Printer Friendly
The Free Library
5,677,147 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

In vivo imaging of activated estrogen receptors in utero by estrogens and bisphenol A.


Environmental estrogens Estrogens
Hormones produced by the ovaries, the female sex glands.

Mentioned in: Acne, Polycystic Ovary Syndrome

estrogens (es´trōjenz),
n.
 are of particular concern when exposure, occurs during embryonic development. Although there are good models to study estrogenic activity of chemicals in adult animals, developmental exposure is much more difficult to test. The weak estrogenic activity of the environmental estrogen bisphenol A (BPA BPA British Paediatric Association. ) in embryos is controversial. We have recendy generated transgenic mice that carry a reporter construct with estrogen-responsive elements coupled to luciferase luciferase
(loosif´rās´),
n an enzyme present in certain luminous organisms that act to bring about the oxidation of luciferins; energy produced in the
. We show that, using this in vivo in vivo /in vi·vo/ (ve´vo) [L.] within the living body.

in vi·vo
adj.
Within a living organism.



in vivo adv.
 model in combination with the MS imaging system, activation of estrogen receptors (ERs) by maternally applied BPA and other estrogens can be detected in riving embryos in utero in utero (in u´ter-o) [L.] within the uterus.

in u·ter·o
adj.
In the uterus.



in utero adv.
. Eight hours after exposure to 1 mg/kg BPA, ER transactivation Transactivation is an increased rate of gene expression triggered either by endogenous cellular or viral proteins - transactivators. These protein factors act in trans (i.e., intermolecularly).  could be significantly induced in the embryos. This was more potent than would be estimated from in vitro in vitro /in vi·tro/ (in ve´tro) [L.] within a glass; observable in a test tube; in an artificial environment.

in vi·tro
adj.
In an artificial environment outside a living organism.
 assays, although its intrinsic activity, is still lower than that of diethylstilbestrol diethylstilbestrol: see DES.  and 17[beta]-estradiol dipropionate. On the basis of these results, we conclude that the estrogenic potency of BPA estimated using in vitro assays might underestimate its estrogenic potential in embryos. Key words: bisphenol A, estrogen receptor, in utero, in vivo, reporter mice. Environ Health Perspect 112:1544-1549 (2004). doi:10.1289/ehp.7155 available via http://dx.doi.org/[Online 21 July 2004]

**********

There is concern about compounds in the environment that could partially mimic the effects of estrogen, which could possibly explain the rising incidence of reproductive abnormalities and certain cancers (Miller and Sharpe 1998). These environmental estrogens are a structurally very diverse group of compounds that can only be identified as environmental estrogens by carrying out functional studies. One compound of concern is bisphenol A (BPA), a monomer component of polycarbonate A category of plastic materials used to make a myriad of products, including CDs and CD-ROMs.  plastics and epoxy resins. Humans are exposed to BPA when it leaks from plastic packaging and dental appliances (Feldman 1997), and nanomolar concentrations have been measured in human serum (Takeuchi and Tsutsumi 2002). Recently, it was reported that BPA could cause meiotic meiotic

pertaining to meiosis.
 aneuploidy aneuploidy /an·eu·ploi·dy/ (an?u-ploi´de) any deviation from an exact multiple of the haploid number of chromosomes, whether fewer or more.

an·eu·ploi·dy
n.
 when female mice were exposed unintentionally through damaged cage material (Hunt et al. 2003). BPA has been found to possess weak estrogenic properties in in vitro assays with an E[C.sub.50] (median effective concentration) about 10,000 times less than strong estrogens such as 17[beta]-estradiol ([E.sub.2]) and diethylstilbestrol (DES) (Kim et al. 2001; Kuiper et al. 1998; Perez et al. 1998). However, the in vivo estrogenic potential of BPA can vary depending on animal species or strain studied (Milligan et al. 1998; Steinmetz et al. 1997, 1998). In addition, the end point is very important. It was shown that BPA did induce DNA synthesis in vaginal epithelium of Fischer 334 rats but did not in Sprague-Dawley rats, whereas in both strains BPA increased c-fos mRNA expression (Long et al. 2000). Two classical in vivo assays, the rodent uterine wet weight assay and the vaginal cornification cornification /cor·ni·fi·ca·tion/ (kor?ni-fi-ka´shun)
1. keratinization.

2. conversion of epithelium to the stratified squamous type.


cor·ni·fi·ca·tion
n.
 assay, have traditionally been used for testing estrogenic activity of compounds. In these assays, BPA has been found to be active (Ashby and Tinwell 1998; Markey et al. 2001; Papaconstantinou et al. 2000) as well as inactive (Coldham et al. 1997; Gould et al. 1998; Mehmood et al 2000; Tinwell et al. 2000). When found active, its potency was four orders of magnitude lower than that of DES, confirming the weak estrogenicity measured in in vitro assays.

It has been proposed that the developing embryo may be much more susceptible to harmful effects of environmental estrogens compared with adult animals (Bigsby et al. 1999; Dencker and Eriksson 1998; McLachlan 2001; Miller 1983). The best-known example of a developmentally active compound is the synthetic estrogen DES, which was prescribed from the 1940s until the 1970s to prevent miscarriages. Children exposed to DES in utero developed abnormalities and cancer of the reproductive tract, whereas these effects were not found in their mothers (Herbst et al. 1971; McLachlan et al. 1975). Structural similarities between DES and BPA are evident, and it has been suggested that prenatal exposure to BPA may cause abnormalities similar to those elicited by DES (vom Saal et al. 1998). Experiments examining the estrogenic effects of BPA on embryos have led to contradictory findings. Although some studies have reported prostate enlargement in offspring of BPA-exposed mice (Howdeshell et al. 1999), others reported no effect (Ashby et al. 1999; Cagen et al. 1999; Nagao et al. 2002; Welshons et al. 1999). Levels of BPA in amniotic fluid amniotic fluid
n.
The fluid within the amnion that surrounds the fetus and protects it from injury.


Amniotic fluid
The liquid that surrounds the baby within the amniotic sac.
 at 15-18 weeks of gestation have been shown to be 5-fold higher than serum levels in both pregnant and nonpregnant women, suggesting a possible accumulation of BPA in the early embryo (Ikezuki et al. 2002), although Domoradzki et al. (2003) could not confirm this in animal experiments. Unfortunately, there is no model in which estrogen effects can be determined directly in embryos.

We have developed an approach, using transgenic reporter mice, that allows us to determine direct activation of estrogen receptor (ER) signaling in embryos. For this, we used our recently established transgenic mice model (Lemmen et al. 2004); direct activation of ERs is detected photometrically pho·tom·e·try  
n.
Measurement of the properties of light, especially luminous intensity.



photo·met
 by measuring luciferase activity, allowing both quantitative and time-course analysis of estrogen target gene activation in vivo. Other estrogen reporter mice that have been generated do not exclude estrogen-response-element (ERE)-independent activation because of the presence of other promoter sequences (Ciana et al. 2001; Nagel et al. 2001; Toda et al. 2004). In our model, activation of the construct via promoter sites other than the EREs is avoided by using only a minimal TATA box TATA box

a eukaryotic DNA sequence usually TATAAATA, similar to the Pribnow box of Escherichia coli, occurring in the promoter region 25 to 35 bases upstream from the transcriptional start site that binds the general transcription factor TFIID which begins the formation of
 in the construct, resulting in low background activity. Although in natural promoters ERE sequences are often found together with other enhancer sequences and other ways of ER transactivation (e.g., via AP1 sites) are possible, we chose a reductionistic approach, with only ERE sequences in the synthetic promoter used. In the present study, we used this model to examine the ability of BPA--in comparison with known strong estrogens DES and 17[beta]-estradiol dipropionate (EP)--to activate endogenous ERs present in mouse embryos (Lemmen et al. 1999). Surprisingly, we found BPA to be more potent in activating embryonic ERs than would be expected on the basis of its in vitro activity.

Materials and Methods

Transgenic animals. We used transgenic animals carrying a reporter construct that consists of three estrogen-responsive elements (GAGCTTAGGTCACTGTGACCT) upstream of a minimal human E1B TATA promoter sequence (GGGTATATAAT) coupled to luciferase surrounded by chicken [beta]-globin insulator (Chung et al. 1993) sequences (Lemmen et al. 2004). To obtain transgenic embryos, heterozygote heterozygote (hĕt'ərōzī`gōt): see genetics.  transgenic males from line INS INS
abbr.
1. Immigration and Naturalization Service

2. International News Service

Noun 1. INS
3 were mated with wild-type females ([F.sub.1] from C57B1/6J x CBA See Capital Builder Account. ). Heterozygote males were used so that every litter would also contain wild type embryos, which could serve as an internal negative control. Females were checked daily for the presence of a vaginal plug, and when a plug was detected, that day was designated 0.5 day postcoitum (dpc).

Compounds and exposures. [E.sub.2], EP, DES, and BPA were all purchased from Sigma-Aldrich (Roosendaal, The Netherlands). For injections, compounds were dissolved in corn oil (Sigma-Aldrich) at a concentration of 10 mg/mL and then diluted in 1:10 steps in corn oil to the required doses (DES, 10-1,000 [micro]/kg; EP, 10-10,000 [micro]g/kg; BPA, 10-10,000 [micro]g/kg). Compounds or vehicle were injected intraperitoneally in 13.5 dpc pregnant animals. Animal experiments were performed with approval of the Netherlands Academy of Arts and Sciences Animal Ethics Committee ethics committee A multidisciplinary hospital body composed of a broad spectrum of personnel–eg, physicians, nurses, social workers, priests, and others, which addresses the moral and ethical issues within the hospital. See DNR, Institutional review board. . The IVIS IVIS International Veterinary Information Service
IVIS Interactive Video Information System
IVIS Intervehicular Information System
IVIS Inter-Vehicular Information System
IVIS Integrated Vehicular Information System
IVIS in Vehicle Information System
 imaging experiments were done with additional approval of the Animal Ethics Committee of NV Organon or·ga·non or or·ga·num
n. pl. or·ga·nons or or·ga·nums or or·ga·na
1. An organ.

2. A set of principles for use in scientific investigation.



organon

pl. organa [Gr.] organ.
.

In vivo luciferase measurement. With the Xenogen IVIS imaging system (Xenogen, Alameda, CA, USA), luciferase activity was monitored in living animals 0, 2, 4, 8, and 24 hr after compound injection. Animals were injected subcutaneously with luciferin luciferin
(loosif´rin),
n a chemical substance present in certain luminous organisms that, when acted upon by the enzyme luciferase, produces a glow called
 (150 [micro]L, 30 mg/mL). After 15 min, the animals were placed in a dark imaging chamber under isoflurane anesthesia. Resulting photon emission from the luciferin/luciferase reaction was detected with a CCD CCD
 in full charge-coupled device

Semiconductor device in which the individual semiconductor components are connected so that the electrical charge at the output of one device provides the input to the next device.
 (charge-coupled device) camera. The photon image obtained was superimposed su·per·im·pose  
tr.v. su·per·im·posed, su·per·im·pos·ing, su·per·im·pos·es
1. To lay or place (something) on or over something else.

2.
 on a normal video image of the mouse with Living Image software (Xenogen). We used IGOR Igor, d. 945, duke of Kiev
Igor (ē`gôr, Russ. ē`gər) or Ihor (ē`khər), d. 945, duke of Kiev (912–45), successor of Oleg as ruler of Kievan Rus.
 software (WaveMetrics Corp., Lake Oswego, OR, USA) to quantify the photon signal over the area encompassing the embryos. For all pregnant animals, this area was kept of equal size.

Luciferase measurement lysates. Embryos were isolated either at 8 or 24 hr after compound injection and frozen at -80[degrees]C. When embryos were isolated from the amniotic membranes, we kept tails separated and stored at -20[degrees]C for subsequent DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 isolation and polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is  for presence of the transgene transgene

a gene that has been incorporated into the genome of another organism.
, as described previously (Legler et al. 2000). Only transgenic embryos were used for further luciferase measurement. Subsequently, embryos were thawed on ice and lysis buffer [1% (vol/vol) Triton X-100, 2.5 x [10.sup.-2] M glycylglycine, 1.5 x [10.sup.-2] M MgS[O.sub.4], 4 x [10.sup.-3] M EGTA EGTA egtazic acid; a chelator similar in structure and function to EDTA (ethylenediaminetetraacetic acid) but with a higher affinity for calcium than for magnesium. , and 1 x [10.sup.-3] M dithiothreitol (DTT DTT Deloitte Touche Tohmatsu (Deloitte & Touch Global Operations)
DTT Dithiothreitol (cytology reagent)
DTT Digital Terrestrial Television
DTT Discrete Trial Training
)] was added. Next, samples were sonicated, the lysate ly·sate
n.
The cellular debris and fluid produced by lysis.
 centrifuged, and the supernatant supernatant /su·per·na·tant/ (-na´tant) the liquid lying above a layer of precipitated insoluble material.

supernatant

the liquid lying above a layer of precipitated insoluble material.
 collected. Samples (25 [micro]L in duplicate) were analyzed for luciferase enzyme activity Enzyme activity
A measure of the ability of an enzyme to catalyze a specific reaction.

Mentioned in: Glucose-6-Phosphate Dehydrogenase Deficiency
 in a luminometer (LUMAC/3M BV, Schaesberg, The Netherlands) with injection of 100 [micro]L luciferin substrate as previously described (Lemmen et al. 2004). Luciferase activity was corrected for protein content as measured with the Bradford assay.

In vitro estrogenic activity assay in stable cell lines. Stable 239HEK cell lines containing human ER-[alpha] (hER-[alpha]) or hER-[beta] and an estrogen-responsive reporter construct--similar to the one introduced in the transgenic animals, but without the flanking insulator sequences--were used and cultured as previously described (Lemmen et al. 2002). Briefly, cells were plated in 96-well tissue culture plates (NUNC, Life Technologies, Breda, The Netherlands) in medium consisting of phenol phenol (fē`nōl), C6H5OH, a colorless, crystalline solid that melts at about 41°C;, boils at 182°C;, and is soluble in ethanol and ether and somewhat soluble in water.  red-free Dulbecco's modified Eagle's medium/F12 (1:1) medium containing 3 x [10.sup.-8] M selenite sel·e·nite  
n.
Gypsum in the form of colorless clear crystals.



[Latin seln
, 10 [micro]g/mL transferrin transferrin /trans·fer·rin/ (-fer´in) a glycoprotein mainly produced in the liver, binding and transporting iron, closely related to the apoferritin of the intestinal mucosa.

trans·fer·rin
n.
, 0.2% (wt/vol) bovine serum albumin serum albumin
n.
See seralbumin.
, and 5% (wt/vol) dextran-coated charcoal-stripped fetal calf serum. After 24 hr, medium was refreshed and after another 24 hr, the medium was removed and fresh medium containing test compounds (dissolved in ethanol) was added. After 24 hr of incubation, the medium was removed and 50 [micro]L lysis lysis /ly·sis/ (li´sis)
1. destruction or decomposition, as of a cell or other substance, under influence of a specific agent.

2. mobilization of an organ by division of restraining adhesions.

3.
 solution [1% (vol/vol) Triton X-100, 2.5 x [10.sup.-2] M glycylglycine, 1.5 x [10.sup.-2] M magnesium sulfate magnesium sulfate
n.
A colorless crystalline compound used as a cathartic and applied locally as an anti-inflammatory agent.


magnesium sulfate Warning - High-alert drug! 
, 4 x 10-3 M EGTA, and 1 x [10.sup.-3] M DTT] was added directly to the cells. Luciferase activity of 25 [micro]L cell lysate was measured with the Luclite Luciferase Reporter gene assay kit (Perkin-Elmer, Brussels, Belgium) according to the manufacturer's instructions using 25 [micro]L Luclite solution on a Topcount liquid scintillation scintillation /scin·til·la·tion/ (sin?ti-la´shun)
1. an emission of sparks.

2. a subjective visual sensation, as of seeing sparks.

3.
 counter (Perkin-Elmer).

Data analysis and statistics. We considered one litter as a statistical unit rather than one embryo because we assumed that all embryos in one litter were subject to the same variation of the compound injection and placental transfer. Therefore, the average [+ or -] SEM per litter was calculated, and these were then averaged to express the luciferase activity per group. All data were log-transformed and tested for normality with the Shapiro-Wilks test using SPSS A statistical package from SPSS, Inc., Chicago (www.spss.com) that runs on PCs, most mainframes and minis and is used extensively in marketing research. It provides over 50 statistical processes, including regression analysis, correlation and analysis of variance.  12.0 (SPSS, Chicago, IL, USA). The data were not normally distributed; therefore, we determined significant differences of treatment groups from oil-exposed control using Kruskal-Wallis analysis followed by the Dunn's posttest post·test  
n.
A test given after a lesson or a period of instruction to determine what the students have learned.
 using GraphPad Prism 3.02 (GraphPad Software Inc., San Diego, CA, USA). In addition, the presence of a linear trend in the dose response was determined by analysis of variance followed by a posttest for linear trends using GraphPad Prism 3.02. For the IVIS time-course experiments, we performed a Friedman test Friedman test

a modification of the aschheim-zondek test for pregnancy in the mare based on the use of a rabbit instead of mice. Little used because of the cost of the rabbit.
 followed by Dunn's posttest using GraphPad Prism 3.02.

The in vitro dose-response activation curves obtained with the stable cell lines were fitted using the sigmoidal sig·moid   also sig·moi·dal
adj.
1. Having the shape of the letter S.

2. Of or relating to the sigmoid colon.



[Greek s
 fit {y = [a.sub.0] + [a.sub.1]/1 + exp[-(x- [a.sub.2])/[a.sub.3]]} in Slidewrite Plus for Windows (version 3.0; BIS, Ridderkerk, The Netherlands), which determines the fitting coefficients by an iterative process minimizing the c2 merit function (least squares criterion). The E[C.sub.50] (median effective concentration) values were calculated by determining the concentration by which 50% of maximum activity was reached using the sigmoidal fit equation. The cell line data shown are the average of at least two independent experiments with each experimental point performed in triplicate. Data are shown as a percentage of maximal induction by [E.sub.2].

Results

Estrogens activate endogenous ERs in transgenic embryos. To be able to measure luciferase activity in the transgenic embryos with the IVIS system, it was crucial that wild-type mothers carry the transgenic embryos. If transgenic mothers had been used, strong photon emission would have been generated after the estrogen and luciferin injections, masking the signal emitted from embryos. We chose 13.5-14.5 dpc as the time for exposure because at this time point ERs are expressed in the embryo (Lemmen et al. 1999) and because this is a sensitive time point for disruption of reproductive organs Reproductive organs
The group of organs (including the testes, ovaries, and uterus) whose purpose is to produce a new individual and continue the species.

Mentioned in: Choriocarcinoma
 by prenatal estrogen exposure. In nonexposed embryos, we detected no luciferase activity with IVIS and barely any luciferase activity in embryo lysates.

In utero luciferase activity in transgenic embryos was induced dose dependently by DES and EP. When measured 8 hr after exposure, 100 and 1,000 [micro]g/kg DES significantly induced luciferase activity when assessed with the IVIS system (Figure 1) and in embryo lysates ex viva measured in the luminometer (Figure 2). No plateau levels in luciferase activity were reached, and the profile of induction after DES exposure DES Exposure Definition

DES (diethylstilbestrol) is a hormone that was prescribed for pregnant women in the 1950s and early 1960s. Many years later, doctors discovered that the daughters of the women who received DES were at high risk for a variety of
 was similar for both methods used to assess luciferase activity. For EP only, the 10,000 [micro]g/kg dose was able to significantly induce luciferase activity when measured with MS after 8 hr (Figure 1). When measured ex vivo ex vivo /ex vi·vo/ (eks´ ve´vo) outside the living body; denoting removal of an organ (e.g., the kidney) for reparative surgery, after which it is returned to the original site.  in embryo lysates, 1,000 [micro]g/kg EP already significantly induced luciferase activity (Figure 2). Fold induction of luciferase activity of estrogen exposed over controls 8 hr after exposure was, however, lower using IVIS compared with measurements in lysates. For DES doses of 100 and 1,000 [micro]g/kg, induction was 5-fold and 14-fold greater, respectively, when measured with the IVIS system, whereas it was 41-fold and 51-fold greater, respectively, when measured ex vivo on embryo lysates. However, these differences in induction are likely based on a difference in noise rather than in signal. Also, for EP inductions were larger when measured ex vivo than when measured with IVIS (data not shown).

[FIGURES 1-2 OMITTED]

An important advantage of using the MS system is that the luciferase induction can be followed in time in a single animal, making it a very useful tool for obtaining information on the kinetics of tissue distribution and gene activation by compounds. With the IVIS measurements, we observed a difference between DES and EP in the kinetics of inducing luciferase activity (Figure 3). DES (1,000 [micro]g/kg) significantly induced luciferase activity, exceeding levels in oil-exposed animals 2 hr after exposure, and this activity peaked 8 hr after exposure (Figure 3). In contrast, only 8 hr after EP exposure (10,000 [micro]g/kg), luciferase activity was significantly above levels in oil-exposed animals, with a peak at 24 hr after exposure (Figure 3). This difference in kinetics thus complicates comparing relative potencies of these estrogens to induce luciferase activity. At 24 hr after estrogen exposure, the embryos were isolated and luciferase activity was measured ex vivo, showing that 100 and 1,000 [micro]g/kg DES and 1,000 and 10,000 [micro]g/kg EP were able to significantly induce luciferase activity compared with oil-exposed controls (Figure 2).

[FIGURE 3 OMITTED]

BPA activates ERs in transgenic embryos. Eight hours after exposure to 10,000 [micro]g/kg BPA, luciferase activity was higher than in oil-exposed animals when measured with IVIS (Figure 4), although this was not statistically significant. To be able to visualize the weak BPA signal, the scale bar of the superimposed video image had to be adjusted compared with Figures 1 and 3. When lysates from embryos sacrificed 24 hr after exposure were measured, no difference between oil- and BPA-exposed animals was found (Figure 2). Because BPA, like DES, may enter the fetal circulation fetal circulation Embryology Prenatal circulation which bypasses the lung and right heart, and is returned to the systemic circulation at the aorta via a patent ductus arteriosus, which usually closes at or shortly after birth, after which the blood flows to the lungs  rapidly (Miyakoda et al. 1999; Takahashi and Oishi 2000), other embryos were isolated 8 hr after exposure to 100 and 1,000 [micro]g/kg BPA, EP, and DES or oil. At this time point, luciferase activity was significantly higher after exposure to 1,000 and 10,000 [micro]g/kg BPA compared with oil-exposed animals (Figure 2). Therefore, at least at early time points, BPA is able to transactivate trans·ac·ti·vate  
tr.v. trans·ac·ti·vat·ed, trans·ac·ti·vat·ing, trans·ac·ti·vates
To stimulate (a host cell) to replicate the genetic components of a virus. Used of a viral protein.
 the embryonic ERs and resembles DES rather than EP in its kinetics of luciferase activation.

[FIGURE 4 OMITTED]

In vitro potency of estrogens and BPA. The compounds used for the exposure experiments of transgenic animals were also tested in an in vitro assay to separately assess their potency to activate ER-[alpha] or ER-[beta] using a similar reporter gene as used in the transgenic animals, only without the flanking insulator sequences (Figure 5). All three compounds activated hER-[alpha] and hER-[beta] in vitro. The E[C.sub.50] values for ER-[alpha] were 3.9 x [10.sup.-11] M, 8.5 x [10.sup.-12] M, and 1.6 x [10.sup.-7] M for DES, EP, and BPA, respectively. ECs0 values for ER-[beta] were 3.9 x [10.sup.-11] M, 8.5 x [10.sup.-12] M, and 1.6 x [10.sup.-7] M for DES, EP, and BPA, respectively. In these experiments, BPA was found to be 5,000 times less active than DES in activating ER-[alpha] and 1,400 times less active than DES toward ER-[beta] transactivation. EP was 4.6 times more potent than DES in activating hER-[alpha] and just as potent as DES in activating hER-[beta]. These results confirm the reported weak estrogenicity of BPA in vitro.

[FIGURE 5 OMITTED]

Discussion

We successfully applied our new sensitive estrogen reporter mice to assess the ability of DES, EP, and BPA to activate ER signaling in embryos. In the present study, BPA exposure of pregnant mice induced the estrogen reporter through activation of endogenous ERs in mouse embryos. Hence, the generated in vivo model was successful in detecting estrogenic activity of a suspected environmental estrogen in embryos exposed in utero. In addition, our results show that in utero activation of ERs by BPA, at early time points after exposure, requires much lower doses than extrapolations from in vitro measurements would predict.

Because barely any luciferase activity could be measured in nonexposed embryos, we concluded that either there are no active endogenous estrogens during the life stage tested (13-14.5 dpc), or that our model is not sufficiently sensitive to detect their presence. Very low levels of estrogens have been described to be present in steroid extracts of mouse embryo homogenates as determined in estrogenic activity measurements (Lemmen et al. 2002). These levels may, however, be too low to activate endogenous ERs or are not able to activate ERs in vivo because of such different factors as tissue distribution and inactivation inactivation /in·ac·ti·va·tion/ (in-ak?ti-va´shun) the destruction of biological activity, as of a virus, by the action of heat or other agent.  through binding proteins. It is possible that measurements of luciferase activity on dissected organs from embryos would prevent dilution of the luciferase signal below the detection limit. The low sensitivity of our model is also apparent in the high doses of DES and EP needed to be able to show a significant luciferase induction (Figures 1 and 2).

From measurements taken after mice pregnant with transgenic embryos were exposed to DES and EP, it was possible to evaluate the ability of the in vivo model to detect well-known estrogens in embryos exposed in utero. Exposure to DES showed a dose- and time-dependent induction of luciferase activity. The kinetic data obtained with the IVIS system showed that for all DES doses peak activity occurred at 8 hr after exposure. Previous studies using [sup.14]C-DES have shown that upon injection of pregnant mice, fetal plasma levels reach a peak after 2 hr and then disappear slowly (McLachlan 1977). The time difference in induction of maximal luciferase activity (i.e., after 8 hr) compared with an expected earlier DES peak in fetal plasma (i.e., after 2 hr) may be additionally due to the time required for transcription and translation of luciferase. Comparing DES with EP, it is evident that EP also shows a dose-dependent increase in luciferase activity. However, the EP-induced peak of luciferase activity was not seen before 24 hr after exposure. The observed time course of EP-induced luciferase activation could be due to a slow transfer to the embryos of EP itself or a relatively slow uptake by target tissues. Because no data are available on the kinetics of placental transfer of EP, only data on placental transfer of [E.sub.2] can be used for comparison. In rhesus monkeys, placental transfer of [sup.14]C-DES and [sup.14]C-[E.sub.2] was similar (Hill et al. 1980]. Similar to embryos, exposure of adult transgenic animals to EP induced peak activation of luciferase at 24 hr after exposure (Lemmen et al. 2004), suggesting that a difference in placental transfer is unlikely to explain the delay in activation of luciferase by EP compared with DES. Another explanation for the difference observed between EP and DES exposure in peak luciferase activity could be that EP is initially bound to binding proteins in the serum and uptake by the embryonal target tissues is therefore slower compared with DES, which has much lower affinity to binding proteins (Arnold et al. 1996; Simmons et al. 1994). However, when [E.sub.2] was tested in adult animals (Lemmen et al. 2004), it did show a peak in luciferase activity at 8 hr rather than at 24 hr; because [E.sub.2] is bound to binding proteins as is EP, this suggests that the time needed for removal of the propionate propionate /pro·pi·o·nate/ (pro´pe-o-nat) any salt of propionic acid.

pro·pi·o·nate
n.
A salt or ester of propionic acid.



propionate

any salt of propionic acid.
 groups could explain the difference in kinetics between EP and DES.

In pregnant rats, BPA has been shown to enter the fetal circulation with a peak concentration after 15-20 min (Takahashi and Oishi 2000). When exposing pregnant mice to 100 mg/kg BPA given subcutaneously, BPA was detected 30 min after exposure in fetal sera, liver, brain uterus, and testes testes
 or testicles

Male reproductive organs (see reproductive system). Humans have two oval-shaped testes 1.5–2 in. (4–5 cm) long that produce sperm and androgens (mainly testosterone), contained in a sac (scrotum) behind the penis.
 (Domoradzki et al. 2003; Shin et al. 2002; Uchida et al. 2002). In the present study, BPA was found to significantly induce luciferase activity at doses of 1,000 and 10,000 [micro]g/kg 8 hr after exposure. The kinetics of luciferase induction by BPA, measured with the IVIS system, resemble the profile of DES. Although the molecular structure of BPA and DES is similar, it remains unknown whether this contributes to the similarity in their kinetics in inducing luciferase activity. Testing more estrogenic compounds with various structures could shed light on this question.

Like DES, BPA showed a transient induction of luciferase activity in embryos; thus, estrogenic potency of BPA is compared with DES rather than with EP. In utero luciferase activation by BPA in transgenic embryos at 8 hr after exposure was significant from oil-exposed controls with 1 mg/kg BPA. Likewise, Nagel et al. (2001) found a significant increase in ER transcriptional activity in the adult uterus after exposure to 1 mg/kg BPA, whereas this dose did not induce a uterine wet weight response. DES was significantly different from oil-exposed controls at a dose of 100 [micro]g/kg (only 10 times less than BPA), which suggests a high in vivo estrogenic potency of BPA. It should be noted that doses of 1 and 10 [micro]g/kg DES induce almost a similar transcriptional activation (Figure 2), and the activation is approximately 20% of maximal activity induced by DES. In vitro, BPA was three to four orders of magnitude less active than DES, consistent with previous reports (Andersen et al. 1999; Kim et al. 2001; Kuiper et al. 1998). Thus, in our hands the relative potency of BPA seems to be higher in utero than in vitro on ER-[alpha], which is the most abundantly expressed ER during embryogenesis Embryogenesis

The formation of an embryo from a fertilized ovum, or zygote. Development begins when the zygote, originating from the fusion of male and female gametes, enters a period of cellular proliferation, or cleavage.
 (Lemmen et al. 1999). We believe this difference is not due to the use of human ERs in vitro versus the endogenous mouse ERs in utero. It has been shown that human and mouse ER-[alpha] have the same affinity for DES and BPA (Matthews et al. 2000), and this is likely to be the case for ER-[beta] as well. One explanation for a higher estrogenic potency of BPA in utero versus in vitro could be that in vivo BPA is converted to metabolites Metabolites
Substances produced by metabolism or by a metabolic process.

Mentioned in: Interactions
 with enhanced estrogenicity (Ben-Jonathan and Steinmetz 1998; Yoshihara et al. 2004), although others have shown that BPA is mainly metabolized to a less active Metabolite active metabolite Therapeutics A drug metabolite with therapeutic activity similar to the parent compound, which must be considered in therapeutic pharmacokinetics  BPA monoglucuronide (Domoradzki et al. 2003; Pottenger et al. 2000). Another explanation could be that BPA has a lower affinity for the steroid-binding proteins present in serum, giving it a higher bioavailability bioavailability /bio·avail·a·bil·i·ty/ (bi?o-ah-val?ah-bil´i-te) the degree to which a drug or other substance becomes available to the target tissue after administration.

bi·o·a·vail·a·bil·i·ty
n.
 than EP, a factor that is not taken into account in the in vitro assay. However, we feel this cannot explain the in vivo versus in vitro potency difference as we compare BPA with DES, and DES does not have a high affinity for binding proteins.

Strain differences in sensitivity to estrogens have been reported. The strain used in this study, C57B1/6J (B6), has been shown to be more sensitive than CD-1 mice with respect to reduction of testis testis (tĕs`tĭs) or testicle (tĕs`tĭkəl), one of a pair of glands that produce the male reproductive cells, or sperm.  weight after estrogen exposure (Spearow et al. 1999). Also, for other end points of estrogen exposure, the B6 strain has been shown to be a sensitive strain (Roper et al. 1999; Spearow et al. 2001). In CFLP CFLP California Foreign Language Project (Stanford University School of Education; Stanford, CA)
CFLP China Federation of Logistics and Purchasing
CFLP Cleavase Fragment Length Polymorphism
 mice, 0.5 mg/mouse (~ 16.7 mg/kg) BPA was reported to be inactive in the uterine wet weight assay, whereas the other dose tested (5 mg/mouse, ~ 167 mg/kg) was toxic (Coldham et al. 1997). In CD-1 mice, a uterotrophic response was induced by 100 mg/kg BPA (Markey et al. 2001), whereas in B6C3F C3F Commander Third Fleet 1 mice, doses between 0.8 and 8 mg/kg could induce uterine wet weight increase (Papaconstantinou et al. 2000). In the present study, a significant induction of luciferase activity in utero was detected after administration of 1 mg/kg BPA to pregnant females. The use of nontransgenic mother animals with a pure B6 background rather than the B6/CBA cross used could further increase the sensitivity of the present model.

In conclusion, we have shown that the mouse model presented here can be used to detect activation of ERs by maternally applied BPA and that other estrogens can be detected in living embryos in utero. BPA was more potent than would be estimated from in vitro assays, although its intrinsic activity is still lower than that of DES and EP. On the other hand, effects on individual embryonic organs might be larger and could be underestimated because we measured total embryo lysates. When considering that nanomolar levels of BPA have been measured in human serum (Takeuchi and Tsutsumi 2002), human amniotic fluid at 15-18 weeks of gestation (Ikezuki et al. 2002), and surface water (Fromme et al. 2003), concern about BPA exposure during embryonic/fetal life seems to be justified. It should be noted, however, that in our model the BPA effect had a more transient nature than did that of the other hormones. If and how this will translate to a biological effect in the exposed embryos should be the target of further investigations using other approaches.

REFERENCES

Andersen HR, Andersson AM, Arnold SF, Autrup H, Barfoed M, Beresford NA, et al. 1999. Comparison of short-term estrogenicity tests for identification of hormone-disrupting chemicals. Environ Health Perspect 107(suppl 1):89-108.

Arnold SF, Collins BM, Robinson MK, Guillette LJJ, McLachlan JA. 1996. Differential interaction of natural and synthetic estrogens with extracellular binding proteins in a yeast estrogen screen. Steroids 61:642-646.

Ashby J, Tinwell H. 1998. Uterotrophic activity of bisphenol A in the immature rat. Environ Health Perspect 106:719-720.

Ashby J, Tinwell H, Haseman J. 1998. Lack of effects for low dose levels of bisphenol A and diethylstilbestrol on the prostate gland of CF1 mice exposed in utero. Regul Toxicol Pharmacol 30:156-166.

Ben-Jonathan N, Steinmetz R: 1998. Xenoestrogens: the emerging story of bisphenol A. Trends Endocrinol Metab 9:124-128.

Bigsby R, Chapin RE, Daston GP, Davis BJ, Gorski J, Gray LE, et al. 1999. Evaluating the effects of endocrine disruptors on endocrine function during development. Environ Health Perspect 107(suppl 4):613-618.

Cagen SZ, Waechter JMJ JMJ Jam Master Jay (rap artist)
JMJ Jornada Mundial de la Juventud
JMJ Jean Michel Jarre (musician)
JMJ Jesus-Mary-Joseph
, Dimond SS, Breslin WJ, Butala JH, Jekat FW, et al. 1999. Normal reproductive organ development in CF-1 mice following prenatal exposure to bisphenol A. Toxicol Sci 50:36-44.

Chung JH, Whiteley M, Felsenfeld G. 1993. A 5' element of the chicken beta-globin domain serves as an insulator in human erythroid erythroid /er·y·throid/ (er´i-throid)
1. of a red color; reddish.

2. pertaining to the cells of the erythrocytic series.


er·y·throid
adj.
1.
 cells and protects against position effect in Drosophila Drosophila: see fruit fly.
drosophila

Any member of about 1,000 species in the dipteran genus Drosophila, commonly known as fruit flies but also called vinegar flies. Some species, particularly D.
. Cell 74:505-514.

Ciana P, Di Luccio G, Belcredito S, Pollio G, Vegeto E, Tatangelo L, et al. 2001. Engineering of a mouse for the in vivo profiling of estrogen receptor activity. Mol Endocrinol 15:1104-1113.

Coldham NG, Dave M, Sivapathasundaram S, McDonnell DP, Connor C, Sauer MJ. 1997. Evaluation of a recombinant yeast cell estrogen screening assay. Environ Health Perspect 106:734-742.

Dencker L, Eriksson P. 1998. Susceptibility in utero and upon neonatal exposure. Food Addit Contam 15(suppl):37-43.

Domoradzki JY, Pottenger LH, Thornton CM, Hansen SC, Card TL, Markham DA, et al. 2003. Metabolism and pharmacokinetics of bisphenol A (BPA) and the embryo-fetal distribution of BPA and BPA-monoglucuronide in CD Sprague-Dawley rats at three gestational stages. Toxicol Sci 76:21-34.

Feldman D. 1997.Estrogens from plastic--are we being exposed? Endocrinology 138:1777-1779.

Fromme H, Kuchler T, Otto T, Pilz K, Muller J, Wenzel A. 2003. Occurrence of phthalates Phthalates, or phthalate esters, are a group of chemical compounds that are mainly used as plasticizers (substances added to plastics to increase their flexibility). They are chiefly used to turn polyvinyl chloride from a hard plastic into a flexible plastic.  and bisphenol A and F in the environment. Water Res 36:1429-1438.

Gould JC, Leonard LS, Maness SC, Wagner BL, Conner K, Zacharewski T, et al. 1998. Bisphenol A interacts with the estrogen receptor alpha in a distinct manner from estradiol. Mol Cell Endocrinol 142:203-214.

Herbst AL, Ulfeider H, Poskanzer DC. 1971. Adenocarcinoma adenocarcinoma: see neoplasm.  of the vagina. Association of maternal stilbestrol stil·bes·trol
n.
DES.



stilbestrol

a synthetic estrogen used in the treatment of female animals for infertility and bitches for urinary incontinence.
 therapy with tumor appearance in young women. N Engl J Med 284:878-881.

Hill DE, Slikker WJ, Helton ED, Lipe GW, Newport GD, Sziszak TJ, et al. 1980. Transplacental transplacental /trans·pla·cen·tal/ (-plah-sen´tal) through the placenta.

trans·pla·cen·tal
adj.
Relating to or involving passage through or across the placenta.
 pharmacokinetics and metabolism of diethylstilbestrol and 17beta-estradiol in the pregnant rhesus monkey. J Clin Endocrinol Metab 50:811-818.

Howdeshell KL, Hotchkiss AK, Thayer KA, Vandenbergh JG, vom Saal FS. 1999. Exposure to bisphenol A advances puberty. Nature 401:763-764.

Hunt PA, Koehler KE, Susiarjo M, Hodges CA, Ilagan A, Voigt RC, et al. 2003. Bisphenol A exposure causes meiotic aneuploidy in the female mouse. Curr Biol i3:546-553.

Ikezuki Y, Tsutsumi O, Takai Y, Kamei Y, Taketani Y. 2002. Determination of bisphenol A concentrations in human biological fluids reveals significant early prenatal exposure. Hum Reprod 17:2839-2841.

Kim HS, Han SY, Yoo SD, Lee BM, Park KL. 2001. Potential estrogenic affects of bisphenol-A estimated by in vitro and in vivo combination assays. J Toxicol Sci 26:111-118.

Kuiper GG, Lemmen JG, Carlsson B, Corton JC, Safe SH, van der Saag PT, et al. 1998. Interaction of estrogenic chemicals and phytoestrogens Phytoestrogens
Compounds found in plants that can mimic the effects of estrogen in the body.

Mentioned in: Premenstrual Syndrome

phytoestrogens,
n.pl plant-derived estrogen analogs.
 with estrogen receptor beta. Endocrinology 139:4262-4263.

Legler J, Broekhof JLM JLM Jesus Loves Me
JLM Just Like Me
JLM Junior League of Memphis
JLM Junior League of Minneapolis
JLM Junior League of Mobile
JLM Junior League of Madison
JLM Junior League of Montgomery
JLM Junior League of Miami, Inc.
JLM Junior League of McAllen, Inc.
, Brouwer A, Lanser PH, Murk murk also mirk  
n.
Partial or total darkness; gloom.

adj. Archaic
Partially or totally dark; gloomy.



[Middle English mirke, from Old Norse myrkr
 AJ, van der Saag PT, et al. 2000. A novel in vivo bioassay Bioassay

A method for the quantitation of the effects on a biological system by its exposure to a substance, as well as the quantitation of the concentration of a substance by some observable effect on a biological system.
 for (xeno-)estrogens using transgenic zebrafish. Environ Sci Technol 34:4439-4444.

Lemmen JG, Arends RJ, van Boxtel AL, van der Saag PT, van der Burg B. 2004 Tissue- and time-dependent estrogen receptor activation in estrogen reporter mice. J Mol Endocrinol 32:689-701.

Lemmen JG, Broekhof JL, Kuiper GG, Gustafsson JA, van der Saag PT, van der Burg B. 1999. Expression of estrogen receptor alpha and beta during mouse embryogenesis. Mech Dev 81:163-167.

Lemmen JG, van den Brink CE, Legler J, van der Saag PT, van der Burg B. 2002. Detection of oestrogenic oestrogenic (ōˈ·es·tr  activity of steroids present during mammalian gestation using Er[alpha] and ER[beta] specific in vitro assays. J Endocrinol 174:435-446.

Long X, Steinmetz R, Ben-Jonathan N, Caperell-Grant A, Young PC, Nephew KP, et al. 2000. Strain differences in vaginal responses to the xenoestrogen bisphenol A. Environ Health Perspect 108:243-247.

Markey CM, Michaelson CL, Veson EC, Sonnenschein C, Soto AM. 2001. The mouse uterotrophic assay: a reevaluation of its validity in assessing the estrogenicity of bisphenol A. Environ Health Perspect 109:55-60.

Matthews J, Celius T, Halgren R, Zacharewski T. 2000. Differential estrogen receptor binding of estrogenic substances: a species comparison. J Steroid Biochem Mol Biol 74:223-234.

McLachlan JA. 1977. Prenatal exposure to diethylstilbestrol in mice: toxicological studies. J Toxicol Environ Health 2:527-537.

McLachlan JA. 2001. Environmental signaling: what embryos and evolution teach us about endocrine disrupting chemicals, Endocr Rev 22:319-341.

McLachlan JA, Newbold RR, Bullock B. 1975. Reproductive tract lesions in male mice exposed prenatally to diethylstilbestrol. Science 190:991-992.

Mehmood Z, Smith AG, Tucker M J, Chuzel F, Carmichael NG. 2000. The development of methods for assessing the in vivo oestrogen-like effects of xenobiotics in CD-1 mice. Food Chem Toxicol 38:493-501.

Miller BK. 1983. Perinatal toxicology: its recognition and fundamentals. Am J Ind Med 4:205-244.

Miller WR, Sharpe RM. 1998. Environmental oestrogens and human reproductive cancers. Endocr Relat Cancer 5:69-96.

Milligan SR, Balasubramanian AV, Kalita JC. 1998. Relative potency of xenobiotic xen·o·bi·ot·ic
adj.
Foreign to the body or to living organisms. Used of chemical compounds.

n.
A xenobiotic chemical.



xenobiotic

any substance, harmful or not, that is foreign to the animal's biological system.
 estrogens in an acute in vivo mammalian assay. Environ Health Perspect 106:23-26.

Miyakoda H, Tabata M, Onodera S, Takeda K. 1999. Passage of bisphenol A into the fetus of the pregnant rat. J Health Sci 45:318-323.

Nagao T, Saito Y, Usumi K, Yoshimura S, Ono H. 2002. Low-dose bisphenol A does not affect reproductive organs in estrogen-sensitive C57BL/6N mice exposed at the sexually mature, juvenile, or embryonic stage. Reprod Toxicol 16:123-130.

Nagel SC, Hagelbarger JL, McDonnell DP. 2001. Development of an ER action indicator mouse for the study of estrogens, selective ER modulators (SERMs), and xenobiotics. Endocrinology 142:4721-4728.

Papaconstantinou AD, Umbreit TH, Fisher BR, Goering PL, Lappas NT, Brown KM. 2000. Bisphenol A-induced increase in uterine weight and alterations in uterine morphology in ovariectomized B6C3F1 mice: role of the estrogen receptor. Toxicol Sci 56:332-339.

Perez P, Pulgar R, Olea-Serrano F, Villalobos M, Rivas A, Metzler M, et al. 1998. The estrogenicity of bisphenol A-related diphenylalkanes with various substituents at the central carbon and the hydroxy hy·drox·y  
adj.
Containing the hydroxyl group.



[From hydroxyl.]


hydroxy  

Containing the hydroxyl group (OH).

Adj. 1.
 groups. Environ Health Perspect 106:167-174.

Pottenger LH, Domoradzki JY, Markham DA, Hansen SC, Cagen SZ, Waechter JM Jr. 2000. The relative bioavailability and metabolism of bisphenol A in rats is dependent upon the route of administration. Toxicol Sci 54:3-18.

Roper RJ, Griffith JS, Lyttle CR, Doerge RW, McNabb AW, Broadbent RE, et al. 1999. Interacting quantitative trait quantitative trait
n.
A phenotype that is influenced by multiple genes.
 loci control phenotypic variation in murine murine /mu·rine/ (mur´en) pertaining to, derived from, or characteristic of mice or rats.

mu·rine
adj.
 estradiol-regulated responses. Endocrinology 140:556-561.

Shin BS, Yoo SD, Cho CY, Jung JH, Lee BM, Kim JH, et al. 2002. Maternal-fetal disposition of bisphenol A in pregnant Sprague-Dawley rats. J Toxicol Environ Health 65:395-406.

Simmons D, France JT, Keelan JA, Song L, Knox BS. 1994. Sex differences in umbilical cord serum levels of inhibin in·hib·in
n.
A peptide hormone secreted by the follicular cells of the ovary and the Sertoli cells of the testis that inhibits secretion of follicle stimulating hormone from the anterior pituitary.
, testosterone, oestradiol Noun 1. oestradiol - the most powerful female hormone that occurs naturally; synthesized and used to treat estrogen deficiency and breast cancer
estradiol

Loestrin - trade name for an oral contraceptive containing estradiol and norethindrone
, dehydroepiandrosterone sulphate, and sex hormone-binding globulin globulin, any of a large family of proteins of a spherical or globular shape that are widely distributed throughout the plant and animal kingdoms. Many of them have been prepared in pure crystalline form.  in human term neonates. Biol Neonate neonate /neo·nate/ (ne´o-nat) newborn infant.

ne·o·nate
n.
A neonatal infant.



neonate

a newborn animal.
 65:287-294.

Spearow JL, Doemeny P, Sera R, Leffler R, Barkley M. 1999. Genetic variation in susceptibility to endocrine disruption by estrogen in mice. Science 285:1259-1261.

Spearow JL, O'Henley P, Doemeny P, Sara R, Leffler R, Sofos T, et al. 2001. Genetic variation in physiological sensitivity to estrogen in mice. APMIS APMIS Acta Pathologica, Microbiologica et Immunologica Scandinavica
APMIS Automated Project Management Information System
APMIS Automated Project Management System
 109:356-364.

Steinmetz R, Brown NG, Allen DL, Bigsby RM, Ben-Jonathan N. 1997. The environmental estrogen bisphenol A stimulates prolactin prolactin /pro·lac·tin/ (-lak´tin) a hormone of the anterior pituitary that stimulates and sustains lactation in postpartum mammals, and shows luteotropic activity in certain mammals.

pro·lac·tin
n.
 release in vitro and in vivo. Endocrinology 138:1780-1786.

Steinmetz R, Mitchner NA, Grant A, Allen DL, Bigsby RM, Ben-Jonathan N. 1998. The xenoestrogen bisphenol A induces growth, differentiation, and c-fos gene expression in the female reproductive tract. Endocrinology 139:2741-2747.

Takahashi O, Oishi S. 2000. Disposition of orally administered 2,2-bis(4-hydroxyphenyl)propane (bisphenol A)in pregnant rats and the placental transfer to fetuses. Environ Health Perspect 108:931-935.

Takeuchi T, Tsutsumi O. 2002. Serum bisphenol A concentrations showed gender differences, possibly linked to androgen levels. Biochem Biophys Res Commun 291:76-78.

Tinwell H, Joiner R, Pate I, Soames A, Foster J, Ashby J. 2000. Uterotrophic activity of bisphenol A in the immature mouse. Regul Toxicol Pharmacol 32:118-128.

Toda K, Okada Y, Zubair M, Morohashi KI, Saibara T, Okada T. 2004. Aromatase-knockout mouse carrying an estrogen-inducible enhanced green fluorescent protein "EGFP" redirects here. EGFP may also refer to the ICAO airport code for Pembrey Airport.

The green fluorescent protein (GFP) is a protein, comprised of 238 amino acids (26,9 kDa), from the jellyfish Aequorea victoria
 gene facilitates detection of estrogen actions in vivo. Endocrinology 145:1880-1888.

Uchida K, Suzuki A, Kobayashi Y, Buchanan DL, Sato T, Watanabe H, et al. 2002 Bisphenol-A administration during pregnancy results in fetal exposure in mice and monkeys. J Health Sci 48:579-582

vom Saal FS, Cooke PS, Buchanan DL, Palanza P, Thayer KA, Nagel SC, et al. 1998. A physiologically based approach to the study of bisphenol A and other estrogenic chemicals on the size of reproductive organs, daily sperm production, and behavior. Toxicol Ind Health 14:239-260.

Welshons WV, Nagel SC, Thayer KA, Judy BM, vom Saal FS. 1999. Low-dose bioactivity bi·o·ac·tiv·i·ty
n.
The effect of a given agent, such as a vaccine, upon a living organism or on living tissue.
 of xenoestrogens in animals: fetal exposure to low doses of methoxychlor methoxychlor

one of the group of chlorinated hydrocarbon insecticides which cause typical signs of that poisoning.
 and other xenoestrogens increases adult prostate size in mice. Toxicol Ind Health 15:12-25.

Yoshihara S, Mizutare T, Makishima M, Suzuki N, Fujimoto N, Igarashi K, et al. 2004. Potent estrogenic metebolites of bisphenol A and bisphenol B formed by rat liver S9 fraction: their structures and estrogenic potency. Toxicol Sci 78:50-59.

Josephine G. Lemmen, (1), * Roel J. Arends, (2) Paul T. van der Saag, (1) and Bart van der Burg (1), **

(1) Hubrecht Laboratory, Netherlands Institute for Developmental Biology, Uppsalalaan, Utrecht, the Netherlands; (2) Department of Pharmacology, NV Organon, Oss, The Netherlands

Address correspondence to P. van der Saag, Hubrecht Laboratory, Netherlands Institute for Developmental Biology, Uppsalalaan 8, 3584 CT Utrecht, the Netherlands. Telephone: 31-30-2121800. Fax: 31-30-2516464. E-mail: paul@niob.knaw.nl

* Current address: Laboratory of Reproductive Biology, Juliane Marie Center for Children, Women and Reproduction, University Hospital of Copenhagen, Copenhagen, Denmark.

** Current address: BioDetection Systems BV, Badhuisweg 3, 1031 CM Amsterdam, the Netherlands.

This study was supported financially by the European Union fifth framework: QLK4-2000-00305, "The Impact of Developmental Exposure to Weak (Environmental) Estrogens on the Incidence of Diseases in Target Organs Later in Life." It does not necessarily reflect its views and in no way anticipates the commission's future policy in this area.

The authors declare they have no competing financial interests.

Received 5 April 2004; accepted 21 July 2004.
COPYRIGHT 2004 National Institute of Environmental Health Sciences
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2004, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Research / Article
Author:van der Burg, Bart
Publication:Environmental Health Perspectives
Geographic Code:4EUNE
Date:Nov 1, 2004
Words:6431
Previous Article:Lung cancer in railroad workers exposed to diesel exhaust.(Research / Article)
Next Article:Understanding the spatial clustering of severe acute respiratory syndrome (SARS) in Hong Kong.(Research / Article)



Related Articles
PET scan spots breast-cancer receptors. (positron emission tomography)
Estrogen flips testosterone gene switch.(research indicates estrogen can bind to male hormone receptor)(Brief Article)
The Mouse Uterotrophic Assay: A Reevaluation of its Validity in Assessing the Estrogenicity of Bisphenol A.
Large effects from small exposures. I. mechanisms for endocrine-disrupting chemicals with estrogenic activity. (Research Review).
Assessment of estrogenic endocrine-disrupting chemical actions in the brain using in vivo somatic gene transfer.(Research)
The need to decide if all estrogens are intrinsically similar.(Research / Commentary)
A hazard in utero? Bisphenol a more potent than expected.(Environews / Science Selections)
Xenoestrogen-induced ERK-1 and ERK-2 activation via multiple membrane-initiated signaling pathways.(Research / Article)
Pancreatic effects of EDCs: low doses can impair glucagon secretion.(Environews: Science Selections)
Low doses of bisphenol A and diethylstilbestrol impair [Ca.sup.2+] signals in pancreatic [alpha]-cells through a nonclassical membrane estrogen...

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles