.89 (p < 0.0001)
-162 0.37 14.04 (p < 0.001)
55 -0.43 4.30 (p < 0.05)
192 -0.02 0.00 (p = NS)
African American
-108 -1.00 7.05 (p < 0.01)
-909 -0.99 7.81 (p < 0.01)
-162 0.10 0.36 (p = NS)
55 0.03 0.14 (p = NS)
192 -0.25 3.23 (p = NS)
Hispanic
-108 -0.87 25.38 (p < 0.0001)
-909 -0.95 42.09 (p < 0.0001)
-162 0.36 20.21 (p < 0.0001)
55 -0.25 1.21 (p = NS)
192 -0.04 0.07 (p = NS)
NS, not significant.
Table 5. PON1 genotypes and maternal PON1 activity [(-108C
[right arrow] T and L55M) all race/ethnicities combined (n = 390)].
PON1: L55M
PON1: -108 LL LM MM
CC 11,731 10,366 10,446
SD = 2,409 SD = 3,006 SD = 2,836
(n = 1.28) (n = 45) (n = 7)
CT 11,044 9,940 * 10,897
SD = 2,439 SD = 2,148 SD = 2,014
(n = 48) (n = 91) (n = 9)
p < 0.0001 a
TT 10,125 9,284 * 8,410 *
SD = 2,308 SD = 3,422 SD = 2,500
(n = 16) (n = 26) (n = 20)
p = 0.02 (a) p < 0.0001 (a) p < 0.0001 (a)
(a) p-Value for contrasts and estimates comparing to PON1: -108CC/55LL
genotype. * Scheffe's multiple comparisons procedure: p < 0.05 compared
to PON1: -108CC/55LL genotype.
REFERENCES Abecasis GR, Noguchi E, Heinzmann A, Traherne JA, Bhattacharyya S, Leaves NI, et al. 2001. Extent and distribution of linkage disequilibrium in three genomic regions. Am J Hum Genet genet: see civet. 68:191-197. Adkins S, Gan KN, Mody M, La Du BN. 1993. Molecular basis for the polymorphic forms of human serum paraoxonase/arylesterase: glutamine glutamine (gl `təmēn), organic compound, one of the 20 amino acids commonly found in animal proteins. or
arginine arginine (är`jənĭn), organic compound, one of the 20 amino acids commonly found in animal proteins. Only the l-stereoisomer participates in the biosynthesis of proteins. at position 191, for the respective A or B allozymes. Am J Hum
Genet 52:598-608.Atterberry TT, Burnett WT, Chambers JE. 1997. Age-related differences in parathion parathion: see insecticide. and chlorpyrifos toxicity in male rats: target and nontarget non·tar·get adj. Not being the target, as of an agent or weapon: effects of radiotherapy on nontarget cells. esterase esterase /es·ter·ase/ (es´ter-as) any enzyme which catalyzes the hydrolysis of an ester into its alcohol and acid. es·ter·ase n. Any of various enzymes that catalyze the hydrolysis of an ester. sensitivity and cytochrome cytochrome (sī`təkrōm'), protein containing heme (see coenzyme) that participates in the phase of biochemical respiration called oxidative phosphorylation. P450-mediated metabolism. Toxicol Appl Pharmacol 147:411-418. Aviram M, Hardak E, Vaya J, Mahmood S, Milo S, Hoffman A, et al. 2000. Human serum paraoxonases (PON1) Q and R selectively decrease lipid peroxides in human coronary and carotid carotid /ca·rot·id/ (kah-rot´id) pertaining to the carotid artery, the principal artery of the neck. ca·rot·id n. atherosclerotic lesions: PON1 esterase and peroxidaselike activities. Circulation 101:2510-2517. Aviram M, Rosenblat M, Bisgaier CU Newton RS, Primo-Parmo SL, La Du BN. 1998. Paraoxonase inhibits high-density lipoprotein high-density lipoprotein n. Abbr. HDL A lipoprotein that contains relatively small amounts of cholesterol and triglycerides and is associated with a decreased risk of atherosclerosis and coronary artery disease. oxidation and preserves its functions. A possible peroxidative role for paraoxonase. J Clin Invest 101:1581-1590. Boright AP, Connelly PW, Brunt JH, Scherer SW, Tsui LC, Hegele RA. 1998. Genetic variation in paraoxonase-1 and paraoxonase-2 is associated with variation in plasma lipoproteins Lipoproteins The packages in which cholesterol and triglycerides travel throughout the body. Mentioned in: Lipoproteins Test lipoproteins (lip´ōprō´tēns), n. in Alberta Hutterites. Atherosclerosis 139:131-136. Brophy VH, Hastings MD, Clendenning JB, Richter RJ, Jarvik GP, Furlong CE. 2001a. Polymorphisms in the human paraoxonase (PON1) promoter. Pharmacogenetics Pharmacogenetics Definition Pharmacogenetics is the study of how the actions of and reactions to drugs vary with the patient's genes. Description 11:77-84. Brophy VH, Jampsa RL, Clendenning JB, McKinstry LA, Jarvik GP, Furlong CE. 2001b. Effects of 5' regulatory-region polymorphisms on paraoxonase-gene (PON1) expression. Am J Hum Genet 68:1428-1436. Chanda SM, Pope CN. 1996. Neurochemical neu·ro·chem·is·try n. The study of the chemical composition and processes of the nervous system and the effects of chemicals on it. neu and neurobehavioral effects of repeated gestational exposure to chlorpyrifos in maternal and developing rats. Pharmacol Biochem Behav 53:771-776. Clendenning JB, Humbert R, Green ED, Wood C, Traver D, Furlong CE. 1996. Structural organization of the human PON1 gene. Genomics 35:586-589. Costa LG, Li WF, Richter R J, Shih DM, Lusis A, Furlong CE. 1999. The role of paraoxonase (PON1) in the detoxication detoxification, detoxication 1. reduction of the toxic properties of a substance. 2. treatment designed to assist in recovery from the toxic effects of a drug. metabolic detoxification of organophosphates and its human polymorphism. Chem-Biol Interact 119-120:429-438. Costa LG, McDonald BE, Murphy SD, Omenn GS, Richter R J, Motulsky AG, et al. 1990. Serum paraoxonase and its influence on paraoxon and chlorpyrifos-oxon toxicity in rats. Toxicol Appl Pharmacol 103:66-76. Davies HG, Richter R J, Keifer M, Broomfield CA, Sowalla J, Furlong CE. 1996. The effect of the human serum paraoxonase polymorphism is reversed with diazoxon, soman soman, colorless liquid used as a nerve gas. It boils at 167°C;, evolving an odorless vapor. It is rapidly absorbed through the skin; death may result within 15 min of exposure. In nonfatal concentrations it is hazardous to the eyes. and sarin. Nat Genet 14:334-336. Dunning AM, Durocher F, Healey CS, Teare MD, McBride SE, Carlomagno F, et al. 2000. The extent of linkage disequilibrium in four populations with distinct demographic histories. Am J Hum Genet 67:1544-1554. Entrez Chromosome Map. 2002. Available: http://www.ncbi.nlm.nih.gov/mapview/maps.cgi?, expanded to see PON1, PON3, PON2 [accessed 5 November 2002]. Furlong CE, Li WF, Richter RJ, Shih DM, Lusis AJ, Alleva E, et al. 2000. Genetic and temporal determinants of pesticide sensitivity: role of paraoxonase (PON1). Neurotoxicology 21:91-100. Furlong CE, Richter RJ, Seidel sei·del n. A beer mug. [German, from Middle High German s del, from Latin situla, bucket.]Noun 1. SL, Costa LG, Motulsky AG. 1989. Spectrophotometric assays for the enzymatic hydrolysis of the active metabolites of chlorpyrifos and parathion by plasma paraoxonase/arylesterase. Anal Biochem 180:242-247. Gan KN, Smolen A, Eckerson HW, La Du BN. 1991. Purification of human serum paraoxonase/ arytesterase. Evidence for one esterase catalyzing both activities. Drug Metab Dispos 19:100-106. Garin MC, James RW, Dussoix P, Blanche H, Passa P, Froguel P, et al. 1997. Paraoxonase polymorphism Met-Leu54 is associated with modified serum concentrations of the enzyme. A possible link between the paraoxonase gene and increased risk of cardiovascular disease in diabetes. J Clin Invest 99:62-66. Geldmacher-von Mallinckrodt M, Diepgen TL, Duhme C, Hommel G. 1983. A study of the polymorphism and ethnic distribution differences of human serum paraoxonase. Am J Phys Anthropol 62:235-241. Germer S, Higuchi R. 1999. Single-tube genotyping without oligonucleotide probes. Genome Res 9:72-78. Humbert R, Adler DA, Disteche CM, Hassett C, 0miecinski CJ, Furlong CE. 1993. The molecular basis of the human serum para oxonase activity polymorphism. Nat Genet 3:73-76. Imai Y, Morita H, Kurihara H, Sugiyama T, Kato N, Ebihara A, et al. 2000. Evidence for association between paraoxonase gene polymorphisms and atherosclerotic diseases. Atherosclerosis 149:435-442. Leviev I, Deakin S, James RW. 2001. Decreased stability of the M54 isoform of paraoxonase as a contributory factor to variations in human serum paraoxonase concentrations. J Lipid Res 42:528-535. Leviev I, James RW. 2000. Promoter polymorphisms of human paraoxonase PON1 gene and serum paraoxonase activities and concentrations. Arterioscler Thromb Vasc Biol 20:516-521. Lewontin RC. 1988. On measures of gametic disequilibrium disequilibrium /dis·equi·lib·ri·um/ (dis-e?kwi-lib´re-um) dysequilibrium. linkage disequilibrium . Genetics 120:849-852. Li WF, Costa LG, Richter RJ, Hagen T, Shih DM, Tward A, et al. 2000. Catalytic efficiency determines the in-vivo efficacy of PON1 for detoxifying organophosphorus compounds. Pharmacogenetics 10:767-779. Mackness B, Durrington PN, Mackness MI. 1999. Polymorphisms of paraoxonase genes and low-density lipoprotein low-density lipoprotein n. Abbr. LDL A lipoprotein that contains relatively high amounts of cholesterol and is associated with an increased risk of atherosclerosis and coronary artery disease. lipid peroxidation. Lancet 353:468-469. Malin R, Laine S, Rantalaiho V, Wirta O, Pasternack A, Jokela H, et al. 2001. Lipid peroxidation is increased in paraoxonase L55 homozygotes compared with M-allele carriers. Free Radic Res 34:477-484. Mueller RF, Hornung S, Furlong CE, Anderson J, Giblett ER, Motulsky AG. 1983. Plasma paraoxonase polymorphism: a new enzyme assay, population, family, biochemical, and linkage studies. Am J Hum Genet 35:393-408. OMIM. 2002. Online Mendelian Inheritance in Man Online Mendelian Inheritance in Man See OMIM. . Available: http://www.ncbi.nlm.nih.gov/Omim/ (for PON1 [MIM 168820], PON2 [MIM 602447], PON3 [MIM 602720]) [accessed 5 November 2002]. Primo-Parmo SL, Sorenson RC, Teiber J, La Du BN. 1996. The human serum paraoxonase/arylesterase gene (PON1) is one member of a multigene family. Genomics 33:496-507. Reich DE, Cargill M, Bolk S, Ireland J, Sabeti PC, Richter DJ, et al. 2001, Linkage disequilibrium in the human genome. Nature 411:199-204. Roy AC, Loke DF, Saha N, Viegas GA, Tay JS, Ratnam SS. 1994. Interrelationships of serum paraoxonase, serum lipids and apolipoproteins in normal pregnancy. A longitudinal study longitudinal study a chronological study in epidemiology which attempts to establish a relationship between an antecedent cause and a subsequent effect. See also cohort study. . Gynecol Obstet Invest 38:10-13. Sams C, Mason HJ, Rawbone R. 2000. Evidence for the activation of organophosphate pesticides by cytochromes P450 3A4 and 2D6 in human liver microsomes. Toxicol Lett 116:217-221. Sanghera DK, Aston CE, Saha N, Kamboh MI. 1998. DNA polymorphisms in two paraoxonase genes (PON1 and PON2) are associated with the risk of coronary heart disease coronary heart disease: see coronary artery disease. coronary heart disease or ischemic heart disease Progressive reduction of blood supply to the heart muscle due to narrowing or blocking of a coronary artery (see atherosclerosis). . Am J Hum Genet 62:36-44. SAS Institute. 2001. SAS/STAT Guide for Personal Computers, Version 8. Cary, NC:SAS Institute, Inc. Shih DM, Gu L, Xia YR, Navab M, Li WF, Hama S, et al. 1998. Mice lacking serum paraoxonase are susceptible to organophosphate toxicity and atherosclerosis. Nature 394:284-287. Slatkin M. 1999. Disequilibrium mapping of a quantitative-trait locus in an expanding population. Am J Hum Genet 64:1764-1772. Smolen A, Eckerson HW, Gan KN, Hailat N, La Du BN. 1991. Characteristics of the genetically determined allozymic forms of human serum paraoxonase/arylesterase, Drug Metab Dispos 19:107-112. Taillon-Miller P, Bauer-Sardina I, Saccone NL, Putzel J, Laitinen T, Cao A, et al. 2000. Juxtaposed jux·ta·pose tr.v. jux·ta·posed, jux·ta·pos·ing, jux·ta·pos·es To place side by side, especially for comparison or contrast. regions of extensive and minimal linkage disequilibrium in human Xq25 and Xq28. Nat Genet 25:324-328. Terwilliger J, Ott J. 1994. Handbook of Human Genetic Linkage. Baltimore, MD: Johns Hopkins University Johns Hopkins University, mainly at Baltimore, Md. Johns Hopkins in 1867 had a group of his associates incorporated as the trustees of a university and a hospital, endowing each with $3.5 million. Daniel C. Press. Address correspondence to J.G. Wetmur, Microbiology, Box 1124, Mount Sinai School of Medicine, 1 Gustave L. Levy Place, New York New York, state, United States New York, Middle Atlantic state of the United States. It is bordered by Vermont, Massachusetts, Connecticut, and the Atlantic Ocean (E), New Jersey and Pennsylvania (S), Lakes Erie and Ontario and the Canadian province of , NY 10029-6574 USA. Telephone: (212) 241-7685. Fax: (212) 534-1684. E-mail: james.wetmur@mssm.edu This work was supported by grants ES09584 and ES11643 from the National Institute of Environmental Sciences and R827039 from the U.S. Environmental Protection Agency Environmental Protection Agency (EPA), independent agency of the U.S. government, with headquarters in Washington, D.C. It was established in 1970 to reduce and control air and water pollution, noise pollution, and radiation and to ensure the safe handling and . J.C. was supported by a Career Development Award CA81750 from the National Cancer Institute. The authors declare they have no conflict of interest. Received 12 November 2002; accepted 7 May 2003. Jia Chen, (1,2,3) Madhu Kumar, (4) Wendy Chan, (2) Gertrud Berkowitz, (2) and James G. Wetmur (4,5) (1) The Derald H. Ruttenberg Cancer Center, and Departments of (2) Community and Preventive Medicine preventive medicine, branch of medicine dealing with the prevention of disease and the maintenance of good health practices. Until recently preventive medicine was largely the domain of the U.S. , (3) pediatrics, (4) Microbiology, and (5) Human Genetics Human genetics A discipline concerned with genetically determined resemblances and differences among human beings. Technological advances in the visualization of human chromosomes have shown that abnormalities of chromosome number or structure are surprisingly , Mount Sinai School of Medicine, New York, New York, USA |
|
||||||||||||||||

ti·va
`təmēn)
del, from Latin situla, bucket.]
Printer friendly
Cite/link
Email
Feedback
Reader Opinion