Printer Friendly
The Free Library
14,635,740 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Identification of putative gene-based markers of renal toxicity.


This study, designed and conducted as part of the International Life Sciences Institute working group on the Application of Genomics and Proteomics, examined the changes in the expression profile of genes associated with the administration of three different nephrotoxicants--cisplatin, gentamicin gentamicin /gen·ta·mi·cin/ (jen?tah-mi´sin) an aminoglycoside antibiotic complex isolated from bacteria of the genus Micromonospora, , and puromycin--to assess the usefulness of microarrays in the understanding of mechanism(s) of nephrotoxicity neph·ro·tox·ic·i·ty
n.
The quality or state of being toxic to kidney cells.


nephrotoxicity(ne·fr
. Male Sprague-Dawley rats were treated with daily doses of puromycin puromycin

an antibiotic that inhibits protein synthesis. Used in the treatment of protozoal infections and as an antineoplastic agent.

puromycin 
 (5-20 mg/kg/day for 21 days), gentamicin (2-240 mg/kg/day for 7 days), or a single dose of cisplatin cisplatin /cis·plat·in/ (sis´plat-in) DDP; a platinum coordination complex capable of producing inter- and intrastrand DNA crosslinks; used as an antineoplastic.

cis·plat·in
n.
 (0.1-5 mg/kg). Groups of rats were sacrificed at various times after administration of these compounds for standard clinical chemistry, urine analysis, and histological evaluation of the kidney. RNA RNA: see nucleic acid.
RNA
 in full ribonucleic acid

One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic
 was extracted from the kidney for microarray analysis. Principal component analysis and gene expression-based clustering of compound effects confirmed sample separation based on dose, time, and degree of renal toxicity. In addition, analysis of the profile components revealed some novel changes in the expression of genes that appeared to be associated with injury in specific portions of the nephron nephron: see urinary system.
nephron

Functional unit of the kidney that removes waste and excess substances from the blood to produce urine. Each of the million or so nephrons in each kidney is a tubule 1.2–2.2 in. (30–55 mm) long.
 and reflected the mechanism of action of these various nephrotoxicanrs. For example, although puromycin is thought to specifically promote injury of the podocytes in the giomerulus, the changes in gene expression after chronic exposure of this compound suggested a pattern similar to the known proximal tubular nephrotoxicants cisplatin and gentamicin; this prediction was confirmed histologicaUy. We conclude that renal gene expression profiling coupled with analysis of classical end points affords promising opportunities to reveal potential new mechanistic markers of renal toxicity.

Key words: biomarkers, cisplatin, gentamicin, microarrays, nephrotoxicity, proximal tubule, puromycin, toxicogenomics. Environ Health Perspect 112:465-479 (2004). doi:10.1289/txg.6683 available via http://dx.doi.org/ [Online 15 January 20041

**********

Renal toxicity commonly occurs after administration of xenobiotics and a variety of pharmaceutical agents. The process is typically initiated by a toxic injury to tubular epithelial cells in various nephron segments or by injury to specific cell types in the glomerulus glomerulus /glo·mer·u·lus/ (glo-mer´u-lus) pl. glomer´uli   [L.] a small tuft or cluster, as of blood vessels or nerve fibers; often used alone to designate one of the renal glomeruli. . The initial injury is often followed by cellular proliferation and repair that attempts to restore normal renal function (Toback 1992). Changes in the expression of mRNA specifically expressed in the injured kidney cells are some of the earliest events that accompany renal injury. This is accompanied by changes in the expression of other genes that contribute either to cellular repair or recovery of renal function or in those that mediate fibrosis and further pathology of the kidney (Matejka 1998; Norman et al. 1988; Safirstein et al. 1990). For example, elevations in the expression of heme oxygenase I (HO-1), kidney injury molecule-1 (KIM-1), clusterin, thymosin Thymosin

A polypeptide hormone synthesized and secreted by the endodermally derived reticular cells of the thymus gland. Thymosin exerts its actions in several loci: (1) in the thymus gland, either on precursor stem cells derived from fetal liver or from bone
 beta 4, osteopontin, and several growth factors have been reported in various models of renal injury (Hammerman 1998a, 1998b; Huang et al. 2001; Ichimura et al. 1998; Yoshida et al. 2002).

Recent application of microarray-based gene profiling has provided some unique insights into compound-specific and toxicity-related gene expression changes in the liver (Hamadeh et al. 2002a, 2002b; Waring et al. 2001a, 2001b), and several laboratories have applied similar techniques to identify gene expression changes related to nephrotoxicity (Huang et al. 2001; Nagasawa et al. 2001; Yoshida et al. 2002).

This study, conducted as a consortium collaboration with the International Life Sciences Institute (ILSI ILSI International Life Sciences Institute
ILSI Incorporated Law Society of Ireland
) Health and Environmental Sciences Institute (HESI HESI High Energy Solar Imager ) (Kramer et al. 2004; Pennie et al. 2004), compares kidney gene expression profiles induced by cisplatin and gentamicin, compounds that injure the proximal tubule, and puromycin, which produces proteinuria proteinuria /pro·tein·uria/ (-ur´e-ah) an excess of serum proteins in the urine, as in renal disease or after strenuous exercise.proteinu´ric

pro·tein·u·ri·a
n.
1.
 by selectively damaging podocytes, a key component of the glomerular glomerular /glo·mer·u·lar/ (glo-mer´u-ler) pertaining to or of the nature of a glomerulus, especially a renal glomerulus.

glo·mer·u·lar
adj.
 filtration barrier to plasma proteins. Conventional clinical chemistry and histopathological or ultrastructural findings confirmed the induction of tubular or glomerular injury in these studies. Through comparison of the expression profiles derived from kidneys exposed to these three nephrotoxicants at multiple doses and time points (associated with varying types and severity of toxicity), we hypothesized that we could identify patterns of gene expression that reflect different types of nephrotoxicity. An important outcome is the identification of potential gene-based markers of nephrotoxicity and evidence that one can detect region-specific renal toxicity using microarray technology. Additional functional genomics studies may afford the opportunity to validate the proposed novel gene-based markers of nephrotoxicity, which in part may improve current sensitivity to assessing xenobiotic-induced nephrotoxicity.

Materials and Methods

General

This study was conducted in accordance with Good Laboratory Practices. All animals were handled and treated in accordance to the NIH "Not invented here." See digispeak.

NIH - The United States National Institutes of Health.
 Guide for the Care and Use of Laboratory Animals (NIH 1999). Experiments were performed on approximately 8- to 9-week-old male (approximately 250-300 g) Sprague-Dawley rats Crl:CD (SD)IGS IGS - Internet Go Server.  BR VAF VAF Value Adjustment Factor
VAF Vane Air Flow (automotive sensor)
VAF Viral Antibody Free
VAF Voice Activity Factor
VAF Virginia Academy of Fencing
VAF Variable Air Flow
VAF Virginia Arts Foundation
+ (abbreviated SD) purchased from Charles River Breeding Laboratories (Raleigh, NC). Food [Purina Rodent Chow no. 5002 (Purina Milling Inc., St. Louis, MO), or Certified Rodent Diet 18% no. 5LG3, (PMI See Private Mortgage Insurance.  Feeds, Richmond, IN)], except for study-defined fasting procedures, and water were available ad libirum.

Test Article and Treatment

Cisplatin (CAS no. 15663-27-1; lot 059H3657), gentamicin sulfate (CAS no. 1405410; lot 50K0924), and puromycin dihydrochloride hydrate hydrate (hī`drāt), chemical compound that contains water. A common hydrate is the familiar blue vitriol, a crystalline form of cupric sulfate. Chemically, it is cupric sulfate pentahydrate, CuSO4·5H2O.  (CAS no. 58-58-2; Lot 080K4031) were purchased from Sigma Chemical Company (St. Louis, MO). Doses were selected based on previous reports that documented histopathological changes in the kidney by the 7-day time point or later. The rats received a single ip injection of vehicle (0.9% NaCl solution) or cisplatin at a dose of 0.3, 1, or 5 mg/kg (20 per group). Cisplatin- and vehicle-treated rats were sacrificed by inhalation of carbon dioxide 4, 24, 48, and 144 hr after injection of vehicle or cisplatin. This portion of the study was conducted at Pfizer Inc (Groton, CT).

Gentamicin was dissolved in a sterile 0.9% (w/v) NaCl solution and the animals were treated with daily ip injections of vehicle or gentamicin at doses of 2, 20, 80 or 240 mg/kg/day for up to 7 days. A group of rats (three to five per group) were sacrificed at 4, 24, 48, and 144 hr after the initial administration of gentamicin. This portion of the study was conducted at Novartis Pharmaceuticals (East Hanover, NJ) and the Medical College of Wisconsin (Madison, WI).

Puromycin was dissolved in sterile 0.9% (w/v) NaCl solution. The rats received daily ip injections of vehicle or puromycin at doses of 5 or 20 mg/kg/day for up to 21 days. Puromycin-treated and time-matched vehicle control animals were sacrificed at 4, 24, 48, and 144 hr, and 21 days after the first exposure to the compound. This portion of the study was coordinated by staff from the National Institute of Environmental Health Sciences The National Institute of Environmental Health Sciences (NIEHS) is one of 27 Institutes and Centers of the National Institutes of Health (NIH),which is a component of the Department of Health and Human Services (DHHS). The Director of the NIEHS is Dr. David A. Schwartz.  (NIEHS NIEHS National Institute of Environmental Health Sciences (NIH, DHHS) ; Research Triangle Park Research Triangle Park, research, business, medical, and educational complex situated in central North Carolina. It has an area of 6,900 acres (2,795 hectares) and is 8 × 2 mi (13 × 3 km) in size. Named for the triangle formed by Duke Univ. , NC).

Urine Collection

Animals were placed in standard metabolic cages overnight (approximately 12-14 hr) prior to necropsy necropsy /nec·rop·sy/ (nek´rop-se) examination of a body after death; autopsy.

nec·rop·sy
n.
See autopsy.



necropsy

examination of a body after death. See also autopsy.
. Food but not water was removed from the animals during this time. Urine volumes were recorded and the urine samples were frozen and stored at -80[degrees]C for subsequent analysis.

Tissue Collection

After C[O.sub.2] anesthesia, a sample of blood was collected from the vena cava for standard clinical chemistry analysis. The kidneys were collected, weighed, and stored frozen. Half the kidney and the left lobe of the liver were placed in 10% neutral buffered formalin formalin /for·ma·lin/ (for´mah-lin) formaldehyde solution.

for·ma·lin
n.
An aqueous solution of formaldehyde that is 37 percent by weight.
 for histology, and the other half was flash-frozen in liquid nitrogen and stored at -80[degrees]C for Western blot or immunohistochemical analysis. The right kidney was minced, transferred to 5 mL RLT RLT Revocable Living Trust
RLT Relating to
RLT Real Life Test
RLT Raleigh Little Theatre
RLT Regimental Landing Team
RLT Regional Leadership Team
RLT Real Life Technologies (trademark of Hewlett-Packard)
RLT Release Link Trunk
 with [beta]-mercaptoethanol (+ BME BME
abbr.
1. Bachelor of Mechanical Engineering

2. Bachelor of Mining Engineering

3. Bachelor of Music Education
) buffer (Qiagen, Valencia, CA) in a 50-mL centrifuge centrifuge (sĕn`trəfyj), device using centrifugal force to separate two or more substances of different density, e.g., two liquids or a liquid and a solid.  tube and homogenized ho·mog·e·nize  
v. ho·mog·e·nized, ho·mog·e·niz·ing, ho·mog·e·niz·es

v.tr.
1. To make homogeneous.

2.
a. To reduce to particles and disperse throughout a fluid.

b.
 for 60-120 sec. Additional RLT (+ BME) buffer was added to achieve a final volume of 30 mL, which was divided into 15-mL aliquots and stored at -80[degrees]C until the RNA was extracted.

Histology

The tissues were fixed for a maximum of 48 hr and then transferred to 70% ethanol for up to 10 days before being placed in paraffin. The tissues were embedded in paraffin blocks, cut into 5-1im sections, and stained with hematoxylin hematoxylin /he·ma·tox·y·lin/ (he?mah-tok´si-lin) an acid coloring matter from the heartwood of Haematoxylon campechianum; used as a histologic stain and also as an indicator.  and eosin eosin /eo·sin/ (e´o-sin) any of a class of rose-colored stains or dyes, all being bromine derivatives of fluorescein; eosin Y, the sodium salt of tetrabromofluorescein, is much used in histologic and laboratory procedures.  (H&E). Ultrastructural analysis using electron microscopy was performed on kidney tissue obtained from animals treated with gentamicin. In this case the kidney tissue was fixed with paraformaldehyde paraformaldehyde: see formaldehyde.  rather than formalin.

Clinical Chemistry and Urinalysis

At scheduled necropsies, blood (fasted, vena cava bleeding; approximately 2-3 mL) was collected into serum separation collection tubes and allowed to clot. Serum was collected (centrifugation Centrifugation

A mechanical method of separating immiscible liquids or solids from liquids by the application of centrifugal force. This force can be very great, and separations which proceed slowly by gravity can be speeded up enormously in centrifugal
 at approximately 4[degrees]C, 1,500 x g, 10 min) and stored frozen at -70 to -80[degrees]C for routine serum biochemistry analysis. Albumin, alkaline phosphatase, alanine alanine (ăl`ənēn'), organic compound, one of the 20 amino acids commonly found in animal proteins. Only the l-stereoisomer participates in the biosynthesis of proteins (see stereochemistry).  amino transferase transferase /trans·fer·ase/ (trans´fer-as) a class of enzymes that transfer a chemical group from one compound to another.

trans·fer·ase
n.
, aspartate aspartate /as·par·tate/ (ah-spahr´tat) a salt of aspartic acid, or aspartic acid in dissociated form.

a·spar·tate
n.
1. A salt of aspartic acid.

2.
 amino transferase, bilirubin Bilirubin

The predominant orange pigment of bile. It is the major metabolic breakdown product of heme, the prosthetic group of hemoglobin in red blood cells, and other chromoproteins such as myoglobin, cytochrome, and catalase.
, blood urea nitrogen blood urea nitrogen
n. Abbr. BUN
Nitrogen in the form of urea in the blood or serum, used as a indicator of kidney function.


Blood urea nitrogen (BUN) 
 (BUN), calcium ([Ca.sup.2+]), chloride, creatinine, gamma glutamyltransferase, glucose, magnesium, phosphate, 5'-nucleotidase, potassium, sorbitol dehydrogenase, sodium, total cholesterol, and total protein were among the parameters measured using a standard clinical chemistry analyzer. Urinary creatinine, total protein, glucose, calcium, sodium, potassium, chloride, magnesium, and phosphorus concentrations were also analyzed.

Statistical Analysis

Mean values [+ or -] 1 standard error (SE) are presented for serum biochemistry, urine chemistry, and organ and body weight measurements. Significance of the differences in mean values were evaluated using either a one-way analysis of variance followed by a Duncan's multiple range post hoc analysis (more than two groups) or a Student t test for comparison between two mean values.

RNA Extraction

Homogenized kidney samples (one of two 15-mL samples per animal) were processed using a Qiagen RNeasy Maxi kit (Qiagen) according to the manufacturer instructions. Final RNA product was quantified from the ultraviolet absorbance absorbance /ab·sor·bance/ (-sor´bans)
1. in analytical chemistry, a measure of the light that a solution does not transmit compared to a pure solution. Symbol .

2.
 at 260 nm (Beckman DU520UV/Vis Spectrophotometer spectrophotometer, instrument for measuring and comparing the intensities of common spectral lines in the spectra of two different sources of light. See photometry; spectroscope; spectrum. ; Beckman Coulter Inc., Fullerton, CA). The quality of the RNA was evaluated by measuring the 260-/280-nm ratios and confirmed by formaldehyde agarose gels or analysis of the sample on a Bioanalyzer (Agilent Technologies, Palo Alto, CA). RNA was deemed of a suitable quality for microarray analysis if the 260/280 ratio was between 1.6 and 2.0 and the gel and Bioanalyzer traces showed no visible degradation products lower than the 18S ribosomal band. An equal amount of RNA extracted from the kidney of all rats in a treatment group was pooled into single samples. In select instances RNA from kidney of individual animals was also analyzed by microarray and/or by RT-PCR RT-PCR

reverse transcriptase-polymerase chain reaction. See PCR1.
. Samples were stored at -80[degrees]C until hybridization hybridization /hy·brid·iza·tion/ (hi?brid-i-za´shun)
1. crossbreeding; the act or process of producing hybrids.

2. molecular hybridization

3.
.

cDNA Microarray Manufacturing

Gene expression analysis was conducted on the same RNA samples using several platforms including Affymetrix (Santa Clara, CA) and NIEHS custom cDNA microarrays. The analysis of samples using the Affymetrix platform was performed according to the manufacturer details (Affymetrix 2003; Lockhart et al. 1996) and is detailed in the accompanying paper (Thompson et al. 2004).

The analysis using the custom cDNA microarray manufactured at NIEHS is as follows: Sequence-verified rat cDNA clones that covered the 3' end of the gene and ranged in size from 500 to 2,000 bp (Research Genetics, Huntsville, AL) were printed on glass slides. M13 primers were used to amplify insert cDNAs from purified plasmid DNA in a 100-[micro]L polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is  (PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
) reaction mixture. A sample of the PCR products (10 [micro]L) was separated on 2% agarose gels to ensure quality of the amplifications. The remaining PCR products were purified by ethanol precipitation, resuspended in Arraylt buffer (TeleChem Intl. Inc., Sunnyvale, CA), and spotted onto poly-L-lysine-coated glass slides using a modified robotic DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 arrayer (Beecher Instruments, Bethesda MD) with TeleChem pins to produce the NIEHS rat chip containing > 7,000 clones. A list of clones on this chip is available on the NIEHS web site (NIEHS Microarray Group 2003a). Methods were adapted from DeRisi et al. (1996) and are available on the NIEHS web site (NIEHS Microarray Group 2003b)

cDNA Microarray Hybridization and Analysis

For microarray hybridizations, each total RNA sample (35-75 [micro]g) was labeled with Cyanine cy·a·nine  
n.
Any of various blue dyes, used to sensitize photographic emulsions to a greater range of light.
, 3 (Cy3)- or Cyanine 5 (Cy5)-conjugated dUTP (Amersham, Piscataway, NJ) by a reverse transcription reaction using the reverse transcriptase SuperScript Any letter, digit or symbol that appears above the line. For example, 10 to the 9th power is written with the 9 in superscript (109). Contrast with subscript.  (Invitrogen, Carlsbad, CA) and the primer Oligo dT (Amersham). Control samples were labeled with Cy3, whereas samples derived from chemically exposed animals were labeled with CyS. The fluorescently labeled cDNAs were mixed and hybridized simultaneously to the cDNA microarray chip. Each RNA pair was labeled and hybridized independently in duplicate or quadruplicate quad·ru·pli·cate  
adj.
1. Multiplied by four; quadruple.

2. Fourth in a group of four identical things.

n.
One of a group of four identical things.

tr. & intr.v.
 to a total of two to four arrays. The cDNA chips were scanned with an Axon axon: see nervous system; synapse.  Scanner (Axon Instruments, Foster City, CA) using independent laser excitation of the two fluors at 532 and 635 nm wavelengths for the Cy3 and Cy5 labels, respectively. Image analysis, background subtraction, normalization In relational database management, a process that breaks down data into record groups for efficient processing. There are six stages. By the third stage (third normal form), data are identified only by the key field in their record. , and determination of significant gene changes were conducted using the ArraySuite, version 2.0 extensions of the IPLab image processing software package (Scanalytics, Fairfax, VA) (Chen et al. 1997) as previously described (Bushel bushel: see English units of measurement.  et al. 2001, 2002; Hamadeh et al. 2002a, 2002b, 2002c).

Hierarchical cluster analysis was carried out with the Cluster, version 2.12, and TreeView, version 1.6, package (Eisen et al. 1998). The cDNA data set is available from NIEHS (NIEHS Microarray Group 2003c). The complete data set is currently being submitted to ArrayExpress (EMBL-European Bioinformatics Institute, Hinxton, U.K.; http://www.ebi.ac.uk/ arrayexpress) and will be available for public download by the second quarter of 2004, Accession numbers referencing this data set will be available on the HESI web site (http://hesi.ilsi.org/index.cfm?pubentityid=120). GeneSpring, version 4.2 (Silicon Genetics, Redwood City, CA), Cluster, and TreeView software (Eisen et al. 1998) were used to perform the self-organizing maps (SOM) procedure and/or visualize sets of genes constituting the union of all significant gene changes from each dose and time point, SOM is a neural network architecture that categorized similar trends in the expression pattern of genes across multiple doses and time points. In addition, Partek Pro, version 5.02 (Partek Inc., St, Charles, MO), was used to further elucidate discriminate gene sets using principal component analysis (PCA (tool, programming) PCA - A dynamic analyser from DEC giving information on run-time performance and code use. ).

Real-Time Quantitative PCR

RNA samples representing single animals treated with cisplatin or gentamicin were also used to validate the expression profile of several genes identified using cDNA microarray data including osteopontin, inositol inositol (ĭnō`sĭtōl): see vitamin.
Inositol

The generic name for hexahydroxycyclohexanes, which are classified as carbohydrates.
 polyphospate multikinase, L-arginine glycine amidinotransferase, prosaposin, lipocalin, synaptogyrin 2, kallikrein, KIM-1, and an expressed sequence tag An expressed sequence tag or EST is a short sub-sequence of a transcribed spliced nucleotide sequence (either protein-coding or not). They may be used to identify gene transcripts, and are instrumental in gene discovery and gene sequence determination.  (EST EST electroshock therapy.

EST
abbr.
electroshock therapy
) (GenBank accession no. AA957270). The primers for these genes were designed using Primer Express (Applied Biosystems, Foster City, CA) and custom made (Bioserve Biotechnologies, Laurel, MD) except for renal kallikrein primers and probe that was purchased from Applied Biosystems assay by design service.

Real-time PCR was performed using the ABI Abi (ā`bī) [short for Abijah], in the Bible, King Hezekiah's mother.


(Application Binary Interface) A specification for a specific hardware platform combined with the operating system.
 Prism 7700 Sequence Detection System (Applied Biosystems) according to the manufacturer instructions. Primer and probe sequences are listed later in this section. Primer and probe concentrations were optimized such that the amplification efficiency of the endogenous reference was similar to that of the target gene. The endogenous reference used for samples was actin RNA. For the cisplatin samples the SYBR Green I labeling kit (Applied Biosystems) was used according to the manufacturer instructions to detect double-stranded DNA generated during PCR amplification. Reverse transcription and PCR reactions were performed at the same time in a 50-[micro]L reaction containing 4 mM magnesium chloride, 0.8 mM of each dNTP, 100 ng total RNA, 0.4 [micro]M reverse primer, 0.4 [micro]M forward primer, 0.4 U/[micro]L RNasin, 0.025 U/[micro]L AmpliTaq Gold DNA polymerase (Roche, Basel, Switzerland), and 0.25 U/[micro]L MulIV reverse transcriptase (Roche). Amplification reactions were carried out using the following temperature profile: 48[degrees]C, 30 min; 95[micro]C, 10 min; 95[micro]C, 15 sec; 60[micro]C, 1 min) for 40 cycles. Fluorescence emission was detected for each PCR cycle and the threshold cycle ([C.sub.T]) values were determined. The [C.sub.T] value was defined as the actual PCR cycle when the fluorescence signal increased above the background threshold. Induction or repression of a gene in a treated sample relative to control was calculated as follows: fold increase/ decrease = 2 - [[C.sub.T(exposed)] - [C.sub.T(control)]] Values are reported as an average of triplicate analyses. For the gentamicin samples, reverse transcription and PCR were carried out in a 25-[micro]L reaction volume using 10 ng total RNA in triplicate per reaction, 5 nM forward and reverse primer, and 25 nM FAM-MGB-labeled probe. Taqman one-step PCR master mix reagent kit (Applied Biosystems) was used for all reactions according to manufacturer's specifications. All reactions were carried out using the ABI Prism 7700 Sequence Detection System (Applied Biosystems). Transcript levels were measured using the comparative CT methods described in User Bulletin No. 2 (Applied Biosystems 1997).

The following primers, listed in the 5' to 3' direction, were used for reverse transcription-PCR (RT-PCR) verification of gentamicin-induced gene expression changes: kallikrein (GenBank accession no. M19647) forward = GCACCGGCTT GTCAGTCAA, probe = CCCTCACC CTGACTAC, reverse = TCGGGTGTG GTTCCTCATG; prosaposin (GenBank accession no. NM 013013) forward = AAGAGCCCAAGCAGTCTG CAT, probe = CGCCCATGTGCCTC, reverse = TGTTCCAAATAGATGACCAGCTT CT; osteopontin (GenBank accession no. M99252) forward = CCAGCACACAAG CAGACGTTT, probe = CAGTCGATGT CCCTGAC, reverse = CAGTCCGTAA GCCAAGCTATCA; KIM-1 (AF35963) forward = CGCAGAGAAACCCGAC TAAG TAAG Trial of Activity for Adolescent Girls
TAAG Toronto Area Archivists' Group (chapter of the Archives Association of Ontario)
TAAG Transportes Aereos Angolanos (Angolan Airways) 
, reverse = CAAAGCTCAGAGAG CCCATC; glyceraldehyde-3-phosphatedehydrogenase (GAPDH GAPDH Glyceraldehyde-3-Phosphate Dehydrogenase (also seen as G3PDH) ) (GenBank accession no. M17701) forward = AGATGG TGAAGGTCGGTGTC, reverse = ACTG ACTG Acting
ACTG AIDS Clinical Trial Group
ACTG Actuating/Actuator
 TGGTCATGAGCCCTTC; cyclophilin B (GenBank accession no. AF071225) forward = CAAGCCACTGAAGGATGTCA, reverse = AAAATCAGGCCTGTGG AATG AATG American Association of Teachers of German ; Cytbl (GenBank accession no. J01435) forward = CGTCACAGCCCA TGCATTCG, reverse = CTGTTCATCC TGTTCCAGCTC.

The following primers, listed in the 5' to 3' direction, were used for RT-PCR verification of cisplatin-induced gene expression changes: Mipmk (GenBank accession no. NM_134417) forward = TG CCTGTCCACACTACATACA GATG, reverse = CGGCATI'TAGGAAT CCGTTCT; L-arginine glycine amidinotransferase (GenBank accession no. U07971) forward = CGAGGCGGTGC ACTACATC, reverse = GCACAGGAAT TTTGGGAGGAA; lipocalin/EST (GenBank accession no. NM_130741) forward = GCAGTGGCCTGATGGTTCA, reverse = GCACAGGAATTTTGGGA GGAA GGAA Greenhouse Gases and Animal Agriculture
GGAA Golden Gate Aviation Artists
GGAA Governor General's Academic Award (Canada) 
; synaptogyrin 2 (GenBank accession no. AI058493) forward = TGCTCG GCTCCCCACTT, reverse = CTGGAG ACGGTTGGCACAGT; Prosaposin (GenBank accession no. M19936) forward = ACTGCTGCCCGATGCAAT, reverse = AAGTAGGCGACTTCTGCAAGCT.

Western Blots

Samples of renal tissue were homogenized in 10 mM potassium homogenization homogenization (həmŏj'ənəzā`shən), process in which a mixture is made uniform throughout. Generally this procedure involves reducing the size of the particles of one component of the mixture and dispersing them evenly  buffer containing 250 mM sucrose, 1 mM EDTA EDTA: see chelating agents. , and 0.1 mM phenylmethylsulfonyl fluoride, adjusted to pH 7.6. Homogenates were centrifuged at 3,000 x g for 5 min and 9,000 x g for 15 min. The renal homogenates (50 [micro]g) were separated by electrophoresis on an 8% sodium dodecyl sulfate-polyacrylamide gel electrophoresis gel and transferred to a nitrocellulose nitrocellulose, nitric acid ester of cellulose (a glucose polymer). It is usually formed by the action of a mixture of nitric and sulfuric acids on purified cotton or wood pulp.  membrane in a transfer buffer (25 mM Tris, 192 mM glycine glycine (glī`sēn), organic compound, one of the 20 amino acids commonly found in animal proteins. Glycine is the only one of these amino acids that is not optically active, i.e. , and 20% methanol) at 100 volts at 4[degrees]C for 2 hr. The membranes were blocked in a TBST-20 buffer (10 mM Tris, 150 mM NaCl, and 10% nonfat dry milk Noun 1. nonfat dry milk - dehydrated skimmed milk
dried milk, dry milk, milk powder, powdered milk - dehydrated milk
) overnight and incubated with a 1:1000 dilution of primary antibodies raised against heine oxygenase oxygenase /ox·y·gen·ase/ (-jen-as) any oxidoreductase that catalyzes the incorporation of both atoms of molecular oxygen into a single substrate.

ox·y·gen·ase
n.
 1 (StressGen, Vancover, Canada) or KIM-1 (kindly provided by J. Bonventre, Massachusetts General Hospital Massachusetts General Hospital Health care The major teaching hospital for Harvard Medical School, widely regarded as one of the best health care centers in the world , Boston, MA) for 2 hr. The membrane was washed with the TBST-20 solution and incubated for 1 hr with a 1:2000 dilution of a horseradish horseradish

Hardy perennial plant (Armoracia lapathifolia) of the mustard family, native to Mediterranean lands and grown throughout the temperate zones. Its hotly pungent, fleshy root is used as a condiment and is traditionally considered medicinal.
 peroxidase-coupied second antibody. The membrane was washed with TBST-20 and then developed using enhanced chemiluminescence chemiluminescence /chemi·lu·mi·nes·cence/ (kem?i-loo?mi-nes´ens) luminescence produced by direct transformation of chemical energy into light energy.  (Pierce Chemical Co., Rockford, IL). Relative intensity of the bands was determined using UnScanit software (Silk Scientific, Inc., Orem, LIT).

Immunohistochemistry

Paraffin sections 3 lam thin were prepared and mounted on glass slides. The sections were deparaffinized, rehydrated, and permeabilized with hyaluronidase Hyaluronidase

Any one of a family of enzymes, also known as hyaluronate lyases or spreading factors, produced by mammals, reptiles, insects, and bacteria, which catalyze the breakdown of hyaluronic acid.
 (1 mg/mL) in a sodium acetate buffer. The sections were placed in an antigen-retrieval solution at 95[degrees]C for 45 min (Dako Corp., Carpenteria, CA) and nonspecific nonspecific /non·spe·cif·ic/ (non?spi-sif´ik)
1. not due to any single known cause.

2. not directed against a particular agent, but rather having a general effect.


nonspecific

1.
 binding was blocked with bovine serum albumin. The sections were incubated with a 1:200 dilution of a KIM-1 primary antibody (provided by J. Bonventre) or vimentin antibody, washed with Tris-buffered saline and exposed to a biotinylated second antibody for 1 hr. The sections were developed using an avidin-hiotin-peroxidase complex, counterstained with H&E, and viewed using a 60x oil objective.

Results

Clinical Chemistry and Urinalysis

Cisplatin. A summary of the clinical chemistry data for all three nephrotoxicants is presented in Table 1. The low dose (0.3 and 1 mg/kg) of cisplatin produced only minor changes in the histologic appearance of the kidney or clinical chemistry at any time point during the experiment. The high dose (5 mg/kg) of cisplatin had minimal effect on urine or serum chemistry relative to the values seen in the time-matched control animals injected with vehicle at 4, 24, and 48 hr (data not shown). However, 7 days after injection of the 5 mg/kg dose of cisplatin, plasma creatinine and serum BUN concentration were elevated by approximately 5-fold. Rats treated with the high dose of cisplatin exhibited glucosuria (elevated glucose/creatinine concentration ratio) indicative of proximal tubular injury. They also exhibited a 2-fold increase in urine protein and calcium concentration.

Gentamicin. Daily treatment of the rats with 2 and 10 mg/kg doses of gentamicin produced very little change in serum or urine clinical chemistry compared with the values seen in time-matched vehicle control animals at day 7 (Table 1). Urinary total protein was significantly increased (p < 0.001) in rats dosed at 80 mg/kg/day at 4 hr and at 7 days. They also exhibited an increase in urinary [Ca.sup.2+] concentration at 4 hr (p < 0.01) and 2, 3, and 7 days (p < 0.01) after administration of gentamicin (data not shown). Because the degree of renal injury was minimal in the strain of rat SD-ICS (Charles River Labs) used in the present studies, we repeated the study in three additional rats using a higher dose of gentamicin (240 mg/kg/day). This dose produced the expected severe renal injury as reflected by the marked increase in BUN and creatinine. These rats also exhibited a pronounced proteinuria and elevated levels of glucose and [Ca.sup.2+] in the urine (Table 1).

Puromycin. Rats treated with puromycin (20 mg/kg/day) for 21 days exhibited marked proteinuria (Table 1) and an elevation in urinary [Ca.sup.2+]. The chronic loss of protein in the urine was reflected by a dramatic fall in serum protein and albumin levels at day 21 in rats chronically exposed to 20 mg/kg/day puromycin. Despite the marked proteinuria, BUN and creatinine were not significantly elevated at any of the time points in the study, indicating that the glomerular filtration rate glomerular filtration rate
n. Abbr. GFR
The volume of water filtered out of the plasma through glomerular capillary walls into Bowman's capsules per unit of time.
 (GFR GFR - Grim File Reaper ) remained relatively normal in these rats.

Renal Histopathology his·to·pa·thol·o·gy
n.
The science concerned with the cytologic and histologic structure of abnormal or diseased tissue.


Histopathology
The study of diseased tissues at a minute (microscopic) level.


Cisplatin. The low dose (0.3 mg/kg) of cisplatin had very little effect on the histology of the kidney. Four of the five animals treated with the 1 mg/kg dose of cisplatin exhibited some degree of single-cell tubular necrosis and some mild tubular degeneration at 48 and 144 hr after administration of the compound. Rats treated with the high dose (5 mg/kg) of cisplatin exhibited severe proximal tubular necrosis and the formation of protein casts, especially in the pars recta rec·ta  
n.
A plural of rectum.
 of proximal tubules (Table 2; Figure 1A, B). There was also evidence of mild interstitial inflammation and edema edema (ĭdē`mə), abnormal accumulation of fluid in the body tissues or in the body cavities causing swelling or distention of the affected parts.  in both the renal cortex and outer medulla medulla: see brain stem. , and some glomeruli Glomeruli (singular, glomerulus)
Tiny tufts of capillaries which carry blood within the kidneys. The blood is filtered by the glomeruli. The blood then continues through the circulatory system, but a certain amount of fluid and specific waste products are filtered
 exhibited thickening of the basement membrane.

[FIGURE 1 OMITTED]

Gentamicin. Rats treated with gentamicin at 2 and 10 mg/kg/day exhibited no discernable renal pathology. Even the rats treated with the higher dose of gentamicin (80 mg/kg/day) exhibited only subtle compound-related changes in the histology of the kidney after 3 and 7 days of exposure (Table 2; Figure 1C, D). These changes included minimal degeneration of some proximal convoluted tubules, apoptosis, tubular basophilia basophilia /ba·so·phil·ia/ (ba?so-fil´e-ah)
1. abnormal increase of basophils in the blood.

2. reaction of immature erythrocytes to basic dyes, becoming blue to gray in color; stippling is seen in lead poisoning.
, tubular casts, increased mitotic figures, and mononuclear mononuclear /mono·nu·cle·ar/ (-noo´kle-er)
1. having but one nucleus.

2. a cell having a single nucleus, especially a monocyte of the blood or tissues.


mon·o·nu·cle·ar
adj.
 cellular infiltrates. Ultrastructural analysis revealed that one control animal had essentially normal proximal tubular epithelium, whereas another had hyaline hyaline /hy·a·line/ (hi´ah-lin) glassy and translucent.

hy·a·line
adj.
Resembling glass, as in translucence or transparency; glassy.

n.
1.
 droplets of different densities (Figure 1E). The proximal tubular epithelium of two treated animals exhibited large lysosomes lysosomes
(līssōmz),
n the self-contained organelles found inside most cells, which contain hydrolytic enzymes that aid in intracellular digestion.
 of varying density that accumulated lamellar lamellar /la·mel·lar/ (lah-mel´ar)
1. pertaining to or resembling lamellae.

2. lamellated (1).


lamellar

pertaining to or emanating from lamella.
 material forming typical myeloid myeloid /my·eloid/ (mi´e-loid)
1. medullary; pertaining to, derived from, or resembling bone marrow or the spinal cord.

2. having the appearance of myelocytes, but not derived from bone marrow.
 bodies (Figure 1F). In addition, all of the animals treated with 240 mg/kg/day gentamicin for 7 days exhibited severe proximal tubular necrosis and formation of protein casts in the proximal tubule.

Puromyein. There were minimal background findings in the control and treated groups, defined as less than three loci of the following: interstitial lymphocytic inflammatory infiltrates, interstitial fibrosis, tubular mineralization Mineralization
The process by which the body uses minerals to build bone structure.

Mentioned in: Rickets

mineralization,
n the bioprecipitation of an inorganic substance.
, and tubular cysts in the cortex or medulla. There was a dose-related minimal increase in severity of one or more of the following lesions: interstitial lymphocytic cellular infiltrate, glomerular sclerosis, lymphocytic perivascular perivascular /peri·vas·cu·lar/ (-vas´ku-lar) near or around a vessel.

perivascular

around a vessel.


perivascular cellulitis
 cellular infiltrate in the renal capsule, and tubular regeneration in one of five animals from each time point (Figure 2; Table 2). The most significant findings were dilation dilation /di·la·tion/ (di-la´shun)
1. the act of dilating or stretching.

2. dilatation.


di·la·tion
n.
1.
 of renal tubules, protein casts, expansion of the mesangial matrix material in the glomerulus, and focal segmental glomerulosclerosis focal segmental glomerulosclerosis
n.
Segmental collapse of glomerular capillaries with thickened basement membranes and increased mesangial matrix, seen sometimes in nephrotic syndrome or mesangial proliferative glomerulonephritis.
 in the rats treated with puromycin (20 mg/kg/day) for 21 days. In two of five rats there were multiple areas of involvement in the renal cortex, which occupied approximately 25-35% of the kidney. Sloughed tubular epithelial cells were sometimes present in the tubular lumen. However, the majority of the glomeruli appeared normal at the light microscopic level.

[FIGURE 2 OMITTED]

Identification of Tubular Toxicity Based on Gene Expression Changes

For each treatment (compound, dose, and time), genes with statistically significant expression changes were identified using the approach described by Bushel et al. (2001). Hierarchical clustering was used to aid in visualization and biological interpretation of this extensive data set, and in particular, to identify correlated expression patterns that reflect potential biological/toxicological processes occurring in the renal tissues of the animals treated with cisplatin, gentamicin, or puromycin at varying doses and time points. Hierarchical clustering, described by Eisen et al. (1998), was applied across the various treatment groups, doses, and time points, using a combined list of genes identified to be altered statistically significantly in at least one of the samples studied relative to control (Figure 3A, B). Using this approach, it was possible to extract correlated patterns and natural classes present in the data set that could be correlated with biological processes relevant to nephron segment-specific toxicity as well as gene expression alterations reflecting histopathological changes.

[FIGURE 3 OMITTED]

Hierarchical clustering revealed two distinct separations in experimental groups that correlated with the severity of renal toxicity. As shown in Figure 3A, the hierarchical order of the clustering tree indicated several correlations and allowed sample separation based on severity, region, and type of toxicity. For instance, the hierarchical ordering of gene expression changes by cisplatin (5 mg/kg/day, 24 and 144 hr), gentamicin (2, 10, 80, and 240 mg/kg/day, day 7), and puromycin (5 mg/kg/day, day 7; 20 mg/kg/day, days 1 and 7) fall within one node and are much more closely correlated compared with the remaining lower-dose, earlier time point samples. This separation in the expression patterns appeared to be correlated with the severity of the renal injury (based on changes in serum biochemistry and/or urinalysis changes or histopathology) and are linked to the treatment, dose, time, and severity of each of these compounds. The second major node separating the remaining treatment groups consists of samples associated with less prominent renal toxicity.

Clustering based on gene expression profiling of samples obtained from independent replicate experiments performed using the same compounds and protocols can reveal if there are variations in gene expression changes across studies. In Figure 3A, cisplatin 5 mg/kg, 144 hr (A) and cisplatin 5 mg/kg, 144 hr (B) represent renal gene expression changes observed based on two independent experiments performed with cisplatin in different groups of animals (A and B denote the first and second biological experiments, respectively). The gene expression changes observed in these two different experiments performed with cisplatin at 5 mg/kg/day were highly correlated, indicating minimal overall variability in gene expression changes across two independent in viva experiments, and hence the profiles clustered together.

Multidimensional visualization by PCA using all of the statistically altered renal gene expression changes was used to observe the spatial distribution of the treatment groups in multidimensional space (Figure 3C). This approach offers an opportunity to visualize expression patterns that can reflect similarities in biological responses. The visualization of high-dimensional data in two- or three-dimensional principal components reveals unsupervised clusters within the data. Samples can be scored using the results of a PCA on known samples, and these scores may place the unknown into one of the previously identified dusters where gene expression changes are clearly linked to biological/pathological events. As shown in Figure 3C, three major separations of the various treatment groups were evident. The first includes treatment groups in which severe renal proximal tubular toxicity was observed (cisplatin 5 mg/kg, 24 and 144 hr). The data from these groups were clearly separated from early time points after exposure to cisplatin and from the low-dose samples where no histologic evidence of tubular injury were observed. In addition, the second principal component shows separation of the high-dose cisplatin data with tubular injury from the puromycin data that exhibited marked proteinuria and glomerular toxicity.

The samples analyzed by microarrays in these experiments consisted of pooled samples. However, we further characterized the response of individual animals at one dose/time point for cisplatin (Thompson et al. 2004) and for gentamicin (day 7) and compared the response of these animals to the animals from a related, biologically replicated experiment. In the gentamicin replicate experiment, the results from animals dosed with 240 mg/kg of gentarnicin for 7 days (to produce severe injury) were compared with the results obtained using the 80-mg!kg dose for 7 days in the initial experiment. The higher dose (240 mg/kg) resulted in the expected severe proximal tubular necrosis and proteinuria. Although not identical, the overall changes in renal gene expression observed after treatment with 240 mg/kg compared with 80 mg/kg gentamicin for 7 days were still closely correlated and hence clustered together despite the less severe changes in renal histology and threshold changes in the urinary excretion of protein, glucose, and [Ca.sup.2+] observed after treatment with 80 mg/kg gentamicin (Figure 4).

[FIGURE 4 OMITTED]

The power of microarray analysis is that it allows elucidation of groups of genes that correlate with certain expression patterns that accompany particular types of biological effects. Analysis of groups or clusters of genes that contribute to similar pathways/functions may be more robust than focusing on a single gene. In addition, gene clusters may be used to identify known and novel putative gene-based markers of renal toxicity and can potentially direct future research to validate these putative gene-based markers in urine/ serum using animal and clinical models. Figure 5 shows a group of genes strongly downregulated in samples that exhibited proximal tubular necrosis. Many of these genes are functionally localized to the proximal tubules, further strengthening the hypothesis that regional-specific toxicity may be discerned through analysis of gene expression patterns (Table 3). Interestingly, the puromycin samples showed similar downregulation of some of these genes, indicating that tubular toxicity may have occurred from this treatment. Indeed, upon further histopathological evaluation, the less prominent tubular toxicity was observed in the rats receiving the higher dose of puromycin for 21 days (Figure 4).

[FIGURE 5 OMITTED]

Elucidation and Verification of Putative Biomarkers

One of the intended outcomes of these studies was the elucidation of putative new sensitive biomarkers of nephrotoxicity. We examined the significantly changed genes for those that displayed induction in a dose- and time-dependent manner for further verification in this study. Figure 6 shows a grouping of genes after high-dose cisplatin and gentamicin treatment that appear to be upregulated in a dose- and time-dependent fashion. Overlap of these genes on clusters derived from both the NIEHS and Affymetrix microarrays indicate several potential biomarkers of renal toxicity/repair, including KIM-1, osteopontin, vimentin, and several ESTs (Figure 6).

[FIGURE 6 OMITTED]

Multiple approaches were used to robustly determine and confirm the expression changes observed in the present microarray studies. First, the genes that were differentially modulated were defined using the approach of Chen et al. (1997) that employs a specified confidence level (95% in the present study) for determining differentially expressed genes. Second, to reduce false positives, replicate hybridizations (typically n = 4, with reverse labeling) were performed using the pooled samples and/or biological replicates, and a binomial distribution was used to model the results of the analyses at given confidence levels. Third, dye reversal was used to avoid false positives due to biases in Cy-dye-specific incorporation for specific genes, and genes with highly variable expression changes across hybridizations were flagged because of a large coefficient of variation Coefficient of Variation

A measure of investment risk that defines risk as the standard deviation per unit of expected return.
 or a modified z-score computation to detect outliers (Bushel et al. 2001, 2002). Therefore, examination of the data from these repeated hybridizations yielded lists of genes that were statistically validated as differentially expressed.

In addition, several of the observed gene expression changes identified in the present study were confirmed using alternate approaches, including RT-PCR, in situ hybridization in situ hybridization A method for localizing a sequence of DNA, mRNA, or protein in a cell or tissue; the use of a DNA or RNA probe to detect a cDNA sequence in chromosome spreads or in interphase nuclei or an RNA sequence of cloned bacterial or cultured , immunohistochemistry, and/or Western blot analysis West·ern blot analysis
n.
An electrophoretic procedure for separating proteins.
. As shown in Table 4, RT-PCR analysis was performed using kidney RNA isolated from rats treated with cisplatin for 24 hr or 144 hr or gentamicin exposed for 7 days. Genes changed with microarray were generally in qualitative agreement when determined using RT-PCR. The expression of genes known to be implicated in the mechanism(s) of renal toxicity that were confirmed include kallikrein, heme oxygenase 1, clusterin, osteopontin, and KIM-1 (Table 4; Figure 7A). In addition, several genes for which there is limited understanding of a role in renal toxicity were validated. These include inositol polyphosphate polyphosphate

a chemical preservative used as a 2 to 4% solution in the treatment of meat.
 multikinase and L-arginine-glycine amidinotransferase. In addition to RT-PCR verification, heme oxygenase and KIM-1 protein expression in rat kidney after cisplatin treatment was confirmed by Western blot analysis (Figure 7A-D A-D

Advance-Decline, or measurement of the number of issues trading above their previous closing prices less the number trading below their previous closing prices over a particular period.
). Using in situ hybridization, expression of KIM-1 was confirmed to be increased in the proximal tubule after exposure to cisplatin (Figure 8B). Increased vimentin expression was also confirmed by immunohistochemistry (Figure 8D).

[FIGURE 7-8 OMITTED]

RT-PCR verification of two ESTs identified to be induced in rat kidney after exposure to 5 mg/kg cisplatin for 144 hr was also performed. Lipocalin 2 (LCN LCN La Cosa Nostra
LCN London Cycle Network (UK)
LCN Logical Channel Number
LCN Low Copy Number (DNA or RNA quantity)
LCN Local Computer Network
LCN Logical Cluster Number
LCN Load Classification Number
2) (GenBank accession no. AA946503) expression was initially identified in cisplatin gene expression data generated with the same RNA on an Affymetrix platform (data not shown). In fact, the expression of LCN2 was similar to that observed for KIM-1. Induction of KIM-1 expression after cisplatin treatment was confirmed by in situ hybridization, RT-PCR, and Western blot analysis (Figure 7). The increased expression of another EST (GenBank accession no. AA957270; now known as a tumor necrosis factor tumor necrosis factor
n. Abbr. TNF
A protein that is produced in the presence of an endotoxin, especially by monocytes and macrophages, is able to attack and destroy tumor cells, and exacerbates chronic inflammatory diseases.
 (TNF TNF
abbr.
tumor necrosis factor


TNF,
n an abbreviation for tumor
necrosis
f
) receptor superfamily superfamily /su·per·fam·i·ly/ (soo´per-fam?i-le)
1. a taxonomic category between an order and a family.

2.
, member 12a, or Tweak receptor) was verified using RT-PCR (Table 4). The role of Tweak receptor in mediating cisplatin renal toxicity remains to be determined.

Discussion

In this study, we used cDNA microarrays to examine temporal changes in gene expression patterns in the kidney after treatment of rats with cisplatin, gentamicin, and puromycin, three nephrotoxicants that primarily injure the proximal tubule (cisplatin and gentamicin) or the glomerulus (puromycin) via different mechanisms of action. The results of our microarray study are consistent with numerous reports of the modulation in expression of various mRNA after renal injury induced by cisplatin, gentamicin, or puromycin (Girton et al. 2002; Huang et al. 2001). For instance, using data from cisplatin treatment, it was possible for us to functionally annotate annotate - annotation  gene expression changes to various previously published and novel categories. These categories include biochemical pathways related to creatinine biosynthesis Biosynthesis

The synthesis of more complex molecules from simpler ones in cells by a series of reactions mediated by enzymes. The overall economy and survival of the cell is governed by the interplay between the energy gained from the breakdown of compounds
, osmoregulation osmoregulation /os·mo·reg·u·la·tion/ (-reg?u-la´shun) adjustment of internal osmotic pressure of a simple organism or body cell in relation to that of the surrounding medium. , kinase signaling, cell cycle-related genes, renal transporters, renal injury, and regenerative responses, as well as gene expression changes related to drug metabolism, detoxification, and drug resistance.

For example, we detected a reduction in the expression of L-arginine-glycine amidinotransferase and guanidinoacetate methyltransferase at days 1 and 6, respectively, after treatment with 5 mg/kg cisplatin, a dose that induced renal lesions. Mapping of these gene products to a biochemical pathway points to a role for them in the formation of creatinine from L-arginine (see map in Kramer et al. 2004). Creatinine is formed from creatine creatine /cre·a·tine/ (kre´ah-tin) an amino acid occurring in vertebrate tissues, particularly in muscle; phosphorylated creatine is an important storage form of high-energy phosphate.  and excreted by the kidneys. Traditionally, measurements of increased serum urea and creatinine are used clinically as indices of changes in glomerular filtration rate. However, they are relatively insensitive markers of glomerular injury, as typically up to 75% of nephrons have to be nonfunctional before there are significant elevations in serum levels of BUN or creatinine. Although ours is the first study to demonstrate the modulation in the expression of these genes in rat kidney after cisplatin treatment, Lee et al. (1998) demonstrated that cisplatin alters the expression of L-arginine-glycine amidinotransferase and guanidinoacetate methyltransferase in the male rat reproductive tract. Using Western blot analysis, Lee et al. (1998) demonstrated that L-arginine-glycine amidinotransferase is also expressed in the rat kidney and guanidoacetate methyltransferase mRNA is expressed in the kidneys, testes testes
 or testicles

Male reproductive organs (see reproductive system). Humans have two oval-shaped testes 1.5–2 in. (4–5 cm) long that produce sperm and androgens (mainly testosterone), contained in a sac (scrotum) behind the penis.
, and epididymis epididymis /ep·i·did·y·mis/ (-did´i-mis) pl. epididy´mides   [Gr.] an elongated cordlike structure along the posterior border of the testis; its coiled duct provides for storage, transit, and maturation of spermatozoa and is  of rats. More recently Yasuda et al. (2000) demonstrated decreases in urinary concentrations of guanidinoacetic acid, creatinine, and creatine after cisplatin treatment. These studies also suggested that production of guanidinoacetic acid, a precursor of creatinine that is affected by metabolic disturbance when kidney function is damaged, may be a marker of renal damage. Our studies revealed that there was a marked decrease in the expression of L-arginine-glycine amidinotransferase in the kidney as early as day 1 after cisplatin treatment. The biochemical outcome expected from inhibition of L-arginine-glycine amidinotransferase would be a decrease in the formation of guanidoacetic acid. It is possible that this renal molecular response, in part, may precede or may correlate with the decrease in urinary excretion of guanidoacetic acid reported by Yasuda et al. (2000). Decreased renal expression of Larginine-glycine amidinotransferase in rats treated with 1 mg/kg, a dose of cisplatin that resulted in mild pathological changes, was evident at day 6 but not at day 1, presumably pre·sum·a·ble  
adj.
That can be presumed or taken for granted; reasonable as a supposition: presumable causes of the disaster.
 reflecting a later onset of toxicity. In contrast, treatment with 5 mg/kg cisplatin decreased the expression of L-arginine-glycine amidino transferase expression at day 1, and downregulation of guanidinoacetate methyltransferase was most prominent after 6 days. The temporal differences in the modulation of two genes in the same biochemical pathway is unclear; however, it may be indicative of progression of toxicity and biochemical feedback mechanisms to compensate for altered creatinine clearance. L-arginine-glycine amidinotransferase was also downregulated in renal tissue of rats treated with gentamicin and puromycin, further implicating the potential importance of this pathway in overall response to renal toxicity. Altered expression of these genes is likely to reflect an altered protein product (not determined in the present studies). This suggests that inhibition of these enzymes may lead to an increase in levels of arginine arginine (är`jənĭn), organic compound, one of the 20 amino acids commonly found in animal proteins. Only the l-stereoisomer participates in the biosynthesis of proteins. , an immediate substrate for nitric oxide synthase The nitric oxide synthase (NOS; EC 1.14.13.39) is an enzyme in the body that contributes to transmission from one neuron to another, to the immune system and to dilating blood vessels.  (NOS), producing a nitric oxide (NO) precursor that can lead to the formation of NO. A role for NO has been implicated in models of renal injury (Srivastava et al. 1996), and L-arginine has been demonstrated to be both protective (Andoh et al. 1997) and harmful (Tome et al. 1999) in models of renal injury. The authors speculate that although the initial effects of NO formation after renal injury may be beneficial, the prolonged inhibition of the L-arginine pathway may contribute to renal damage because of excessive buildup of NO, which has been implicated in numerous renal pathologies (Valdivielso and Blantz 2002). NO is an important regulator of renal vascular tone and can modulate renal blood flow In the physiology of the kidney, renal blood flow (RBF) is the volume of blood delivered to the kidneys per unit time. In humans, the kidneys together receive roughly 20% of cardiac output, amounting to 1 L/min in a 70-kg adult male. , glomerular hemodynamics hemodynamics /he·mo·dy·nam·ics/ (-di-nam´iks) the study of the movements of blood and of the forces concerned.hemodynam´ic

he·mo·dy·nam·ics
n.
, and the contractility contractility /con·trac·til·i·ty/ (kon?trak-til´i-te) capacity for becoming shorter in response to a suitable stimulus.

contractility

a capacity for becoming short in response to suitable stimulus.
 of mesangial cells. In addition, NOS is present in the renal tubular segments and the juxtaglomerular apparatus and may enhance the renal damage incurred after nephrotoxicant administration.

The expression of kallikrein decreased in the kidney after gentamicin (80 mg/kg/day, 7 days) (Table 4). Kallikrein is a serine protease that cleaves kininogen to produce kinin kinin /ki·nin/ (ki´nin) any of a group of vasoactive straight-chain polypeptides formed by kallikrein-catalyzed cleavage of kininogens; causing vasodilation and also altering vascular permeability. , a vasoactive vasoactive /vaso·ac·tive/ (va?zo-) (vas?o-ak´tiv) exerting an effect upon the caliber of blood vessels.

va·so·ac·tive
adj.
 and natriuretic peptide (Clemems 1989; Schmaier 2003). Kallikrein is produced and secreted in distal nephron segments and has been implicated in the control of sodium and water excretion and the long-term control of arterial pressure. More recently, kallikrein has also been implicated in determining the pathogenesis of renal injury after administration of nephrotoxicants. For example, Murakami et al. (1998): reported that systemic transfection trans·fec·tion
n.
Infection of a bacterium or cell with DNA or RNA isolated from a bacteriophage or from an animal or a plant virus, resulting in replication of the complete virus.
 of the kidney with an adenovirus adenovirus

Any of a group of spheroidal viruses, made up of DNA wrapped in a protein coat, that cause sore throat and fever in humans, hepatitis in dogs, and several diseases in fowl, mice, cattle, pigs, and monkeys.
 expressing kallikrein attenuates the development of gentamicin-induced nephrotoxicity in rats. Murakami et al. (1998) suggest that the renoprotective effect of kallikrein gene delivery may be related to the ability of kinins to activate phospholipase A and prevent phospholipidosis, which is characteristic of gentamicin toxicity. In addition, recent studies have revealed that urinary kallikrein levels are reduced and there are polymorphisms in the kallikrein gene in patients with renal disease (Yu et al. 2000, 2002). These results suggest the potential utility of gene expression profiling to identify genes and pathways that may play a role in determining the genetic susceptibility to nephrotoxicity (toxicogenomics).

Puromycin treatment, in the present studies, was associated primarily with glomerular toxicity, in addition to the less prominent proximal tubular toxicity. Numerous genes were identified as upregulated or downregulated at various doses and time points after puromycin treatment. Examples of genes upregulated primarily at 24 hr after treatment with 5 mg/kg puromycin include serum amyloid amyloid /am·y·loid/ (am´i-loid)
1. starchlike; amylaceous.

2. the pathologic, extracellular, waxy, amorphous substance deposited in amyloidosis, being composed of fibrils in bundles or in a meshwork of polypeptide
 p-component (GenBank accession no, AA819447) and dentin dentin /den·tin/ (den´tin) the chief substance of the teeth, surrounding the tooth pulp and covered by enamel on the crown and by cementum on the roots.den´tinal

adventitious dentin  secondary d.
 siatophosphoprotein (GenBank accession no. AA899472; discussed below), dihydropyrimidinase (GenBank accession no. Al111911), cathepsin cathepsin /ca·thep·sin/ (kah-thep´sin) one of a number of enzymes each of which catalyzes the hydrolytic cleavage of specific peptide bonds.  H (GenBank accession no. AA819336), cathepsin B (GenBank accession no. AA963225), alcohol dehydrogenase (GenBank accession no. AA875140), solute solute /so·lute/ (sol´ut) the substance dissolved in solvent to form a solution.

sol·ute
n.
 carrier) family 4, member 4 (SLC (Subscriber Loop Carrier) Lucent's designation for its digital loop carrier (DLC) products. See digital loop carrier. See also 386SLC. 4A4; GenBank accession no. Al144995), macrophage inflammatory protein This article is about proteins. For the chemical compound CCl4, see Carbon tetrachloride.

Macrophage Inflammatory Proteins (MIP) belong to the family of chemotactic cytokines known as chemokines.
 1-alpha (Mip-1-alpha; GenBank accession no. AA924105), interferon, alpha inducible protein 27-like (GenBank accession no. AA955996), retinol binding protein Retinol binding proteins are a family of proteins with diverse functions. They are carrier proteins which bind retinol. Genes
  • Cellular: RBP1, RBP2, RBP5, RBP7
  • Interstitial: RBP3
  • Plasma: RBP4
 (GenBank accession no. AA860061), and glucose-6-phosphatase (GenBank accession no. AA964628). An increase in expression of transporter genes may function to facilitate reuptake reuptake /re·up·take/ (re-up´tak) reabsorption of a previously secreted substance.

re·up·take
n.
 of solutes and small molecules passing through the damaged glomerulus. Solute carrier family The SoLute Carrier (SLC) group of membrane transport proteins include over 300 members organized into 47 families.[1] The SLC gene nomenclature system was originally proposed by the Human Genome Organization (HUGO) and is the basis for the official HUGO names of the  4, for example, is involved in the coupled movement of sodium and bicarbonate; the expression of this gene may be among the renal responses for maintaining solute homeostasis homeostasis

Any self-regulating process by which a biological or mechanical system maintains stability while adjusting to changing conditions. Systems in dynamic equilibrium reach a balance in which internal change continuously compensates for external change in a feedback
 during renal injury. Cathepsins are primarily cysteine-dependent lysosomal lysosomal

pertaining to or emanating from lysosomes.


lysosomal enzymes
enzymes located in the lysosomes.

lysosomal phospholipidosis
 proteases and play an important role in protein degradation and turnover. The authors speculate that the upregulation of cathepsin genes may be a compensatory response to allow for protein degradation as the nephron compensates for proteinuria by increasing protein reuptake associated with glomerular toxicity. In addition to the genes described above, retinol-binding protein was upregulated in the present study and retinol-binding protein mRNA is known to be expressed in rat proximal tubules (Makover et al. 1989). It is likely that the induction of retinol-binding protein may be in response to increased urinary loss associated with glomerular and/or tubular toxicity. Recent studies demonstrate that urinary retinal-binding protein has been investigated as a prognostic marker of proximal tubular dysfunction in patients with glomerulopathies (Kirsztajn et al. 2002).

In contrast to the observed upregulation of dentin sialophosphoprotein at 24 hr after treatment with 5 mg/kg/day puromycin, dentin sialophosphoprotein was among some of the more downregulated genes at 24 hr after treatment with 20 mg/kg puromycin. Acidic nuclear phosphoprotein phosphoprotein /phos·pho·pro·tein/ (-pro´ten) a conjugated protein in which phosphoric acid is esterified with a hydroxy amino acid.

phos·pho·pro·tein
n.
 32 (GenBank accession no. AI070967), L-glycine arginine amidinotrausferase (GenBank accession no. AA900287, discussed earlier), and cytosolic epoxide hydrolase (GenBank accession no. AA819830) were downregulated at 24 hr after treatment with 20 mg/kg puromycin. Although the role of these genes in the molecular responses to glomerular toxicity is unclear, the downregulation of some of these genes (i.e., cytosolic epoxide hydrolase, acidic nuclear phosphoprotein 32) was observed at both 24 hr and after 7 days of treatment with 20 mg/kg/day of puromycin. Hydrolases have been identified in rat glomerular mesangial ceils and have been implicated in glomerulonephritis glomerulonephritis: see nephritis.  (Nakao et al. 1999).

Renal lesions induced by cisplatin, gentamicin, and puromycin generally occur in discrete anatomical regions (e.g., tubular or glomerular components), although as observed in this study, injury can diffuse to additional regions of the nephron when toxicity is severe. Discrete toxicity to an organ with site-selective functional capacity suggests that observed changes of the biochemical properties of the affected renal region can provide pertinent information regarding the molecular outcome of the lesion. To take advantage of this in facilitating the interpretation of mRNA expression changes in our study, we used the published literature related to enzymology en·zy·mol·o·gy
n.
The branch of science that deals with the biochemical nature and activity of enzymes.



enzymology

the study of enzymes and enzymatic action.
 of kidney tissue to compile information regarding the expression of specific genes within specific regions of the nephron, particularly within various tubular segments (Table 3) (Mattenheimmer 1968; WHO 1991). As shown in Figure 4, decreased expression of several mRNAs was detected by microarray profiling, particularly in kidneys of rats treated with cisplatin (5 mg/kg, day 6) and to a lesser extent after gentamicin treatment (80 mg/kg/day, day 7). One explanation could be that the loss of expression of these RNAs could, in part, reflect massive injury and death of proximal tubular cells. Although necrosis of tubular segments was confirmed histologically after treatment with each of the three compounds, it varied in severity (cisplatin > gentamicin > puromycin). One important point to highlight is that the large grouping of genes that are downregulated and grouped together in the clustering diagram (Figure 5) could, as a group, serve as a sensitive diagnostic indicator of proximal tubular damage. We confirmed this by using this set of genes to correctly predict puromycin-induced proximal tubular injury before histopathological analysis was conducted. Further work will be needed to validate the regulation of the expression of these genes during regenerative/repair processes.

This work further highlights the application of microarray in identifying putative biomarkers of injury. For practical considerations in detection assays, it may be most useful to consider those genes that have low expression in control tissue but are induced/ upregulated with damage. In this article we have identified several potential biomarkers that appear to be upregulated in a dose- and time-dependent manner upon injury. These include KIM-1, osteopontin, clusterin, and several ESTs, including two that were recently defined, LCN2 and TNF receptor superfamily, member 12a (Tweak receptor). Although our study confirmed that the expression levels of these genes did increase in the kidney, further work will be needed to truly validate these as biomarkers of nephrotoxicity. Studies to investigate reversibility, specificity, and sensitivity will be needed as part of this validation (Kramer et al. 2004). One of these gene products, KIM-1, is a membrane-spanning protein cleaved cleaved (klevd) split or separated, as by cutting.  on the extracellular surface after tubular injury (Bailly et al. 2002). In addition, antibodies to KIM-1 are now being used to measure protein levels in human urine after renal ischemic Ischemic
An inadequate supply of blood to a part of the body, caused by partial or total blockage of an artery.

Mentioned in: Antiangiogenic Therapy, Subarachnoid Hemorrhage, Ventricular Fibrillation


ischemic
 injury (Han et al. 2002). This study indicates that KIM-1 may indeed be a specific marker of tubular injury, which could provide a more sensitive indication of damage compared with traditional clinical measurements (Han et al. 2002). As mentioned earlier, RT-PCR verification of two ESTs induced after exposure to 5 mg/kg cisplatin for 144 hr was performed. Tweak receptor, or TNF receptor superfamily, member 12 (GenBank accession no. AA957270), belongs to the TNF receptor superfamily. Death ligands and receptors such as TNF participate in apoptosis regulation in the course of renal injury (Ortiz et al. 2001), and its induction is likely involved in apoptotic signaling and regulatory mechanisms contributing to cisplatin-induced renal injury. LCN2 (GenBank accession no. AA946503) was identified as a putative biomarker of kidney injury based on the similarity of its expression pattern to KIM-1.

The human homolog hom·o·log  
n.
Variant of homologue.
 of LCN2 is neutrophil-associated lipocalin (NGAL NGAL Neutrophil Gelatinase-Associated Lipocalin (protein) ) and the mouse homolog is 24P3. LCN2 has been implicated in the regulation of cell homeostasis and immune response and can function as a carrier protein for the general clearance of endogenous and exogenous compounds (Flower 1996; Flower et al. 2000; Yang et al. 2003). Lipocalin products have been found in neutrophilic neutrophilic /neu·tro·phil·ic/ (-fil´ik)
1. pertaining to neutrophils.

2. stainable by neutral dyes.


neutrophilic

1. pertaining to neutrophils.

2. stainable by neutral dyes.
 granules Granules
Small packets of reactive chemicals stored within cells.

Mentioned in: Allergic Rhinitis, Allergies
 and may play a role in apoptosis (Devireddy et al. 2001; Yang et al. 2003). NGAL/24p3 expression has also been detected in inflamed epithelia ep·i·the·li·a  
n.
A plural of epithelium.
 (Nielsen et al. 1996), perhaps explaining that the appearance of this transcript may be related to the damage occurring in the renal tubules and the accompanying infiltrates observed histopathologically. Relevant to the present studies is the role implicated for lipocalin superfamily members (i.e., NGAL/24p3) in inducing the formation of kidney epithelia (Yang et al. 2003). However, the underlying molecular signaling mechanism(s) are not fully known. NGAL protein has been identified as a complex with matrix metalloproteinases in urine of patients with cancer (Yan et al. 2001). Lipocalin-type prostaglandin D synthase synthase /syn·thase/ (-thas) a term used in the names of some enzymes, particularly lyases, when the synthetic aspect of the reaction is dominant or emphasized.

syn·thase
n.
 (also known as L-PGDS or [beta]-trace) is another member of the lipocalin family (Hoffmann et al. 1993; Nagata et al. 1991), and elevated serum and urinary levels of [beta]-trace (L-PGDS) have been observed in patients with renal failure (Hoffmann et al. 1997; Melegos et al. 1999). L-PGDS is a secretory secretory /se·cre·to·ry/ (se-kre´tah-re) (se´kre-tor?e) pertaining to secretion or affecting the secretions.

se·cre·to·ry
adj.
Relating to or performing secretion.
 glycoprotein glycoprotein (glī'kōprō`tēn), organic compound composed of both a protein and a carbohydrate joined together in covalent chemical linkage.  that catalyzes the isomerization isomerization /isom·er·iza·tion/ (i-som?er-i-za´shun) the process whereby any isomer is converted into another isomer, usually requiring special conditions of temperature, pressure, or catalysts.  of a precursor of prostanoids, prostaglandin (PG) H2, to produce prostaglandin D-2 (Urade and Hayaishi 2000). Oda et al. (2002) developed and evaluated an enzyme-linked immunosorbent assay enzyme-linked immunosorbent assay
n.
ELISA.


Enzyme-linked immunosorbent assay (ELISA)
A diagnostic blood test used to screen patients for AIDS or other viruses.
 (ELISA ELISA (e-li´sah) Enzyme-Linked Immuno-Sorbent Assay; any enzyme immunoassay using an enzyme-labeled immunoreactant and an immunosorbent.

ELISA
n.
) method to screen for human urinary L-PGDS. Using this method, Oda et al. determined that L-PGDS excretion was significantly increased in patients with renal disease, even in the absence of increases in serum creatinine. Therefore, its ability to be monitored in urine of patients (Yan et al. 2001) and, in particular, the ability to monitor L-PGDS (a member of the lipocalin family) in urine of patients with epithelial renal disease warrants its further evaluation in models of renal injury. This premise is confirmed in these studies. In addition to the ESTs described above, the expression of several other ESTs (e.g., GenBank accession nos. AA819209, AA899472, and AA899737) were commonly modulated by cisplatin and gentamicin at doses that caused proximal tubular toxicity. In most instances, the expression of these ESTs correlated with severity of proximal tubular injury, and hence, expression was more robust in cisplatin-treated compared with gentamicin-treated rats with tubular toxicity. For instance, one of the ESTs (GenBank accession no. AA899472) appears to have weak similarity to dentin phosphoprotein precursor/dentin sialoprotein (DSP (1) (Digital Signal Processor) A special-purpose CPU used for digital signal processing applications (see definition #2 below). It provides ultra-fast instruction sequences, such as shift and add, and multiply and add, which are commonly used in math-intensive ), whose role in response to renal tubular injury has not been previously studied. DSP is a 53-kDa protein that has an overall composition similar to that of the sialoprotein osteopontin (Ritchie et al. 1994). An increase in level of osteopontin mRNA expression in the present studies was observed with cisplatin and gentamicin treatment (Figure 3B) [for RT-PCR validation data, refer to Thompson et al. (2004)]. Although little is known about the function/role of DSP in response to renal injury,, an increase in the expression of osteopontin in proximal tubular epithelium has been demonstrated in human and animal models of renal injury and can be associated with monocyte monocyte /mono·cyte/ (mon´o-sit) a mononuclear, phagocytic leukocyte, 13µ to 25µ in diameter, with an ovoid or kidney-shaped nucleus, and azurophilic cytoplasmic granules.  or macrophage macrophage /mac·ro·phage/ (mak´ro-faj) any of the large, mononuclear, highly phagocytic cells derived from monocytes that occur in the walls of blood vessels (adventitial cells) and in loose connective tissue (histiocytes, phagocytic  infiltration (Hudkins et al. 2001; Magil et al. 1997; Pichler et al. 1995). Khan et al. (2002) reported concomitant renal expression and urinary excretion of osteopontin in a rat model of ethylene glycol-induced calcium oxalate nephrolithiasis. Expression of osteopontin protein and mRNA in proximal tubular epithelium has been reported in absence of prominent macrophage influx in both pretransplant donor biopsies and biopsies with cyclosporine cyclosporine /cy·clo·spor·ine/ (-spor´en) a cyclic peptide from an extract of soil fungi that selectively inhibits T cell function; used as an immunosuppressant to prevent rejection in organ transplant recipients and to treat severe  toxicity (Hudkins et al. 1999, 2001).

Induction of clusterin expression in these studies was observed after cisplatin-and gentamicin-induced renal injury and has great potential to be used as a biomarker of nephrotoxicity. Clusterin is a secreted heterodimeric glycoprotein that circulates in blood at concentrations of 50-300 [micrp]g/mL (Rosenberg and Silkensen 1995a, 1995b). Clusterin has been induced in a variety of models of renal tubular injury and/or remodeling remodeling /re·mod·el·ing/ (re-mod´el-ing) reorganization or renovation of an old structure.

bone remodeling
 after treatment with cisplatin (Huang et al. 2001; Silkensen et al. 1997) as well as in tubular epithelial cells, in response to proteinuria, in kidneys of nephrotic nephrotic /ne·phrot·ic/ (ne-frot´ik) pertaining to, resembling, or caused by nephrosis.  rats (Correa-Rotter et al. 1998) after puromycin treatment. Depletion of clusterin enhances immune glomerular injury in the isolated perfused kidney (Saunders et al. 1994), and mice deficient in clusterin are more susceptible to injury due to immunocomplexes (Rosenberg et al. 2002). Urinary and serum clusterin levels have been studied in various models of renal injury (Aulitzky et al. 1992) and may play a role in early detection of renal injury. Clearly, the potential use of clusterin as a biomarker of nephrotoxicity has to be confirmed.

Numerous efforts are ongoing to identify and validate markers of renal function and injury in rodent and human models. Muramatsu et al. (2002) demonstrated that cysteine-rich protein 61, a secreted growth factor-inducible immediate early gene, is induced in proximal straight tubules of rodents within 2 hr of renal ischemia and can be detected in rat urine as early as 3-6 hr after renal injury. Cystatin C is a 13-kDa plasma protein that inhibits cysteine cysteine (sĭs`tēn), organic compound, one of the 20 amino acids commonly found in animal proteins. Only the l-stereoisomer participates in the biosynthesis of mammalian protein.  proteases and is freely filtered at the glomerulus. Cystatin C appears to have improved diagnostic accuracy compared with creatinine measurements as a serum marker of GFR (Christensson et al. 2003; Laterza et al. 2002; Newman 2002). Oda et al. (2002) have demonstrated the utility of monitoring lipocalin-type urinary [beta]-trace in patients with renal disease. Star et al. (2002) noted that the approach described in the article by Oda et al. (2002) for developing and evaluating an ELISA-based approach for lipocalin-type urinary J-trace provides valuable insight into efforts that need to be undertaken to translate a novel marker into a valuable -laboratory assay.

In conclusion, this study indicates that gene expression arrays may be used to discern regional specific damage of nephrotoxicity. Additionally, this study provides a foundation for opportunities that exist to apply gene expression profiling to begin identifying novel markers of renal toxicity. Further expansion of these analyses may lead to the identification of groups of genes that could ultimately result in the detection of sensitive markers of renal damage. Traditional measures of renal damage, such as proteinuria, creatinine clearance, and elevated BUN, usually occur after significant kidney damage has occurred. Elucidation and validation of new sensitive markers could help clinicians more efficiently monitor patients who are administered potentially nephrotoxic nephrotoxic /neph·ro·tox·ic/ (nef´ro-tok?sik) destructive to kidney cells.
Nephrotoxic
Toxic, or damaging, to the kidney.
 drugs.
Table 1. Changes in serum and urine chemistry and organ weights 7 days
after cisplatin and gentamicin treatment 21 days after puromysin

treatment. (a)
                                                           Serum
Cisplatin
dose          Body weight             Kwt                   Cr
(mg/kg)           (g)                 (g)                 (mg/dL)

Vehicle     279 [+ or -] 7     2.5 [+ or -] 0.1     0.30 [+ or -] 0.01
0.3         288 [+ or -] 8     2.7 [+ or -] 0.1     0.24 [+ or -] 0.02
1           289 [+ or -] 10    2.7 [+ or -] 0.1     0.22 [+ or -] 0.04
5           252 [+ or -] 3 *   2.7 [+ or -] 0.3      1.4 [+ or -] 0.4 *

Gentami-
cin dose
(mg/kg/
day)

Vehicle     269 [+ or -] 7     2.0 [+ or -] 0.1     0.19 [+ or -] 0.02
2           278 [+ or -] 8     2.1 [+ or -] 0.1     0.15 [+ or -] 0.02
10          280 [+ or -] 6     2.1 [+ or -] 0.1     0.16 [+ or -] 0.03
80          264 [+ or -] 7     2.2 [+ or -] 0.2     0.16 [+ or -] 0.03
240         252 [+ or -] 8     3.2 [+ or -] 0.2 *    1.9 [+ or -] 0.1 *

Puromycin
dose
(mg/kg)

Vehicle     269 [+ or -] 7     2.0 [+ or -] 0.1     0.19 [+ or -] 0.02
5           278 [+ or -] 8     2.1 [+ or -] 0.1     0.15 [+ or -] 0.02
10          280 [+ or -] 6     2.1 [+ or -] 0.1     0.16 [+ or -] 0.03

                 Serum
Cisplatin                                          Urine
dose              BUN
(mg/kg)         (mg/dL)             Glucose/Cr            Prot/Cr

Vehicle     15 [+ or -] 1      0.23 [+ or -] 0.01    1.0 [+ or -] 0.1
0.3         14 [+ or -] 1      0.17 [+ or -] 0.06    1.1 [+ or -] 0.1
1           11 [+ or -] 1      0.15 [+ or -] 0.04    1.5 [+ or -] 0.2
5           63 [+ or -] 20 *    6.1 [+ or -] 2.0 *   1.8 [+ or -] 0.3 *

Gentami-
cin dose
(mg/kg/
day)

Vehicle      16 [+ or -] 1     0.19 [+ or -] 0.02    0.5 [+ or -] 0.1
2            13 [+ or -] 1     0.16 [+ or -] 0.02    0.4 [+ or -] 0.1
10           13 [+ or -] 1     0.20 [+ or -] 0.02    0.5 [+ or -] 0.1
80           15 [+ or -] 2     0.23 [+ or -] 0.02    1.3 [+ or -] 0.1 *
240         127 [+ or -] 41    0.49 [+ or -] 0.01 *  4.9 [+ or -] 0.3 *

Puromycin
dose
(mg/kg)

Vehicle      16 [+ or -] 1     0.19 [+ or -] 0.02    0.5 [+ or -] 0.1
5            13 [+ or -] 1     0.16 [+ or -] 0.02    0.4 [+ or -] 0.1
10           13 [+ or -] 1     0.20 [+ or -] 0.02    0.5 [+ or -] 0.1

Cisplatin          Urine                Protein
dose                                   excretion
(mg/kg)            Ca/Cr               (mg/day)

Vehicle     0.07 [+ or -] 0.01     39 [+ or -] 3
0.3         0.11 [+ or -] 0.02     28 [+ or -] 3
1           0.12 [+ or -] 0.03     39 [+ or -] 4
5           0.23 [+ or -] 0.08 *   66 [+ or -] 10

Gentami-
cin dose
(mg/kg/
day)

Vehicle     0.07 [+ or -] 0.01       5 [+ or -] 1
2           0.06 [+ or -] 0.01       4 [+ or -] 1
10          0.09 [+ or -] 0.02       5 [+ or -] 1
80          0.14 [+ or -] 0.07 *    14 [+ or -] 1 *
240         0.26 [+ or -] 0.07 *   142 [+ or -] 31 *

Puromycin
dose
(mg/kg)

Vehicle     0.07 [+ or -] 0.01     91.7 [+ or -] 17
5           0.06 [+ or -] 0.01     99.5 [+ or -] 44
10          0.09 [+ or -] 0.02     1891 [+ or -] 1728

Abbreviations: Ca, calcium; Cr, creatinine; Kwt, total kidney weight in
grams; Prot, protein.

(a) Mean values [+ or -] 1 SE from five rats per group are presented.
* p < 0.05 from control.

Table 2. Summary of observations indicative of cisplatin-, gentamicin-,
and puromycin-induced renal dysfunction. (a)

                                Cisplatin     Gentamicin      Puromycin
Renal tubular dysfunction
  Altered serum electrolyte/
    mineral concentration           +              +             -/+
  Calcuria                          +              +              +
Tubular injury
  Proteinuria                       +              +              +
  Single-cell necrosis              +              -              -
  Tubular degeneration              +              +             -/+
  Tubular regeneration              +              -             -/+
  Apoptosis                         -              +              -
  Mononuclear/lymphocytic
    infiltrates                     +              +              +
  Myelin figures (electron
    microscopy)                    NE              +             NE
  Proximal tubular necrosis         +        + (high dose)        +
  Protein casts                     +              +              +
  Focal segmental
    glomerulosclerosis              -              -              +
Glomerular injury or other
  indicators of renal injury
  Altered serum creatinine          +        + (high dose)        -
  Glomerular thickening of
    basement membrane               +              -              +
  Altered serum urea
    nitrogen                        +        + (high dose)        -

Abbreviations: NE, not evaluated; +, end point observed; -, end point
not observed; -/+, end point observed in some instances.

(a) Cisplatin (5 mg/kg), gentamicin (80 or 240 mg/kg/day), and
puromycin (20 mg/kg/day). For cisplatin-treated rats, microscopic
alterations were evident at day 1.

Table 3. Downregulated gene expression changes correlated with regional
specific damage. (a)

Renal distribution and enzyme        Distribution (b)      Cisplatin

Glomerulus
  Adenosine-deaminase (c)
Proximal tubule
  Glucose-6-phosphatase (d)            S1 > S2 > S3         [check]
  Fructose-1,6-bisphosphatase (d)      S1 < S2 > S3
  Phosphoenolpyruvate carboxyl-
    kinase (d)                         S1 > S2 > S3
  Fructokinase (d)                     S1 = S2 < S3
  Fructose-1 phosphate aldolase
    (d)                                S1 = S2 > S3
  Glycerokinase (d)                    S1 = S2 > S3
  Glycerol 3-phosphate dehydro-
    genase (d)                         S1 = S2 = S3
  Glutamine synthetase                      S3              [check]
  Alanine aminotransferase             S1 = S2 < S3         [check]
  Ornithine aminotransferase           S1 = S2 < S3
  Gamma glutamyltranspeptidase
    (e)                                S1 < S2 < S3
  Gamma glutamyl cysteine
    synthetase                              S3
  Gluthathione S-transferase (e)       Sl = S2 = S3      [check][check]
  Cytochrome P450 (e)                  S1 = S2 = S3         [check]
  L-Hydroxyacid oxidase                S1 = S2 < S3         [check]
  Peroxisomes (D-amino acid
    oxidase/catalase (e)               S1 = S2 < S3         [check]
  Aminopeptidases (f)                  S1 < S2 < S3         [check]
  Alkaline phosphatase                 S1 = S2 = S3
  Fatty acyl-CoA oxidase               S1 = S2 < S3
  Choline oxidase                      S1 < S2 = S3
  25(OH)-[D.sub.3]-1[alpha]-
    hydroxylase (g)                    S1 = S2 < S3         [check]
  Vitamin D binding proteins (g)                            [check]
  Solute carrier family 15
    ([H.sup.+]/peptide)                                     [check]
  Isocitrate dehvdrogenase 1                                [check]

Renal distribution and enzyme           Gentamicin

Glomerulus
  Adenosine-deaminase (c)
Proximal tubule
  Glucose-6-phosphatase (d)
  Fructose-1,6-bisphosphatase (d)
  Phosphoenolpyruvate carboxyl-
    kinase (d)
  Fructokinase (d)
  Fructose-1 phosphate aldolase
    (d)
  Glycerokinase (d)
  Glycerol 3-phosphate dehydro-
    genase (d)
  Glutamine synthetase                   [check]
  Alanine aminotransferase
  Ornithine aminotransferase
  Gamma glutamyltranspeptidase
    (e)
  Gamma glutamyl cysteine
    synthetase
  Gluthathione S-transferase (e)
  Cytochrome P450 (e)                 [check][check]
  L-Hydroxyacid oxidase
  Peroxisomes (D-amino acid
    oxidase/catalas (e)
  Aminopeptidases (f)
  Alkaline phosphatase
  Fatty acyl-CoA oxidase
  Choline oxidase
  25(OH)-[D.sub.3]-1[alpha]-
    hydroxylase (g)
  Vitamin D binding proteins (g)
  Solute carrier family 15
    ([H.sup.+]/peptide)
  Isocitrate dehvdrogenase 1

Abbreviations: [check], change in gene expression observed;
[check][check], change in gene expression observed in more than 1 gene
in this family. (a) Information modified from WHO (1991). (b) S1, S2,
and S3 denote renal tubular subregions. (b) Purine metabolism related.
(d) Sugar metabolism related. (e) Role in xenobiotic metabolism.
(f) Peptide/amino acid metabolism. (g) Vitamin D related.

Table 4. Comparison of cDNA microarray and RT-PCR measurements.

                                                    Cisplatin (a)
GenBank
                                                                cDNA
accession                                         RT-PCR     microarray
no. (b)      Gene                                (5 mg/kg)   (5 mg/kg)

AA964431     Osteopontin                            5.2          4.1
AA901117     Inositol polyphosphate kinase
                                                    0.5          0.7
AA920287     L-Arginine-glycine amidinotrans-
               ferase                               0.3          0.5
AA858514     Prosaposin                             1.07         1.05
AI058493     Synaptogyrin 2                         0.5          1.8
AA957270     EST                                    3.5          2.9
M19647       Kallikrein                             --           --
AA946503     Lipocalin 2                            7.7          -- (c)

                                     Gentamicin

                   Day 2 RT-PCR                Day 7 RT-PCR
GenBank
accession    (10 mg/kg/    (80 mg/kg/    (10 mg/kg/    (80 mg/kg/
no. (b)         day)          day)          day)          day)

AA964431        0.9           1.1           1.4           3.9
AA901117
                 --            --            --            --
AA920287
                 --            --            --            --
AA858514        1.0           1.0           0.9           0.9
A1058493         --            --            --            --
AA957270         --            --            --            --
M19647          1.01          1.0           0.5           0.3
AA946503         --            --            --            --

--, not done or not on platform. (a) All cisplatin values are from
144-hr time point except L-arginine glycine amidinotransferase, which
is from the 24-hr time point. (b) from GenBank (http://www.ncbi.nih.
gov/GenBank/). (c) Sequence not present on cDNA microenray. Observed
based on similarity to KIM-1 expression on Affymetrix platform (data
not shown).


REFERENCES

Affymetrix 2003. Technical Documentation Manuals. Santa Clara, CA:Affymetrix Inc. Available: http://www.affymetrix.com/support/technical/ma nuals.affx [accessed 5 September 2003].

Andoh TF, Gardner MP, Bennett WM. 1997. Protective effects of dietary L-arginine supplementation on chronic cyclosporine nephrotoxicity. Transplantation 64:1236-1240.

Applied Biosystems. 1997. User Bulletin #2: Relative Quantitation of Gene Expression. Foster City, CA:Applied Biosystems.

Aulitzky WK, Schlegel PN, Wu DF, Cheng CY, Chen CL, Li PS, at al. 1992. Measurement of urinary clusterin as an index of nephrotoxicity. Proc Soc Exp Biol Mad 199:93-96.

Bailly V, Zhang Z, Meier W, Cate R, Sanicola M, Bonventre JV. 2002. Shedding of kidney injury molecule-1, a putative adhesion protein involved in renal regeneration. J Biol Chem 277:39739-39748.

Bushel PR, Hamadeh HK, Bennett L, Green J, Ableson A, Misener S, et al. 2002. Computational selection of distinct class+ and subclass-specific gone expression signatures. J Biomed Inform 35:160-170.

Bushel PR, Hamadeh H, Bennett L, Sieber S, Martin K, Nuwaysir EF, et al. 2001. MAPS: a microarray project system for gone expression experiment information and data validation. Bioinformatics 17:664-565.

Chen Y, Dougherty ER, Bittner ML. 1997. Ratio-based decisions and the quantitative analysis of cDNA microarray images. J Biomed Opt 2:364-374.

Christensson A, Ekberg J, Grubb A, Ekberg H, Lindstrom V, Lilja H. 2003. Serum cystatin C is a more sensitive and more accurate marker of glomerular filtration rate than enzymatic measurements of creatinine in renal transplantation. Nephron Physiol 94:19-27.

Clements, JA. 1989. The glandular glandular /glan·du·lar/ (glan´du-ler)
1. pertaining to or of the nature of a gland.

2. glanular.


glan·du·lar
adj.
1.
 kallikrein family of enzymes: tissue-specific expression and hormonal regulation. Endocr Rev 10:393-419.

Correa-Rotter R, Ibarra-Rubio ME, Schwochau G, Cruz C, Silkensen JR, Padraza-Chaverri J, et al. 1998. Induction of clusterin in tubules of nephrotic rats. J Am Soc Nephrol 9:33-37.

DeRisi J, Penland L, Brown PO, Bittner ML, Meltzer PS, Ray M, et al. 1996. Use of a cDNA microarray to analyze gene expression patterns in human cancer. Nat Genet 14:457-460.

Devireddy LR, Teodoro JG, Richard FA, Green MR. 2001. Induction of apoptosis by a secreted lipocalin that is transcriptionally regulated by IL-3 deprivation. Science 293:829-834.

Eisen MB, Spellman PT, Brown PO, Botstein D. 1998. Cluster analysis and display of genome-wide expression patterns. Proc Natl Acad Sci USA 95:1 4863-14888.

Flower DR. 1996. The lipocalin protein family: structure and function. Biochem J. 318:1-14.

Flower DR, North AC, Sansom CE. 2000. The lipocalin protein family: structural and sequence overview. Biochim Biophys Acta 1482:9-24.

Girton RA, Sundin DP, Rosenberg ME. 2002. Clusterin protects renal tubular epithelial cells from gentamicin-madiated cytotoxicity. Am J Physiol Renal Physiol 282: 703-709.

Hamadeh HK, Bushel PR, Jayadev S, DiSorbo O, Bennett L, Li L, et al. 2002a. Prediction of compound signature using high density gene expression profiling. Toxicol Sci 67:232-240.

Hamadeh HK, Bushel PR, Jayadev S, Martin K, DiSorbo O, Sieber S, at al. 2002b. Gene expression analysis reveals chemical-specific profiles. Toxicol Sci 67:219-231.

Hamadeh HK, Knight BL, Haugen AC, Sieber S, Amin RP, Bushel PR, et al. 2002. Methapyrilene toxicity: anchorage of pathologic observations to gone expression alterations. Toxicol Pathol 30:470-482.

Hammerman MR. 1998a. Potential role of growth factors in the prophylaxis and treatment of acute renal failure acute renal failure Acute kidney failure Nephrology An abrupt decline in renal function, triggered by various processes–eg, sepsis, shock, trauma, kidney stones, drug toxicity-aspirin, lithium, substances of abuse, toxins, iodinated radiocontrast. . Kidney Int Suppl 64:S19-S22.

--. 1998b. Growth factors and apoptosis in acute renal injury. Curr Opin Nephrol Hypertens 7:419-424.

Han WK, Bailly V, Abichandani R, Thadhani R, Bonvantre JV. 2002. Kidney injury molecule-1 (KIM-1): a novel biomarker for human renal proximal tubule injury. Kidney Int 62:237-244.

Hoffmann A, Conradt HS, Gross G, Nimtz M, Lottspeich F, Wurster U. 1993. Purification and chemical characterization of beta-trace protein from human carebrospinal fluid: its identification as prostaglandin D synthase. J Neurochem 61:451-466.

Hoffmann A, Nimtz M, Conradt HS. 1997. Molecular characterization of beta-trace protein in human serum and urine: a potential diagnostic marker for renal diseases. Glycobiology 7:499-506.

Huang Q, Dunn RT 2nd, Jayadev S, DiSorbo O, Pack FD, Farr SB, et al. 2001. Assessment of cisplatin-induced nephrotoxicity by microarray technology. Toxicol Sci 63:196-207.

Hudkins KL, Giachelli CM, Cui Y, Couser WG, Johnson RJ, Alpers CE. 1999. Osteopontin expression in fetal and mature human kidney, J Am Soc Nephrol 10:444-457.

Hudkins KL, Le QC, Segerer S, Johnson RJ, Davis CL, Giachelli CM, et al. 2001. Osteopontin expression in human cyclosporine toxicity. Kidney Int 60:635-640.

Ichimura T, Bonventre JV, Bailly V, Wei H, Ression CA, Cate RL, et al. 1998. Kidney injury molecule-1 (KIM-1), a putative epithelial cell adhesion molecule Cell Adhesion Molecules (CAMs) are proteins located on the cell surface involved with the binding with other cells or with the extracellular matrix (ECM) in the process called cell adhesion.  containing a novel immunoglobulin domain, is up-regulated in renal cells after injury. J Biol Chem 273:4135-4142.

Khan SR, Johnson JM, Peck AB, Cornelius JG, Glenton PA. 2002. Expression of osteopontin in rat kidneys: induction during ethylene glycol induced calcium oxalate nephrolithiasis. J Urol 168:1173-1181.

Kirsztajn GM, Nishida SK, Silva MS, Ajzen H, Moure LA, Pereira AB. 2002. Urinary retinol-binding protein as a prognostic marker in glomerulopathies. Nephron 90:424-431.

Kramer JA, Petit SD, Amin RP, Bertram TA, Car B, Cunningham M, at al. 2004. Overview of the application of transcription profiling using selected nephrotoxicants for toxicology assessment. Environ Health Perspect 112:460-464.

Laterza OF, Price CP, Scott MG. 2002. Cystatin C: an improved estimator of glomerular filtration rate? Clin Ghem 48:699-707.

Lee H, Kim JH, Chae YJ, Ogawa H, Lee MH, Gerton GL. 1998. Creatine synthesis and transport systems in the male rat reproductive tract. Biol Reprod 58:1437-1444.

Lockhart DJ, Dong H, Byrne MC, Follettie MT, Gallo MV, Chee MS, et al. 1996. Expression monitoring by hybridization to high-density oligonucleotide arrays. Net Biotechnol 14:1675-1680.

Magil AB, Pichler RH, Johnson RJ. 1997. 0steopontin in chronic puromycin aminonuclaoside nephrosis nephrosis (nəfrō`səs), kidney disease characterized by lesions of the epithelial lining of the renal tubules, resulting in marked disturbance in the filtration function and the consequent appearance of large amounts of protein (albumin) . J Am Soc Nephrol 8:1383-1390.

Makover A, Soprano DR, Wyatt ML, Goodman DS. 1989. Localization Customizing software and documentation for a particular country. It includes the translation of menus and messages into the native spoken language as well as changes in the user interface to accommodate different alphabets and culture. See internationalization and l10n.  of retinol-binding protein messenger RNA in the rat kidney and in perinephric perinephric /peri·neph·ric/ (-nef´rik) perirenal; surrounding the kidney.

perinephric

around the kidney.
 fat tissue. J Lipid Res 30:171-180.

Matejka GL. 1998. Expression of GH receptor, IGF-I IGF-I

see somatomedin C.

IGF-I Insulin-like growth factor I, somatomedin-C A polypeptide hormone structurally similar to proinsulin, synthesized in the liver and fibroblasts, giving fibroblasts a paracrine function; serum levels correlate with
 receptor and IGF-I mRNA in the kidney and liver of rats recovering from unilateral renal ischemia. Growth Horm IGF (Internet Governance Forum) An international organization of governments and U.N. agencies that was founded to discuss Internet issues such as security and spam. It was created at the United Nations Summit in 2005 after the U.S.  Res 8:77-82.

Mattanheimer H. 1968. Enzymology of kidney tissue. Curr Probl Clin Biochem 2:119-145.

Melegos DN, Grass L, Pierratos A, Diamandis EP. 1999, Highly elevated levels of prostaglandin D synthase in the serum of patients with renal failure. Urology 53:32-37.

Murakami H, Yayama K, Chao L, Chao J. 1998. Human kallikrein gena delivery protects against gentamycin-induced naphrotoxicity in rats. Kidney Int 53:1305-1313.

Muramatsu Y, Tsujie M, Kohda Y, Pham B, Perantoni AO, Zhso H, et el. 2002. Early detection of cysteine rich protein 61 (CYR CYR Colonia, Uruguay (Airport Code) 61, CCN CCN Cloud Condensation Nuclei
CCN Church Communication Network
CCN Conseil Canadien des Normes (Standards Council of Canada)
CCN Critical Care Nurse
CCN Certified Clinical Nutritionist
CCN Community Care Network
CCN Cyclin
1)in urine following renal ischemic reperfusion injury. Kidney Int 62:1601-1610.

Nagasawa Y, Takenaka M, Kaimori J, Matsuoka Y, Akagi Y, Tsujie M, et al. 2001. Rapid and diverse changes of gana expression in the kidneys of protein-overload proteinuria mice detected by microarray analysis. Nephrol Dial Transplant 16:923-9311

Negate A, Suzuki Y, Igarashi M, Eguchi N, Toh H, Urade Y, et el. 1991. Human brain prostaglandin D synthase has been evolutionarily differentiated from lipophilic-ligand carrier proteins, Proc Natl Acad Sci USA 88:4020-4024.

Nakao A, Watanabe T, Ohishi N, Toda A, Asano K, Taniguchi S, et al. 1999. Ubiquitous localization of leukotriene A4 hydrolase Leukotriene A4 hydrolase is an enzyme which converts leukotriene A4 to leukotriene B4. External links
  • MeSH leukotriene+A4+hydrolase


    
 in the rat nephron. Kidney Int 55:100-108.

NIEHS Microarray Group. 2003a. NIEHS Chips and Clones. Research Triangle Park, NC:National Center for Toxicogenomics, National Institute of Environmental Health Sciences. Available: http://dir.niehs.nih.gov/microarray/chips.htm [accessed 5 September 2003].

--. 2003b. Methods and Protocols. Research Triangle Park, NC:National Center for Toxicogenomics, National Institute of Environmental Health Sciences. Available: http://dir.niehs.nih.gov/microarray/methods.htm [accessed 5 September 2003].

--. 2003c. ILSI Datasets, Research Triangle Park, NC:National Center for Toxicogenomics, National Institute of Environmental Health Sciences. Available: http://dir.niehs.nih.gov/ microarray/ilsi-datasets/home.htm [accessed 5 September 2003].

NIH. 1999. NIH Guide for the Care and Use of Laboratory Animals. Bethesda, MD:National Institutes of Health.

Newman DJ. 2002. Cystatin C. Ann Clin Biochem 39:89-104.

Nielsen BS, Borregaard N, Bundgaard JR, Timshel S, Sehested M, Kjeldsen L. 1996. Induction of NGAL synthesis in epithelial cells of human colorectal neoplasia neoplasia /neo·pla·sia/ (-pla´zhah) the formation of a neoplasm.

cervical intraepithelial neoplasia
 and inflammatory bowel diseases. Gut 38:414-420.

Norman JT, Bohman RE, Fischmann G, Bowen JW, McDonough A, Slamon D, et el. 1988. Patterns of mRNA expression during early cell growth differ in kidney epithelial cells destined des·tine  
tr.v. des·tined, des·tin·ing, des·tines
1. To determine beforehand; preordain: a foolish scheme destined to fail; a film destined to become a classic.

2.
 to undergo compensatory hypertrophy versus regenerative hyperplasia. Proc Natl Acad Sci USA 85:6768-6772.

Oda H, Shiina Y, Seiki K, Sato N, Eguchi N, Urade Y. 2002. Development and evaluation of a practical ELISA for human urinary lipocalin-type prostaglandin D synthase. Clin Chem 48:1445-1453.

Ortiz A, Lorz C, Justo P, Catalan MP, Egido J. 2001. Contribution of apoptotic cell death to renal injury. J Cell Mol Mad 5:18-32.

Pennie WD, Pettit SD, Lord PG. 2004. Toxicogenomics in risk assessment: an overview of an HESI collaborative research program. Environ Health Perspect 112:417-419.

Pichler RH, Franceschini N, Young GA, Hugo C, Andoh TF, Burdmann EA, et al. 1995. Pathogenesis of cyclosporine nephropathy nephropathy /ne·phrop·a·thy/ (ne-frop´ah-the) disease of the kidneys.nephropath´ic

analgesic nephropathy
: roles of angiotensin II and osteopontin. J Am Soc Nephrol 6:1185-1196.

Ritchie HH, Hou H, Veis A, Butler WT. 1994. Cloning and sequence determination of rat dentin sialoprotein, a novel dentin protein. J Biol Chem 269:3698-3702.

Rosenberg ME, Girton R, Finkel D, Chmielewski D, Barrie A 3rd, Witte DP, et el. 2002. Apolipoprotein apolipoprotein /apo·lipo·pro·tein/ (ap?o-lip?o-pro´ten) any of the protein constituents of lipoproteins, grouped by function in four classes, A, B, C, and E.

ap·o·lip·o·pro·tein
n.
 J/clusterin prevents s progressive glomerulopathy of aging. Mol Cell Biol 22:1893-1902.

Rosenberg ME, Silkensen J. 1995. Clusterin and the kidney. Exp Nephrol 3:9-14.

--.1995. Clusterin: physiologic and pathophysiologic considerations. Int J Biochem Cell Biol 27:633-645.

Safirstein R, Price PM, Saggi SJ, Harris RC. 1990. Changes in gene expression after temporary renal ischemia. Kidney Int 37:1515-1521.

Saunders JR, Aminian A, McRae JL, O'Farrell KA, Adam WR, Murphy BF. 1994. Clusterin depletion enhances immune glomerular injury in the isolated perfused kidney. Kidney Int 45:817-827.

Schmaier AH. 2003. The kallikrein-kinin and the reninangiotensin systems have a multilayered interaction. Am J Physiol Regul Integr Comp Physiol 265:R1-R13.

Silkensen JR, Agarwal A, Nath KA, Manivel JC, Rosenberg ME. 1997. Temporal induction of clusterin in cisplatin nephrotoxicity. J Am Soc Nephrol 8:302-305.

Srivastava RC, Farookh A, Abroad N, Mists M, Hasan SK, Husain MM. 1996. Evidence for the involvement of nitric oxide in cispletin-induced toxicity in rats. Biometals 9:139-142.

Star R, Hostetter T, Hortin BL 2002. New markers for kidney disease. Clin Chem 48:1375-1376.

Thompson KL, Afshari CA, Amin RP, Bertram TA, Car B, Cunningham M, at el. 2004. Identification of platform-independent gene expression markers of cisplatin nephrotoxicity. Environ Health Perspect 112:488-496.

Toback FG. 1992. Regeneration after acute tubular necrosis acute tubular necrosis Nephrology A pathologic change of acute renal failure due to shock, crush injuries, hemoglobinuria, toxic nephrosis, sepsis, drugs-aminoglycosides, amphotericin B, cyclosporine, radiocontrast, ischemia in transplanted kidneys Predisposing . Kidney Int 41:226-248.

Tome LA, Yu L, de Castro I, Campos SB, Seguro AC. 1999. Beneficial and harmful effects of L-arginine on renal ischaemia Noun 1. ischaemia - local anemia in a given body part sometimes resulting from vasoconstriction or thrombosis or embolism
ischemia

ischaemic stroke, ischemic stroke - the most common kind of stroke; caused by an interruption in the flow of blood to the brain
. Nephrol Dial Transplant 14:1139-1145.

Urade Y, Hayaishi O. 2000. Prostagiandin D synthase: structure and function. Vitam Horm 58:89-120.

Valdivielso JM, Blantz RC. 2002. Acute renal failure: is nitric oxide the bad guy? Antioxid Redox Signal 4:925-934.

Waring JF, Ciurlionis R, Jolly RA, Heindel M, Ulrich RG. 2001a. Microarray analysis of hepatotoxins in vitro reveals a correlation between gene expression profiles and mechanisms of toxicity. Toxicol Lett 120:359-368.

Waring JF, Jolly RA, Ciurlionis R, Lum n. 1. A chimney.
2. A ventilating chimney over the shaft of a mine.
3. A woody valley; also, a deep pool.
 PY, Praestgaard JT, Morfitt DC, et el. 2001b. Clustering of hepatotoxins based on mechanism of toxicity using gene expression profiles. Toxicol Appl Pharmacol 175:28-42.

WHO. 1991. Principles and Methods for the Assessment of Nephrotoxicity Associated with Exposure to Chemicals. Environmental Health Criteria 119. Geneva Geneva, canton and city, Switzerland
Geneva (jənē`və), Fr. Genève, canton (1990 pop. 373,019), 109 sq mi (282 sq km), SW Switzerland, surrounding the southwest tip of the Lake of Geneva.
:World Health Organization, International Programme on Chemical Safety The International Programme on Chemical Safety (IPCS) is a collaboration between three United Nations bodies—the World Health Organization, the International Labour Organization and the United Nations Environment Programme. .

Yan L, Borregaard N, Kjeldsen L, Moses MA. 2001. The high molecular weight urinary matrix metalloprotsinase (MMP MMP Matrix Metalloproteinase (enzymes related to tissue healing/remodeling and cancer cell metastasis)
MMP Mixed Member Proportional (New Zealand electoral system)
MMP Multi-man Publishing
) activity is a complex of gelatinase B/MMP-9 and neutrophil neutrophil /neu·tro·phil/ (noo´tro-fil)
1. a granular leukocyte having a nucleus with three to five lobes connected by threads of chromatin, and cytoplasm containing very fine granules; cf. heterophil.

2.
 gelatinase-associated lipocalin (NGAL). Modulation of MMP-9 activity by NGAL. J Biol Chem 276:37258-37265.

Yang J, Mori K, Li JY, Barasch J. 2003. Iron, lipocalin, end kidney epithelia. Am d Physiol Renal Physiol 285:F9-F18.

Yasuda M, Sugahara K, Zhang J, Shuin T, Kodama H. 2000. Effect of cisplstin treatment on the urinary excretion of guanidinoacetic acid, creatinine and crestine in patients with urinary tract neoplasm neoplasm or tumor, tissue composed of cells that grow in an abnormal way. Normal tissue is growth-limited, i.e., cell reproduction is equal to cell death. , and on superoxide superoxide /su·per·ox·ide/ (-ok´sid) any compound containing the highly reactive and extremely toxic oxygen radical O2-, a common intermediate in numerous biological oxidations.

su·per·ox·ide
n.
 generation in human neutrophils neutrophils (ner·ō·trōˑ·filz),
n.pl white blood cells with cytoplasmic granules that consume harmful bacteria, fungi, and other foreign materials.
. Physiol Chem Phys Mad NMR NMR: see magnetic resonance.  32:119-125.

Yoshida T, Kurella M, Beato F, Min H, Ingelfinger JR, Steers RL, et al. 2002. Monitoring changes in gene expression in renal ischemia-reperfusion in the rat. Kidney Int 61:1646-1654.

Yu H, Anderson PJ, Freedman BI, Rich SS, Bowden DW. 2000. Genomic structure of the human plasma prekallikrein gene, identification of allelic variants, and analysis in end-stage renal disease End-stage renal disease (ESRD)
Total kidney failure; chronic kidney failure is diagnosed as ESRD when kidney function falls to 5-10% of capacity.

Mentioned in: Chronic Kidney Failure

end-stage renal disease 
. Genomics 69:225-234.

Yu H, Song Q, Freedman BI, Chao J, Chao L, Rich SS, et el. 2002. Association of the tissue kallikrein gene promoter with ESRD ESRD end-stage renal disease.
ESRD
End-stage renal disease; chronic or permanent kidney failure.

Mentioned in: Dialysis, Kidney

ESRD End-stage renal disease, see there
 and hypertension. Kidney Int 61:1030-1039.

Rupesh P. Amin, (1) Alison E. Vickers, (2) Frank Sistare, (3) Karol L. Thompson, (3) Richard J. Roman, (4) Michael Lawton, (5) Jeffrey Kramer, (5) Hisham K. Hamadeh, (1,6) Jennifer Collins, (1) Sherry Grissom, (1) Lee Bennett, (1) C. Jeffrey Tucker, (1) Stacie Wild, (6) Clive Kind, (7) Victor Oreffo, (7) John W. Davis

For other people named John Davis, see John Davis (disambiguation).

John William Davis (April 13 1873 — March 24 1955) was an American politician and lawyer.
 II, (8) Sandra Curtiss, (5) Jorge M. Naciff, (9) Michael Cunningham, (1) Raymond Tennant, (1) James Stevens, (10) Bruce Car, (11) Timothy A. Bertram, (5) and Cynthia A. Afshari1, (6)

(1) National Institute of Environmental Health Sciences, National Institutes of Health, Department of Health and Human Services Noun 1. Department of Health and Human Services - the United States federal department that administers all federal programs dealing with health and welfare; created in 1979
Health and Human Services, HHS
, Research Triangle Park, North Carolina, USA; (2) Novartis Pharmaceuticals Corporation, East Hanover, New Jersey East Hanover Township is a township in Morris County, New Jersey, United States. As of the United States 2000 Census, the township population was 11,393. Incorporated in 1928, it is a largely middle to upper-income suburban community situated roughly 25 miles west of New York City. , USA; (3) Center for Drug Evaluation and Research The Center for Drug Evaluation and Research is a division of the FDA that deals with the approval of drugs. CDER reviews New Drug Applications to ensure that the drugs are safe and effective. It is one of five Centers at the United States Food and Drug Administration. , U.S. Food and Drug Administration, Laurel, Maryland, USA; (4) Medical College of Wisconsin and Physiogenix Inc., Milwaukee, Wisconsin, USA; (5) Pfizer Inc, St. Louis, Missouri, USA, and Groton, Connecticut, USA; (6) Amgen Inc., Thousand Oaks, California Thousand Oaks, commonly referred to as "T.O." by residents, is a city in southeastern Ventura County, California, in the United States. It was named after the many oak trees that grace the area, and the city seal is adorned with an oak. , USA; (7) AstraZeneca Inc., Leicestershire, United Kingdom; (8) Schering-Plough Research Institute, Lafayette, New Jersey, USA; (9) The Procter & Gamble Company, Miami Valley Laboratories, Cincinnati, Ohio, USA; (10) Eli Lilly and Company Eli Lilly and Company (NYSE: LLY) is a global pharmaceutical company and one of the world's largest corporations. Eli Lilly's global headquarters is located in Indianapolis, Indiana, in the United States. , Indianapolis, Indiana, USA; (11) Bristol-Myers Squibb Company, Wilmington, Delaware, USA

This article is part of the mini-monograph "Application of Genomics to Mechanism-Based Risk Assessment."

Address correspondence to C. Afshari, Amgen Inc., One Amgen Center Dr., MS 5-1-A, Thousand Oaks, CA 91320 USA. Telephone: (805) 447-3537. Fax: (805) 449-4687. E-mail: cafshari@amgen.com

We would like to thank the following people: J. Bonventure for donation of antibody reagents, and S. Pettit, S. Susanne, P. Bushel, and R. Paules for maintenance of and posting of data to the International Life Sciences Institute (ILSI) and the National Institute of Environmental Health Sciences web sites. Our appreciation to B. Pennie, D. Robinson, and R. Tyler for their leadership role in the establishment of this ILSI working group. We thank members of the Health and Environmental Health Sciences (HESI) Technical Committee on Application of Genomics to Mechanism-Based Risk Assessment for critically reviewing this manuscript prior to submission.

The authors declare they have no competing financial interests.

Received 18 August 2003; accepted 14 January 2004.
COPYRIGHT 2004 National Institute of Environmental Health Sciences
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2004, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Genomics and Risk Assessment Mini-Monograph
Author:Afshari, Cynthia A.
Publication:Environmental Health Perspectives
Date:Mar 15, 2004
Words:12563
Previous Article:Overview of the application of transcription profiling using selected nephrotoxicants for toxicology assessment.(Toxicogenomics)
Next Article:Dye-bias correction in dual-labeled cDNA microarray gene expression measurements.(Genomics and Risk Assessment: Mini-Monograph)
Topics:



Related Articles
Use of genomics in toxicology and epidemiology: findings and recommendations of a workshop. (Meeting Report).
Phenotypic anchoring: linking cause and effect. (NCT Update).
Toxicogenomic applications to drug risk assessment.(Editorial)
Taking stock of toxicogenomics: mini-monograph offers overview.(Science Selections)
Applying new biotechnologies to the study of occupational cancer--a workshop summary.(Workshop Summary)
Toxicogenomics in risk assessment: an overview of an HESI collaborative research program.(Genomics and Risk Assessment: Mini-Monograph)
Overview of an interlaboratory collaboration on evaluating the effects of model hepatotoxicants on hepatic gene expression.(Genomics and Risk...
Overview of the application of transcription profiling using selected nephrotoxicants for toxicology assessment.(Toxicogenomics)
Identification of platform-independent gene expression markers of cisplatin nephrotoxicity.(Genomics and Risk Assessment: Mini-Monograph)
Key issues in the modes of action and effects of trichloroethylene metabolites for liver and kidney tumorigenesis.(Mini-Monograph)

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles