Printer Friendly
The Free Library
14,487,362 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Identifying relapsing fever Borrelia, Senegal.


We describe a nested polymerase chain reaction Nested polymerase chain reaction is a modification of polymerase chain reaction intended to reduce the contaminations in products due to the amplification of unexpected primer binding sites.  for the identification of Borrelia Borrelia

A genus of spirochetes that have a unique genome composed of a linear chromosome and numerous linear and circular plasmids. Borreliae are motile, helical organisms with 4–30 uneven, irregular coils, and are 5–25 micrometers long and 0.
 species from serum of patients with unidentified fevers. This technique, based on single nucleotide polymorphisms of the 16S ribosomal RNA ribosomal RNA
n.
See rRNA.


ribosomal RNA (rī´bōsō´m
 gene, was used to test blood samples from 7,750 patients, 33 of whom were diagnosed with spirochete spirochete

Any of an order (Spirochaetales) of spiral-shaped bacteria. Some are serious pathogens for humans, causing such diseases as syphilis, yaws, and relapsing fever. Spirochetes are gram-negative (see gram stain) and motile.
 infections. Borrelia crocidurae was the only species identified.

**********

Tickborne relapsing fevers, caused by spirochetes of the genus Borrelia, vary in severity and frequency of recurrence. The prevalence of various Borrelia species depends on the locality. In West Africa, Borrelia crocidurae is the primary cause of relapsing fevers (1-3), although B. duttonii and B. recurrentis are also found in Senegal. Tickborne relapsing fever is difficult to diagnose and is often confused in its early stages with malaria or relapsing malaria. Diagnosis is routinely made by conventional microscopy (Giemsa-stained thick blood smear) or fluorescence microscopy after concentration of blood in capillary tubes and staining with acridine orange acridine orange
n.
A basic fluorescent dye used as a metachromatic stain for nucleic acids and in screening cervical smears for abnormal cells.
 (quantitative buffy coat buf·fy coat
n.
The upper, lighter portion of the blood clot occurring when coagulation is delayed or when blood has been centrifuged.


Buffy coat 
 [QBC QBC Quantitative Buffy Coat ] analysis) (3). However, these methods require technical expertise and do not identify Borrelia species. Another method, culture ex vivo ex vivo /ex vi·vo/ (eks´ ve´vo) outside the living body; denoting removal of an organ (e.g., the kidney) for reparative surgery, after which it is returned to the original site. , is difficult to perform and rarely used in African medical laboratories. In contrast, the polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is  (PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
) is a sensitive diagnostic tool that is widely used in developing countries in AIDS, malaria, and entomology-related disease control programs.

The Study

The objective of our study was to develop a PCR method to identify the main Borrelia species in uncultured serum from patients with relapsing fevers in Senegal. This study was conducted using primers for single nucleotide polymorphisms (SNPs) in the 16S ribosomal RNA (rrs) gene of Borrelia sp. Sequencing of the rrs gene has shown that B. crocidurae, B. duttonii, B. recurrentis, and B. hispanica belong to the same species cluster (4). B. crocidurae differs from B. duttonii in this gene by only 1 nt (G63A polymorphism, GenBank accession no. M88329) and from B. recurrentis by 2 nt (G63A and C211T, GenBank accession no. M88329) (4). These SNPs have also been identified in Borrelia species found outside sub-Saharan Africa. We used this method to analyze blood samples collected from patients treated at the medical laboratory of the Institut Pasteur in Dakar, Senegal, for suspected malaria from October 1999 to October 2003. In addition to routine laboratory analysis, PCR was performed on frozen serum. Spirochetes were first detected in fresh blood samples by microscopic examination with a QBC kit (Makromed, Johannesburg, South Africa). Five hundred microliters of serum from spirochete-positive patients was then used for extraction of DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
. Extraction was performed according to the method of Wilson (5), with slight modifications. Serum was diluted in distilled water (final volume 1.5 mL) and centrifuged at 15,000 rpm for 30 min at 4[degrees]C. DNA was extracted from the pellet by incubation for 2 h at 37[degrees]C in extraction buffer (1mol/L Tris, 0.5mol/L EDTA EDTA: see chelating agents. , proteinase proteinase /pro·tein·ase/ (pro´ten-as?) endopeptidase.

pro·tein·ase
n.
A protease that begins the hydrolytic breakdown of proteins usually by splitting them into polypeptide chains.
 K [20 mg/mL], and 10% sodium dodecyl sulfate Sodium dodecyl sulfate (or sulphate) (SDS or NaDS) (C12H25NaO4S),is an anionic surfactant that is used in household products such as toothpastes, shampoos, shaving foams and bubble baths for its thickening effect and its ability to ), purified by a standard phenol/chloroform procedure (6), and precipitated with ethanol. Thermolysates provided by the National Borrelia Reference Center (CNRB CNRB Company Nuclear Review Board ) (Pasteur Institute, Paris, France) served as controls.

The primers used in this study are listed in the Table. Borrelia species were first identified by using the nested PCR reported by Ras et al. (4). It consisted of amplification of a 523-bp region of the rrs gene using primers sets fD3-T50 and Rec4-Rec9. In a second PCR, the presumptive identification of the Borrelia species was made using primer set Fd3-595R for the first amplification and specific primer sets (BcroF-255R for B. crocidurae, BdutF-255R for B. duttonii, and BrecF-500R for B. recurrentis) for the second amplification. These 3 specific primers sets were used in 3 separate reactions for the second PCR. Species identification was systematically confirmed by sequencing the rrs gene. The 3 species-specific primer sets include the SNPs up to their last 3' base. Based on the alignment of sequences of Borrelia found in GenBank, these 3 primer sets can also hybridize hy·brid·ize  
intr. & tr.v. hy·brid·ized, hy·brid·iz·ing, hy·brid·iz·es
1. To produce or cause to produce hybrids; crossbreed.

2.
 with other sequences from the Eurasian B. burgdorferi sensu lato group and the North America relapsing fever group.

The reaction conditions were adapted to optimize species-specific amplification by using thermolysates of strains obtained from CNRL CNRL Canadian Natural Resources Ltd (Calgary, Alberta)
CNRL Communications and Navigation Research Laboratory (NASA) 
 as positive controls. Serum samples negative for Borrelia and DNA extracted from Escherichia coli Escherichia coli (ĕsh'ərĭk`ēə kō`lī), common bacterium that normally inhabits the intestinal tracts of humans and animals, but can cause infection in other parts of the body, especially the urinary tract. , Plasmodium plasmodium, name for a stage in the life cycle of a slime mold. Also, Plasmodium is the name given to the genus of the protozoan parasite that causes malaria. , Mycoplasma mycoplasma

Any of the bacteria that make up the genus Mycoplasma. They are among the smallest of bacterial organisms. The cell varies from a spherical or pear shape to that of a slender branched filament.
, and Candida obtained from our medical laboratory were used as negative controls.

All PCR amplifications were performed in a final volume of 25 [micro]L containing approximately 3 ng of DNA, 10 mmol/L Tris-HC1 (pH 8.3), 2.5 mmol/L Mg[Cl.sub.2], 200 mmol/L of each deoxynucleotide triphosphate triphosphate /tri·phos·phate/ (tri-fos´fat) a salt containing three phosphate radicals.

tri·phos·phate
n.
A salt or ester containing three phosphate groups.
, 1 U of Taq polymerase (Amersham Biosciences, Piscataway, NJ, USA), and 1 mmol/L of each primer. Amplification in all PCRs was carried out for 35 cycles with denaturation denaturation, term used to describe the loss of native, higher-order structure of protein molecules in solution. Most globular proteins exhibit complicated three-dimensional folding described as secondary, tertiary, and quarternary structures.  at 93[degrees]C for 1 min, annealing annealing (ənēl`ĭng), process in which glass, metals, and other materials are treated to render them less brittle and more workable.  at 4[degrees]C below the melting temperature of the primer (Table) used for 1 min, and extension at 72[degrees]C for 2 min. For PCR species typing, annealing was performed at 70[degrees]C for 40 s and extension at 72[degrees]C for 40 s. Final PCR products were detected by electrophoresis on a 1.5% agarose agarose

more highly purified form of agar with similar uses to agar and widely used in the separation of nucleic acid fragments.
 gel stained with ethidium bromide. PCR analyses were performed according to Good Laboratory Practice to avoid cross-contamination between samples during extraction or amplification. Under the PCR conditions defined, the 3 West African Borrelia species were amplified only with their respective primers.

We tested potential cross-amplification of Eurasian and North American strains by using strains provided by CNRB. Typical bands were found in the thermolysates of B. hermsii (strainHS1), B. parkeri (strain M3001), and B. turicatae (strain 2007) when the specific primer for B. crocidurae was used. The thermolysates of B. duttonii (strain Ly), B. garinii (strain 20047), and B. burgdorferi sensu stricto (strain B31) were amplified with the specific primer for B. duttonii. However, since the geographic distribution of these pathogens does not overlap, species identification is relatively simple. For example, B. hispanica and B. burgdorferi sensu lato have not been previously found in sub-Saharan Africa.

Conclusions

Most patients treated at the medical laboratory of the Institut Pasteur in Dakar, Senegal, during the study period were residents of the Dakar area. Of the 7,750 patients included in this study, 3,300 were females and 4,450 were males; their mean age was 44.5 years. A total of 605 (7.8%) patients tested positive for malaria; most infections were diagnosed as Plasmodium falciparum. Spirochetes were found in the blood of 33 patients by microscopic examination. Only 1 patient was infected with both spirochetes and P. falciparum. In contrast to malaria, detection of spirochetes does not exhibit a seasonal variation in prevalence rates. Sera were available for 25 of 33 spirochete-positive patients. Using our species-specific nested PCR, we found that serum from 25 of these patients contained B. crocidurae. As described earlier, the presence of this species was confirmed by gene sequencing.

This new nested PCR is an efficient method for identifying tickborne relapsing fevers in sub-Saharan Africa. The procedures were conducted over a 2-day period with standard PCR equipment and could also be useful in epidemiologic studies. This study also confirmed that B. crocidurae is the most prevalent Borrelia species in the study area.
Table. Primers used for amplification of the Borrelia 16S ribosomal RNA
gene based on GenBank accession no. M88329 for Crocidurae

Primer (reference)            Sequence             Tm, [degrees]C *

Fd3 (4)                 AGAGTTTGATCCTGGCTTAG              58
T50 (4)                  GTTACGACTTCACCCCCCT              60
Rec4 (4)                 ATGCTAGAAACTGCATGA               50
Rec9 (4)                 TCGTCTGAGTCCCCATCT               56
Fd4                    GGCTTAGAACTAACGCTGGCAG             68
595R                    CTTGCATATCCGCCTACTCA              60
500R (4)                CTGCTGGCACGTAATTAGCC              64
BcroF                   CGTCTTAAGCATGCAAGTCAG             62
BdutF                   CGTCTTAAGCATGCAAGTCAA             60
BrecF                  GAAAGGAAGCCTTTAAAGCTTT             60
255R                  CCCTACCAACTAGCTAATAAGACGC           74

Primer (reference)       Nucleotide position

Fd3 (4)                          8-27
T50 (4)                       1478-1499
Rec4 (4)                       659-675
Rec9 (4)                      1191-1174
Fd4                             21-42
595R                           621-602
500R (4)                       548-529
BcroF                      45-65 (U42283)
BdutF                     45-65 (AF107364)
BrecF                     193-214 (AF10362)
255R                           255-231

* Tm, melting temperature.


References

(1.) Aubry P, Renambot J, Teyssier J, Buisson Y, Granic G, Brunetti G, et al. Les borrelioses a tiques au Senegal a propos de 23 observations [in French]. Dakar Med. 1983;28:413-20.

(2.) Trape JF, Godeluck B, Diatta G, Rogier C, Legros F, Albergel J et al. The spread of tick-borne borreliosis in West Africa and its relationship to sub-Saharan drought. Am J Trop Med Hyg. 1996;54:289-93.

(3.) van Dam AP, van Gool T, Wetsteyn JC, Dankert J. Tick-borne relapsing fever imported from West Africa: diagnosis by quantitative buffy coat analysis and in vitro culture of Borrelia crocidurae. J Clin Microbiol. 1999;37:2027-30.

(4.) Ras NM, Lascola B, Postic D, Cutler SJ, Rodhain F, Baranton, et al. Phylogenesis phy·lo·gen·e·sis
n.
See phylogeny.
 of relapsing fever Borrelia spp. Int J Syst Bacteriol. 1996;46:859-65.

(5.) Wilson K. Preparation of genomic DNA from bacteria. In: Ausubel F, Brent R, Kingston R, Moore D, Seidman J, Smith J, Struhl K, editors. Current protocols in molecular biology. Supplement 9. New York: John Wiley and Sons, Inc; 1990. p. 241-58.

(6.) Prescott L, Harley J, Klein S. Microbiologie. Leuven, Belgium: De Boek University; 1999.

Mr. Brahim is a PhD candidate in the Immunology Department of the Institut Pasteur in Dakar. His research interests include the study of relapsing fever in urban Senegal.

Hamoud Brahim, * Jean David Perrier-Gros-Claude, * Danielle Postic, ([dagger]) Guy Baranton, ([dagger]) and Ronan Jambou *

* Institut Pasteur, Dakar, Senegal; and ([dagger]) Institut Pasteur, Paris, France

Address for correspondence: Ronan Jambou, Unite d'Immunologie, Institut Pasteur de Dakar, PO Box 220, Dakar, Senegal, fax: 221-839-9210; email: rjambou@pasteur.sn
COPYRIGHT 2005 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2005, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Dispatches
Author:Jambou, Ronan
Publication:Emerging Infectious Diseases
Geographic Code:6SENE
Date:Mar 1, 2005
Words:1571
Previous Article:Japanese encephalitis virus in meningitis patients, Japan.(Dispatches)
Next Article:Babesia microti, upstate New York.(Dispatches)
Topics:



Related Articles
Relapsing fever-like spirochetes infecting European vector tick of Lyme disease agent. (Research).
Tick-borne relapsing fever caused by Borrelia hermsii, Montana.(Dispatches)
Typing of Borrelia relapsing fever group strains.(Dispatches)
Third Borrelia species in white-footed mice.(LETTERS)(Letter to the Editor)
Typing African relapsing fever spirochetes.(RESEARCH)
Tickborne relapsing fever in Israel.(DISPATCHES)
Imported tickborne relapsing fever, France.(Letter to the Editor)
Possibilities for relapsing fever reemergence.(PERSPECTIVE)
Molecular characterization of tickborne relapsing fever Borrelia, Israel.(DISPATCHES)
Tickborne relapsing fever diagnosis obscured by Malaria, Togo.(Disease/Disorder overview)

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles