Printer Friendly
The Free Library
21,419,978 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Identification and characterization of 66 EST-SSR markers in the eastern oyster Crassostrea virginica (Gmelin).

ABSTRACT Large numbers of genetic markers are needed for genomic analyses in the eastern oyster (Crassostrea virginica). We previously identified 53 simple sequence repeat (SSR) markers from an expressed sequence tag (EST) database using a high selection standard. We mined the same EST database again using a lower threshold (>5 di-nucleotide and 4 other repeats) and identified 330 new SSR-containing ESTs. Primers were designed for 201 suitable sequences, and PCR was successful for 137. The screening of 113 primer pairs that produced fragments shorter than 800 bp produced 66 polymorphic SSR markers, which were characterized in 30 oysters from three populations and a full-sib family. The SSRs had an average of 5.4 alleles per locus, ranging from 2 12. Thirty-four loci segregated in the family, with seven showing significant deviation from Mendelian ratios after Bonferroni correction. Nullalleles were observed at 17 loci. The EST-derived SSRs are part of expressed genes, and most of them should be useful for gene and genome mapping. This study shows that more SSR markers can be developed from ESTs using lower selection standards.

KEY WORDS: expressed sequence tags, simple sequence repeats, linkage mapping, population genetics, oyster, Crassostrea virginica

INTRODUCTION

The eastern oyster (Crassostrea virginica Gmelin, 1791) is an economically important mollusc that has supported important fishery industries in the United States. However, the eastern oyster populations and fishery in much of the Mid-Atlantic region have been devastated by overfishing, habitat destruction, and diseases (MacKenzie 1996). Aquaculture production of the eastern oyster is on the rise and increasingly demands superior stocks. Genetic improvement of oyster stocks can greatly benefit from a better understanding of the oyster genome and genes that control economically important traits such growth and disease resistance. An important step in genomic research is the development of a large set of genetic markers for genetic and QTL (quantitative trait loci) mapping.

For a long time, there were few genetic markers for the eastern oyster. It is only recently that DNA-based genetic markers became available. Genetic linkage maps have been constructed for the eastern oyster using primarily amplified fragment length polymorphisms (AFLPs) (Yu & Guo 2003). Although AFLPs are efficient markers and widely used in aquaculture species, they are dominant and less informative markers, and not readily transferable among populations. AFLP-based genetic maps have limited applications unless codominant markers are added. Codominant markers such as simple sequence repeats (SSRs) and single nucleotide polymorphisms (SNPs) are better suited for genome mapping because they are more informative and easily transferable. Whereas codominant markers are ideal, they are also more difficult and expensive to develop. At the present time, there are only about 95 SSRs available in C. virginica including seven from Brown et al. (2000), four from Yu and Guo (2003, 2006), 31 from Reece's laboratory (Reece et al. 2004, Carlsson et al. 2006, Carlsson & Reece 2007) and 53 from Wang & Guo (2007). Whereas the number of SSRs markers is sufficient for population genetics studies, it is inadequate for genome mapping. Large numbers of SSR markers (hundreds) are needed for genome mapping and population-wide association studies.

SSR markers are typically developed from genomic libraries enriched for SSR. Recently, expressed sequences tags (ESTs) have been shown to be good sources of SSR markers (Zhan et al. 2005, Wang et al. 2007, Wang & Guo 2007). ESTs are part of expressed genes, and the EST-derived SSRs can be considered as type I markers and used to map genes of known functions. We have previously identified and characterized 53 EST-SSRs by screening a database of 9,101 C. virginica ESTs with stringent criteria of having at least eight di-nucleotide and five other repeats (Wang & Guo 2007). These 53 EST-SSRs are highly polymorphic and useful for mapping and population studies. In this study, we mined the same EST database again using a lower threshold (>5 di-nucleotide and four other repeats) in an attempt to obtain more SSR markers. Here we report the development and characterization of 66 new polymorphic EST-SSR markers in selected individuals from three populations and a full-sib family.

MATERIALS AND METHODS

We downloaded all C. virginica ESTs from GenBank (http:// www.ncbi.nlm.nih.gov/dbEST) and screened them for SSRs with the software MISA (MIcroSAtellite, http://pgrc.ipk-gatersleben. de/misa/). The selection threshold for SSRs used in this study was five to seven di- and four tri, tetra-, penta- or hexa-nucleotide repeats, lower than the respective eight and five repeats used in the previous study (Wang & Guo 2007).

Primers were designed for SSR-containing ESTs with good and sufficient flanking sequences, using PRIMER 3 (http:// frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi), as previously described. A M13-tail (TGTAAAACGACGGCCAGT) was added to the 5' end of the forward primers (Schuelke 2000). PCR for each primer pair was performed in a 10-[micro]L solution including 1X PCR buffer (Promega) with 1.5 2.5 mM Mg[Cl.sub.2], 1.0 mg/mL bovine serum albumin, 0.2 mM each dNTP, 0.025 U Taq DNA polymerase, 0.025 [micro]M forward primer, 0.1 [micro]M reverse primers, 0.1 [micro]M of the WellRED dye-labeled M13 primer, and 5-30 ng of oyster genomic DNA. PCR cycling protocol consisted of the following: an initial denaturing for 5 rain at 94[degrees]C; 34 cycles of 94[degrees]C for 30 s, annealing at proper temperature (Table 1) for 45 s, and 72[degrees]C for 45 s; 18 cycles of 94[degrees]C for 30 s, 53[degrees]C for 45 s, and 72[degrees]C for 45 s; and a final extension at 72[degrees]C for 10 rain. PCR was conducted on either a GeneAmp 9700 thermocycler (Perkin Elmer, Weiterstadt, CA) or a PTC-200 DNA engine (MJ Research Inc., Watertown, MA).

All primer pairs were initially evaluated for consistent amplification in six oysters from three populations (two each): a wild Delaware Bay population (DB), a hatchery population of Rutgers University (NEH), and a wild population from Louisiana (LA). DNA was extracted from adductor muscle or mantle/gill tissues from each oyster with the E.Z.N.A. mollusc DNA kit (Omega Bio-tek, GA) following supplied protocols. PCR products were visualized on 2% agarose gels to see if the amplification is successful. PCR conditions were optimized for loci having complex banding patterns or low yields by adjusting annealing temperatures and/or Mg[Cl.sub.2] concentrations.

For primer pairs that produced specific and reproducible fragments, polymorphism was further assessed using denaturing polyacrylamide gels (4% to 8% polyacrylamide, AA:BIS = 19:1, with 7 M urea and in 0.5X TBE as described in Wang & Guo (2007). PCR products were denatured at 95[degrees]C for 5 min and then loaded onto preheated polyacrylamide gels and run for 3-5 h at 150 V. PCR fragments were stained with ethidium bromide and visualized under UV illumination.

Polymorphic SSRs were further genotyped and characterized in 30 oysters from the same three populations mentioned above (10 each). PCR was conducted as described above. PCR products (about 0.5-1.0 [micro]L) that labeled with different WellRED fluorescent dyes were mixed with 30 [micro]L of deionized formamide and 0.4 [micro]L of size standard for electrophoresis on a CEQ 8000 Genetic analyzer (Beckman Coulter). Allele size was determined by the software onboard the genetic analyzer, and genotypes for each oyster were recorded.

To verify Mendelian inheritance, all polymorphic markers were tested in a full-sib family (HB4) with two parents and 100 one-year old progeny. DNA was extracted by the E.Z.N.A. mollusc DNA kit as mentioned before. All segregating loci were tested for goodness of fit to the expected Mendelian ratios using chi-square test.

To determine the function of genes associated with the SSR markers, GenBank homology searches were conducted for all EST sequences that contained polymorphic SSRs using BLASTX and BLASTN (http://www.ncbi.nlm.nih.gov/ BLAST), at a significant level of e-value <1.00E-8.

RESULTS

Using the threshold mentioned above, the screening of 9,101 ESTs identified 330 SSR-containing sequences and 398 SSRs. Fifty-two EST sequences had more than one SSR, and 44 ESTs contained compound SSR motifs. Among the 398 SSRs, 201 (50.5%) were di-nucleotide, 164 were (41.2%) trinucleotide, 28 (7.0%) were tetra-nucleotide, one was penta- and four were hexa-nucleotide repeats. Di- and trinucleotide repeats in combination accounted for 91.7% of all SSRs. Among di-nucleotide repeats, the motif AG/CT (60.7%) was most common, whereas CG/CG was least abundant (only one SSR). Among trinucleotide repeats, ACT/AGT (27.4%) and AAG/CTT (24.4%) and were the most common motifs, whereas AAAC/GTTT was the most-frequent tetra-nucleotide motif.

Primers were designed for 201 SSR-containing ESTs that had good and sufficient flanking sequences. PCR amplification was successful for 137 (68.2%) primer pairs after optimization, and the remaining 64 (31.8%) failed to amplify under various annealing temperatures and/or Mg[Cl.sub.2] concentrations. Among the 137 amplified primer pairs, 93 (67.9%) produced PCR products with expected sizes, and 44 (32.1%) produced longer than the expected size, probably because of the presence of introns. Because the size standard used for the genetic analyzer can only detect PCR products shorter than 800 bp, 24 primer pairs that produced PCR fragments longer than 800 bp were excluded for further characterization. Subsequently, 113 primer pairs that produced fragments shorter than 800 bp were screened for polymorphism in the six oysters with polyacrylamide gel electrophoresis, producing 66 (58.4%) polymorphic loci. The remaining 47 (41.6%) loci were monomorphic and may not be the true SSRs. The primer sequences and PCR conditions for the 66 polymorphic SSRs are listed in Table 1.

Polymorphism of the 66 SSRs was characterized in 30 oysters from three populations as mentioned above. Two SSRs amplified more than two fragments in some individuals, probably due to nonspecific amplification. The remaining 64 SSRs showed no more than two alleles per individual (Table 1). Null-genotypes were observed at nine loci in 4-15 of the 30 oysters (or 13.3-50%). In the 30 oysters genotyped, the SSRs had an average of 5.4 alleles per locus, ranging from 2-12 (Table 1).

All 66 polymorphic SSRs were tested for Mendelian segregation in a full-sib family (HB4) with 100 progeny, although 32 loci were monomorphic (31 loci had AA x AA genotype and one marker was BB x AA). The remaining 34 loci were polymorphic and segregated in HB4 (Table 2). Null alleles were observed at 10 loci (29.4%). For some loci, the two alleles showed different amplification efficiency. At RUCV241 (AB x AC), for example, the C allele is visibly lower than A and B alleles, and the C allele may be considered as a partial null-allele and require careful attention for scoring. Ten (29.4%) loci showed significant (P < 0.05) deviation from Mendelian ratios, and seven (20.6%) remained significant after Bonferroni correction (Table 2). Among the 34 segregating loci, four (RUCV156, RUCV230, RUCV227, and RUCV270) amplified more than two fragments in some or all oysters. These loci could still be scored for mapping purposes, as some of fragments were fixed leaving only one locus segregating. For example, in RUCV227 (AB x CC), the extra D allele at 639 bp showing up in both parents and all the progeny, and the A, B and C alleles showed Mendelian inheritance. Likewise, loci RUCV156 had two extra alleles that showed up in both parents and all progeny and could be ignored. RUCV270 amplified three extra alleles that showed no variation in all oysters, and the three alleles (243, 395 and 421 bp) differed by multiples of 26 bp, possibly because of a tandem mini-satellite. The extra fragment at RUCV230 was only present in some individuals. Further studies are needed to verify whether the extra alleles represent duplicated loci or caused by nonspecific amplifications.

GenBank BLAST searches found that 26 of 66 SSR-containing ESTs (39.4%) had significant (at e-value <1.00E08) homology to known genes or predicted proteins from other organisms (Table 3). The 26 genes included ribosomal proteins, ribosomal RNA methyltransferase, beta-actin, erg gene, cytoplasmic actin, actin binding protein, heat shock protein, aspartate racemase, and receptor tyrosine kinase. Twelve of these genes were segregating in HB4 and could potentially be mapped as Type I markers (Table 2).

DISCUSSION

We previously developed 53 SSR markers from the ESTs of the eastern oyster (Wang & Guo 2007). The present study was designed to determine if additional SSR markers can be developed from the same EST database by lowering the SSR selection threshold. Determining the lowest threshold of detecting SSRs is important for bioinformatic mining of SSR markers. By lowering the threshold from having at least eight di-nucleotide and five other types of repeats to five and four respectively, this study identified an additional 330 SSR-containing sequences and developed 66 new polymorphic SSRs from the same database of 9101 ESTs. Most studies have used the threshold of having at least six di-nucleotide and five other nucleotide repeats (Gupta et al. 2003, Thiel et al. 2003, Barrett et al. 2004, Gao et al. 2004, Nicot et al. 2004, Perez et al. 2005), and some used five di-nucleotide and four other repeats (Yu et al. 2004, Han et al. 2006). Our results suggest that the lower threshold of having at least five di-nucleotide and four other types of repeats works in the eastern oyster.

Using the lower threshold, this and the previous study in combination identified 537 SSRs in 456 ESTs (5.0% of all ESTs) totaling 5.2 million base pair. Our results suggest that there is about one SSR in every 9.7 kb of expressed sequences in the eastern oyster, which is similar to what have been reported for wheat (9.2 kb, Gupta et al. 2003) and barley (6.3 kb, Thiel et al. 2003). Such a comparison should be viewed with caution, as slightly different criteria are used in different studies.

Lowering the SSR threshold had a clear effect on the success rate of SSR discovery. In our previous study, 53 polymorphic SSRs were developed by screening 66 primer pairs, corresponding to a success rate of 80% (Wang & Guo 2007). In this study, the success rate is 58% or 66 polymorphic SSRs from 113 primer pairs. Further, the level of polymorphism of the SSRs developed in this study was also reduced. In the same set of 30 oysters, the 53 SSRs from the previous study had 9.3 alleles per locus, whereas the 66 SSRs in this study had 5.4 alleles per locus. Many of the SSRs identified in this study, especially these with 2-3 alleles, may be indels rather than true SSRs. Clearly, we are approaching the limit of discovering more SSRs from the same EST database.

In this study, 68% of the primer pairs were successfully amplified, a rate similar to the 67% reported by Reece et al. (2004) for genomic SSRs in the same species, and higher than the 47% reported with genomic SSRs for the Pacific oyster C. gigas (Thunberg) (Li et al. 2003). Failures of PCR amplification can be caused by many factors including primer design, sequence quality and polymorphism at the priming site. For EST-SSRs, the failure can also be caused by the presence of introns. The presence of introns was suggested by the larger than expect PCR fragments observed at 32% of the loci. This is a conservative estimate as some introns might be too large to be amplified. It seems that in the eastern oyster at least 32% of EST amplicons between 100 and 300 bp contain introns, and the upper limit should be about 54% as 93 of the 201 primer pairs produced products of the expected size (also see Wang & Guo 2007).

Polymorphism at the priming site may explain the nullalleles observed in this study. Because of exceptionally high levels of polymorphism, null alleles are common in oysters (Huvet et al. 2000, McGoldrick et al. 2000, Launey et al. 2002, Li et al. 2003, Hedgecock et al. 2004, Reece et al. 2004). The finding of null alleles at 17 (or 25.8%) out of 66 loci (nine in populations and 10 in the family with two overlapping) is not unusual. Hedgecock et al. (2004) observed null alleles at 49 out of 96 loci (or 51%) in three families of C. gigas. The presence of null-alleles may complicate population genetics studies, as nullalleles cause deviation from Hardy-Weinberg equilibrium. We did not test fitness to Hardy-Weinberg equilibrium in this study because the 30 oysters did not come from one population. We used 30 oysters from three diverse populations to estimate allele diversity across a wide geographic range.

As expected, most polymorphic SSR loci developed here segregated in Mendelian ratios. The number of distorted loci observed in this study (29% before and 21% after Bonferroni correction) was slightly higher than that reported in the same species for EST-SSRs (21% before and 7% after Bonferroni correction) (Wang & Guo 2007) and for genomic-SSRs (29% before and 11% after correction) (Reece et al. 2004), but similar to what has been reported in C. gigas (Launey & Hedgecock 2001; McGoldrick et al. 2000) and the flat oyster Ostrea edulis (Naciri et al. 1995). Segregation distortion is common in oysters and probably caused by the high levels of polymorphism or recessive lethal genes.

As part of or immediately adjacent to expressed genes, EST-derived SSRs are particularly useful in mapping and interrogating functional genes. Unfortunately, most oyster ESTs do not have homology to known genes at this time and in this study, only 26 of 66 SSR-containing ESTs can be matched to known genes. Most of these genes can be identified over time as more genes from molluscs are annotated. Some of the genes, such as heat shock proteins, may be involved in host response to stress and diseases. Markers derived from these genes should be useful for gene and comparative mapping, and for associating their variation with phenotypes.

In conclusion, 66 new SSRs were successfully developed from a database of eastern oyster ESTs with a low selection threshold of having at least five di- and four other nucleotide repeats. Whereas some of the SSRs have low levels of polymorphism, most of them are moderately polymorphic and segregate in Mendelian ratios. They should be useful for genome mapping and population genetics studies. Extremely high levels of polymorphism for SSR markers may not be advantageous for some applications. Population genetics analysis with highly variable SSRs may require a large sample size to cover a large number of rare alleles. Moderately variable SSRs with no or fewer null-alleles may be more appropriate for population genetics studies. This study brings the total number of available SSRs markers to 161. Still, hundreds more SSRs and other types of genetic markers are needed for genome mapping in the eastern oyster. The finding that more SSRs can be developed from EST databases using a low selection threshold should encourage similar efforts in this and other species.

ACKNOWLEDGMENTS

This study is supported by grants from NOAA Sea Grant Oyster Disease Research Program (NJMSC-6742-0001) and New Jersey Marine Science Consortium (NJMSC-6840-0005). This is publication No. 2009-3 of IMCS and NJSG-09-713.

LITERATURE CITED

Barrett, B., A. Griffiths, M. Schreiber, N. Ellison, C. Mercer, J. Bouton, B. Ong, J. Forster, T. Sawbridge, G. Spangenberg, G. Bryan & D. Woodfield. 2004. A microsatellite map of white clover. Theor. Appl. Genet. 109:596-608.

Brown, B. L., D. E. Franklin, P. M. Gaffney, M. Hong, D. Dendanto & I. Kornfield. 2000. Characterization of microsatellite loci in the eastern oyster, Crassostrea virginica. Mol. Ecol. 9:2217-2219.

Carlsson, J., C. L. Morrison & K. S. Reece. 2006. Wild and aquaculture populations of the eastern oyster compared using microsatellite. J. Hered. 97:595-598.

Carlsson, J. & K. S. Reece. 2007. Eight PCR primers to amplify EST-linked microsatellites in the Eastern oyster, Crassostrea virginica genome. Mol. Ecol. Notes 7:257-259.

Gao, L. F., R. L. Jing, N. X. Huo, Y. Li, X. P. Li, R. H. Zhou, X. P. Chang, J. F. Tang, Z. Y. Ma & J. Z. Jia. 2004. One hundred and one new microsatellite loci derived from ESTs (EST-SSRs) in bread wheat. Theor. Appl. Genet. 108:1392-1400.

Gupta, P. K., S. Rustgi, S. Sharma, R. Singh, N. Kumar & H. S. Balyan. 2003. Transferable EST-SSR markers for the study of polymorphsim and genetic diversity in bread wheat. Mol. Genet. Genomics 270:315-323.

Han, Z. G., C. B. Wang, X. L. Song, W. Z. Guo, J. Y. Gou, C. H. Li, X. Y. Chen & T. Z. Zhang. 2006. Characteristics, development and mapping of Gossypium hirsutum derived EST-SSRs in aliotetraploid cotton. Theor. Appl. Genet. 112:430-439.

Hedgecock, D., G. Li, S. Hubert, K. Bucklin & V. Ribes. 2004. Wildspread null alleles and poor cross-species amplification of microsatellite DNA loci cloned from the Pacific oyster, Crassostrea gigas. J. Shellfish Res. 23:379 385.

Huvet, A., P. Boudry, M. Ohresser, C. Delsert & F. Bonhomme. 2000. Variable microsatellite in the Pacific oyster Crassostrea gigas and other cupped oyster species. Anim. Genet. 31:71-72.

Launey, S. & D. Hedgecock. 2001. High genetic load in the pacific oyster Crassostrea gigas. Genetics 159:255-265.

Launey, S., C. Ledu, P. Boudry, F. Bonhomme & Y. Naciri-Graven. 2002. Geographic structure in the flat oyster Ostrea edulis L. as revealed by microsatellite polymorphism. J. Hered. 93:331-338.

Li, G., S. Hubert, K. Bucklin, V. Ribes & D. Hedgecock. 2003. Characterization of 79 microsatellite DNA markers in the Pacific oyster Crassostrea gigas. Mol. Ecol. Notes 3:228-232.

MacKenzie, C. L., Jr. 1996. History of oystering in the United States and Canada, featuring the eight greatest oyster estuaries. Mar. Fish. Rev. 58:1-78.

McGoldrick, D., D. Hedgecock, L. J. English, P. Baoprasertkul & R. D. Ward. 2000. The transmission of microsatellite alleles in Australian and north American stocks of the Pacific oyster (Crassostrea gigas): selection and null alleles. J. Shellfish Res. 19: 779-788.

Naciri, Y., Y. Vigouroux, J. Dallas, E. Desmarais, C. Delsert & F. Bonhomme. 1995. Identification and inheritance of (GA/TC)n and (AC/GT)n repeats in the European flat oyster Ostrea edulis (L.). Mol. Mar. Biol. Biotechnol. 4:83-89.

Nicot, N., V. Chiquet, B. Gandon, L. Amilhat, F. Legeai, P. Leroy, M. Bernard & P. Sourdille. 2004. Study of simple sequence repeat (SSR) markers from wheat expressed sequence tags (ESTs). Theor. Appl. Genet. 109:800-805.

Perez, F., J. Ortiz, M. Zhinaula, C. Gonzabay, J. Calderon & F. A. M. J. Volckaert. 2005. Development of EST-SSR markers by data mining in three species of shrimp: Litopenaeus vannamei, Litopenaeus stylirostris, and Trachypenaeus birdy. Mar. Biotechnol. 7:554-569.

Reece, K. S., W. L. Ribeiro, P. M. Gaffney, R. B. Carnegie & S. K. Allen. 2004. Microsatellite marker development and analysis in the eastern oyster (Crassostrea virginica): Confirmation of null alleles and non-Mendelian segregation ratios. J. Hered. 95:346-352.

Schuelke, M. 2000. An economic method for the fluorescent labeling of PCR fragments. Nat. Biotechnol. 18:233-234.

Thiel, T., W. Michalek, R. K. Varshney & A. Graner. 2003. Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.). Theor. Appl. Genet. 106:411-422.

Wang, D., X. Liao, L. Cheng, X. Yu & J. Tong. 2007. Development of novel EST-SSR markers in common carp by data mining from public EST sequences. Aquaculture 271:558-574.

Wang, Y. & X. Guo. 2007. Development and characterization of ESTSSR markers in the eastern oyster Crassostrea virginica. Mar. Biotechnol. 9:500-511.

Yu, J. K., T. M. Dake, S. Singh, D. Benscher, W. L. Li, B. Gill & M. E. Sorrells. 2004. Development and mapping of EST-derived simple sequence repeat markers for hexaploid wheat. Genome 47:805-818.

Yu, Z. & X. Guo. 2003. Genetic linkage map of the eastern oyster Crassostrea virginica Gmelin. Biol. Bull. 204:327-338.

Yu, Z. & X. Guo. 2006. Identification and mapping of disease-resistance QTLs in the eastern oyster, Crassostrea virginica Gmelin. Aquaculture 254:160-170.

Zhan, A. B., Z. M. Bao, X. L. Wang & J. J. Hu. 2005. Microsatellite markers derived from bay scallop Argopecten irradians expressed sequence tags. Fish. Sci. 71:1341-1346.

YONGPING WANG, (1) YAOHUA SHI (1,2) AND XIMING GUO (1) *

(1) Haskin Shellfish Research Laboratory, Institute of Marine and Coastal Sciences, Rutgers University, 6959 Miller A venue, Port Norris, New Jersey 08349; (2) Ocean College, Hainan University, Key Laboratory of Tropic Biological Resources, MOE, Hainan Key Laboratory of Tropical Hydrobiological Technology, 58 Renmin Road, Haikou, Hainan 570228, People's Republic of China

* Corresponding author. E-mail: xguo@hsrl.rutgers.edu
TABLE 1.
Locus name, sequence identity, motif type, primer sequences, PCR
conditions and allele number (in 30 oysters) of 66 EST-SSRs developed
in Crassostrea virginica.

Locus     GenBank ID   Motif         Primer Sequence (5'-3')

RUCV102    51877088    (TTG)4        ACCTGATCCTTCCTTTGTGG
                                     GCTCTTGATAGGAGTCATTTTCC

RUCV108    51876414    (ACA)4        CATCAATGCAGCAGAAAAGC
                                     CACTGCCTACACCGACAACC

RUCV109    51876365    (CGA)4        TCAGTTCCTCGCCTCCTACC
                                     TCGTGTGCTTGTGATGATCC

RUCV112    51568977    (CAACCA)4     CAGCCTCCAGGAAGTAGTGC
                                     CGGTAGTAGTTGGGGCTTCC

RUCV113    51568962    (ATC)4        AAAAACAACGCTGGAAAAGC
                                     GCTGGATTTTGTCCAAGAGG

RUCV114    51568799    (ATTG)4       GTGAGAAGGGATTGGAGTGC
                                     ATGAAATAATGGCGATACGG

RUCV116    51568721    (GAT)4(GAC)   AGGGACGTCTCGTCTTACGG
                                     CTCTCTCTGCCTTTGCATCC

RUCV119    51568681    (GAG)4        AGTCCGACGAATCAATCACC
                                     CTTCCTGCTGCAGACCTAGC

RUCV121    51568504    (GCT)4        CCTTAGTGGCAACAACAATCC
                                     AGAGACCAAATCCCATGTCG

RUCV122    51568396    (AGA)4        AAACATGGCAGAAGTTGACG
                                     TGGACCTGCTTCTTTCTTGG

RUCV125    51567984    (ACA)4        GGACGGTTCTACTCTGTGTTTCC
                                     ACTGATGACCCACAGCAAGC

RUCV126    51567665    (CAG)4        TTGTCTGTGAAGTCCGTTGG
                                     TCGTCGGGTAGATAGTTGTCG

RUCV131    51567118    (GCA)4        CTCTGGAGACAAATCCATGC
                                     CATTTCTCTGTGCTGATGACG

RUCV133    51566676    (AAAC)4       CATGAATGGCTAACTGAAAAGG
                                     CCTTGTAGAGGATGCTTCACC

RUCV135    31908515    (GGA)4        CTGTCTGAGTCCCCAGAAGC
                                     TCTTGCACAGCTTTTCTTCC

RUCV138    31907361    (AT)6         AAGCATTCCAACCTCTGTCC
                                     TGGCATCCAAACAACATACC

RUCV148    31906049    (CAAT)4       CGGATGGGACGTTAAATGG
                                     CATTGGTCACATCTCACACG

RUCV150    31905846    (TA)6         GTGGGGGTCATTCTATGTGG
                                     AGGTTGACGTTCCCTCTGC

RUCV152    31905701    (GATT)4       AAATGTGAGTCACGGTCAGG
                                     GCTTTTCGAGGGAGTGAGG

RUCV156    31905336    (TA)6         CATACGGTATCCTCTTATTTCAGC
                                     TTTTTCTTGCATTCGCTAGG

RUCV159    31904931    (TAT)4        GGGCACATTGAAGTGTTGG
                                     GAGGGGGAGAAATAGTGAAGG

RUCV164    31904689    (TC)6         GGAAGAGTGTTTTGAATTGACG
                                     ATATGTGATCCCCACACAAGG

RUCV165    31904655    (GA)6         GCCAAAGAAGCTCAAAAAGG
                                     GCTATGACGCATCCTTCTCC

RUCV168    31904205    (ATT)4        GTGGTTCAGCTTTTATCTGTCC
                                     TTACACGAATGTGGTGATGC

RUCV172    31903867    (GAG)4        CAACGCTATGAAGGGACAGG
                                     ATCTTGCACAGCTCCTTTGG

RUCV173    31903680    (CAA)4        GGAAGGGTGACCTAATGTGG
                                     GGACAGAATGTAAGCGTCTGC

RUCV176    31903249    (AAG)4        GGACTGTGAGTGGGAAGTGG
                                     CAGTGGTTTTGGGCTTTCC

RUCV183    31900834    (GA)6         GTGTGAAGTCAGGCTGTATGG
                                     GCACCACAAATACTGCATACC

RUCV185    31900617    (CAT)4        AGCGTGGCTACTCTTTCACC
                                     CACCTGAATCGCTCATTTCC

RUCV186    31900433    (AGC)4        GAAAAACGCAAAGAGGAAGG
                                     TGTTCTTTCTCGGGGTTAGC

RUCV190    14581219    (AGA)4        TTTGCTTCAAAAGTGGTTGG
                                     TCATTCAGCATGTTAGATGTGG

RUCV191    14581217    (TTA)4        GGGACTAGGTCGAAAAGACC
                                     CACGAAGAACATCGCTTCC

RUCV195    14581037    (ACAG)4       GACAAGACGTAGCCATCAACC
                                     AAGGTCCAACCATCCAACC

RUCV197    14580980    (TA)6         GTGACTGTACAAAGGCTGTGC
                                     GGAAAATGAGCCATCTACTGC

RUCV199    14580606    (CGGA)4       GACATGGCCAATCATCTCC
                                     TACCCCTTTATGTCCGTTCG

RUCV204    14581280    (AC)5         CTATGCTCGGCACTTCAGG
                                     AAAATGTAGGTTGGGTGTTCG

RUCV206    31901037    (AG)5         GGTGTGAAAAACATGCAACG
                                     GGCAGTAACAGCATTGAGTCC

RUCV210    31903448    (AT)5         ATAATTCAGGGATGGGTTGG
                                     GAATACAAGGCAAAATGGAAGC

RUCV212    31904211    (GT)5         AAAACCTACCCCTGGTTTCC
                                     TTAGTTGTCATTCGCGTTGC

RUCV216    31904635    (TA)5         GGACATCCGGGTCCTATACC
                                     GGAGACACATGTATGCAAAGAGC

RUCV218    31904852    (CA)5         TCTACCCACCCTGAGTCACC
                                     GATGGATCTCCTGGCCTAGC

RUCV220    31905003    (AT)5         ACAGGAGAATGCAGGAATGG
                                     GCGAGTTTTGACTTTACAATGC

RUCV221    31905130    (AT)5         CGAGATCGAAGGACAAAAGC
                                     GTGTCACAAGGAATAAAGATCACC

RUCV226    31905913    (GA)5         AAGCTAAAGCGTGTGTGTGC
                                     GCTTTCTCCAGGTTTTCTCG

RUCV227    31906040    (GA)5         CTATGCCACCACCACAGAGG
                                     CCTTCTCCTCCTCCAGTTCC

RUCV228    31906092    (TC)5         TCTCATGTTGGATGGAATGC
                                     TACCGAACGCCACTATCAGG

RUCV230    31907050    (CAT)4        GGACTTTGAGCAGGAAATGG
                                     GAAAGATGGCTGGAACATGG

RUCV235    31908461    (CT)5         CCAAACACGAGGAGTCTAACC
                                     GAGCCTCGATACACAACACC

RUCV237    31908791    (CT)5         GTGGGAGACAGAGGGAAGC
                                     AACATAGCAGTGGGCAGTCC

RUCV241    51172880    (AT)5         TGCAGCAAATTCAAAACAGC
                                     CAAGGGGAGAGAATTTTATTGG

RUCV243    51567484    (AG)5         TTCTGGGTTGTTTTTGTGAGG
                                     AACACTTGGCTCCAGCTACC

RUCV246    51567784    (AT)5         CCCAACAGACATTGGACTGC
                                     GAGATGACAGTGAGCCTTTCG

RUCV253    51876088    (TA)5         GGGTCCATGTTCTCTGACG
                                     TCACTGCTACATGGTAACAAGC

RUCV256    51877114    (CA)5         CAGGGGAAAACTTGTCATGC
                                     CCCCTCCATTTGTCGTAGG

RUCV263    51568075    (TTG)4        GTAGTAAGCTCCAGGGGAAGGA
                                     CACGGAGATCTCACATGCAA

RUCV265    31908056    (TA)5         ATCACCGATGGAAACAGTCC
                                     CCTAAATGTACAGATACAGCAGAAG

RUCV270    31902968    (TTTA)4       GGACCAAATATTCCACATCACAC
                                     AAGCTGAATGCCCAAACATC

RUCV272    31900597    (TA)6         AGCAATTCTGTGCTGATTCAAG
                                     TGAAAAATCCATGAGCGATG

RUCV274    14581106    (TTA)4        CCAACAACAAAACGTGGAAAC
                                     AGGGAGGGATGTTTATCGTG

RUCV277    14580875    (AC)5         GGCTGAGTTCAAATTCATGTTC
                                     GTTGGTTTGGTGCCATCTG

RUCV279    14581306    (AT)5         GTCATTTTGGCCCTAATCTTACAC
                                     AACAACACGAGGCGGTTATAC

RUCV280    14581359    (AT)5         GTGCGCACTTGATTTAGC
                                     GGGTTTTACGCCGTATTGTC

RUCV282    31903779    (AT)5         AATGCATTAGCGTCTGAAG
                                     CAAAGCATCCTTGGGTGAAG

RUCV284    31904125    (TA)5         ATTTCTTTCCGCAAGCAGTG
                                     CAGATTCAACCGAGATTGTGAG

RUCV287    31904707    (GTG)4        TCCAATGACGACCTTTAGAATG
                                     GGAAATGGGTGAGTTTTTGC

RUCV297    51567947    (TC)5         CATAAACCGGTGGAATACCC
                                     TTCCTCTAACTTGGCCGTTC

          Mg[CI.sub.2]        Tm        Expected   Observed   Allele
Locus         (MM)       ([degrees]C)     Size       Size      No.

RUCV102       1.5             60          224      243-250      5

RUCV108       1.5             60          153      318-337      4

RUCV109       1.5             60          213      225-231      3

RUCV112       1.5             60          175      168-192      3

RUCV113       1.5             60          116      345-364      7

RUCV114       1.5             60          234      230-258      6

RUCV116       1.5             60          121      137-143      3

RUCV119       1.5             56          255      483-553      7

RUCV121       2.5             56          296      628-646      5

RUCV122       1.5             56          229      621-695      8

RUCV125       2.0             60          261      277-283      4

RUCV126       2.0             60          240      255-260      3

RUCV131       2.0             60          266      468-502      9

RUCV133       1.5             60          122      135-139      2

RUCV135       2.0             55          196      465-543     11

RUCV138       1.5             56          281      304-311      3

RUCV148       1.5             60          247      216-270      6

RUCV150       1.5             60          278      288-302      3

RUCV152       1.5             60          280      298-310      6

RUCV156       1.5             60          299      314-332      9

RUCV159       1.5             60          258      275-283      5

RUCV164       1.5             60          232      253-260      5

RUCV165       2.0             60          252      355-433     10

RUCV168       2.0             55          277      282-298      4

RUCV172       2.0             55          256      497-522      8

RUCV173       2.0             60          230      231-249      3

RUCV176       2.0             55          287      626-636      4

RUCV183       1.5             56          136      144-165      6

RUCV185       2.0             55          187      206-209      2

RUCV186       2.0             55          261      263-278      2

RUCV190       2.0             55          292      310-322      4

RUCV191       2.0             55          286        301        3

RUCV195       1.5             60          267      408-435      5

RUCV197       2.5             60          177      183-232     11

RUCV199       1.5             60          266      275-294      9

RUCV204       2.0             60          199      190-226      5

RUCV206       2.0             60          272      287-292      3

RUCV210       1.5             60          298      320-328      2

RUCV212       1.5             60          297      310-320      5

RUCV216       1.5             60          233      204-260      8

RUCV218       1.5             60          205      223-225      2

RUCV220       1.5             60          168      176-188      2

RUCV221       1.5             60          126      131-146      5

RUCV226       1.5             60          293      283-298      4

RUCV227       1.5             60          278      527-660      8

RUCV228       1.5             60          206      476-507      7

RUCV230       2.0             55          136      152-167      6

RUCV235       1.5             60          135      142-154      2

RUCV237       1.5             60          279      299-303      3

RUCV241       1.5             60          226      245-264      6

RUCV243       1.5             60          217      235-237      2

RUCV246       1.5             60          185      196-205      4

RUCV253       1.5             60          224      231-263      7

RUCV256       1.5             60          195      419-452      3

RUCV263       1.5             60          225      227-252      6

RUCV265       1.5             60          347      365-377      5

RUCV270       1.5             60          576      522-601     11

RUCV272       1.5             60          154      168-179      4

RUCV274       2.0             55          235      227-232     12

RUCV277       1.5             60          354      374-381      6

RUCV279       1.5             60          395      412-432      8

RUCV280       1.5             60          413      428-450      6

RUCV282       1.5             60          433      408-453      5

RUCV284       1.5             60          519      504-547      7

RUCV287       2.0             55          408      413-431      4

RUCV297       1.5             60          355      359-382     12

Locus        Note

RUCV102

RUCV108

RUCV109

RUCV112

RUCV113   15/30 nulls

RUCV114

RUCV116

RUCV119

RUCV121

RUCV122

RUCV125

RUCV126   5/30 nulls

RUCV131

RUCV133   4/30 nulls

RUCV135

RUCV138

RUCV148

RUCV150

RUCV152   8/30 nulls

RUCV156

RUCV159

RUCV164

RUCV165

RUCV168

RUCV172

RUCV173

RUCV176

RUCV183

RUCV185

RUCV186

RUCV190

RUCV191      EF *

RUCV195

RUCV197

RUCV199

RUCV204

RUCV206

RUCV210   15/30 nulls

RUCV212

RUCV216      EF *

RUCV218

RUCV220

RUCV221

RUCV226

RUCV227   13/30 nulls

RUCV228

RUCV230

RUCV235

RUCV237   10/30 nulls

RUCV241

RUCV243

RUCV246

RUCV253

RUCV256

RUCV263

RUCV265   5/30 nulls

RUCV270

RUCV272

RUCV274

RUCV277

RUCV279

RUCV280   8/30 nulls

RUCV282

RUCV284

RUCV287

RUCV297

* EF, more than two fragments in some individuals

TABLE 2.
Segregation of 34 C. virginica EST-SSRs in a full-sib family tested
against Mendelian ratios. The presence of null-alleles (O) was
deduced based on parental and progeny genotypes.

Locus     Mother   Father   Progeny (N)   Progeny Genotype

RUCV108     AA       BO           90      AB:AO

RUCV109     AA       AB          100      AA:AB

RUCV113     BO       AC           99      AB:AO:BC:CO

RUCV114     BB       AB           97      AB:BB

RUCV116     AB       AA           95      AB:AA

RUCV119     CC       AB           81      AC:BC

RUCV121     CC       AB           79      AC:BC

RUCV126     BC       AB           98      AB:AC:BC:CC

RUCV131     AC       BB           99      AB:BC

RUCV135     AB       0            94      AO:BO

RUCV150     BB       AB          100      ABSB

RUCV152     AO       AO          100      AA+AO:OO

RUCV156     BB       AB           97      AB:BB

RUCV159     AA       BC           95      AB:AC

RUCV164     AA       AB           94      AA:AB

RUCV165     AC       AB           89      AA:AB:AC:BC

RUCV168     AB       BB           97      AB:BB

RUCV183     AC       BC          100      AB:AC:BC:CC

RUCV190     AB       BO           97      AB:AO:BB+BO

RUCV197     BD       AC           99      AB:BC:AD:CD

RUCV210     AO       0            97      AO:00

RUCV216     AB       BB           99      AB:BB

RUCV218     AA       AB           98      AA:AB

RUCV220     AB       BB          100      AB:BB

RUCV227     AB       CC           92      AC:BC

RUCV230     AB       BB           96      AB:BB

RUCV241     AB       AC           97      AA:AB:AC:BC

RUCV246     BB       AO          100      AB:BO

RUCV270     AO       AB          100      AA+AO:AB:BO

RUCV274     AB       CO           94      AC:BC:AO:BO

RUCV277     BB       AB           94      AB:BB

RUCV279     BB       AC          100      AB:BC

RUCV284     0        AO          100      AO:OO

RUCV297     CD       AB           95      AC:AD:BC:BD

Locus     Expected Ratio   Observed Ratio   P-value

RUCV108        1:1             58:32        0.0061

RUCV109        1:1             51:49        0.8415

RUCV113      1:1:1:1        24:21:30:24     0.6309

RUCV114        1:1             31:66        0.0004 *

RUCV116        1:1             54:41        0.1823

RUCV119        1:1             40:41        0.9115

RUCV121        1:1             39:40        0.9104

RUCV126      1:1:1:1        28:23:26:19     0.4854

RUCV131        1:1             59:40        0.0562

RUCV135        1:1             42:52        0.3023

RUCV150        1:1             49:51        0.8415

RUCV152        3:1             57:43        0.0000 *

RUCV156        1:1             65:32        0.0008 *

RUCV159        1:1             40:55        0.1238

RUCV164        1:1             38:56        0.0634

RUCV165      1:1:1:1        27:29:12:21     0.0491

RUCV168        1:1             48:49        0.9191

RUCV183      1:1:1:1        21:21:39:19     0.0144

RUCV190       1:l:2           24:24:49      0.4016

RUCV197      1:l:1:1        22:22:32:23     0.4139

RUCV210        1:1             47:50        0.7607

RUCV216        1:1             52:47        0.6153

RUCV218        1:1             55:43        0.2254

RUCV220        1:1             33:67        0.0007 *

RUCV227        1:1             45:47        0.8348

RUCV230        1:1             51:45        0.5403

RUCV241      1:1:1:1        23:19:29:26     0.5207

RUCV246        1:1             51:49        0.8415

RUCV270       2:l:1           70:28:02      0.0000 *

RUCV274      1:1:1:1        18:31:19:26     0.1864

RUCV277        1:1             50:44        0.5360

RUCV279        1:1             51:49        0.8415

RUCV284        1:1             25:75        0.0000 *

RUCV297      1:1:1:1         35:21:22:7     0.0002 *

* Designates significant deviation from expected Mendelian
ratios after Bonferroni correction.

TABLE 3.
SSR-containing ESTs of C. virginica with significant homology
to known genes from other organisms.

Locus         Sequence ID         Gene Function

RUCV102   gb|AA134580.1|        SLC6A9 protein (Bos taurus)

RUCV113   ref|NP_001086845.1|   MGC83353 protein (Xenopus
                                  laevis).

RUCV116   ref|NP_001075868.1|   elongation factor 1 beta
                                  (Oryctolagus cuniculus).

RUCV119   ref|XP_001200338.1|   PREDICTED: similar to Pesl
                                  -prov protein
                                  (Strongylocentrotus
                                  purpuratus).

RUCV121   gb|AAV84269.1|        ribosomal protein P2-like
                                  (Culicoides sonorensis)

RUCV122   gb|ABZ04266.1|        ribosomal protein rps15
                                  (Linens viridis)

RUCV131   gb|EDL30000.1|        transmembrane protein 57 (Mus
                                  musculus)

RUCV135   ref|XP_001622481.1|   predicted protein
                                  (Nematostella vectensis).

RUCV150   dbj|BAE78960.1|       aspartate racemase (Scapharca
                                  broughtonii)

RUCV172   ref|XP_001630508.1|   predicted protein
                                  (Nematostella vectensis).

RUCV173   ref|XP_683651.21      PREDICTED: hypothetical
                                  protein (Danio rerio)

RUCV176   ref|NP990272.1|       chromodomain helicase DNA
                                  binding protein 1 (Gallus
                                  gallus)

RUCV185   gb|ABW97741.1|        beta-actin (Crassostrea
                                  ariakensis)

RUCV186   ref|XP_795301.1|      PREDICTED: hypothetical
                                  protein (Strongylocentrotus
                                  purpuratus).

RUCV210   ref|XP_001607815.1|   PREDICTED: similar to vacuolar
                                  proton atpases isoform 3
                                  (Nasonia vitripennis).

RUCV216   ref|XP_001079310.1|   erg gene (erg_E) (Xenopus
                                  laevis).

RUCV220   ref|XP_780065.1|      PREDICTED: similar to receptor
                                  tyrosine kinase
                                  (Strongylocentrotus
                                  purpuratus).

RUCV221   BC003832.1            Mus musculus S100 calcium
                                  binding protein A6
                                  (calcyclin), Mrna

RUCV226   ref|XP785663.21       PREDICTED: similar to zinc
                                  finger protein
                                  (Strongylocentrotus
                                  purpuratus).

RUCV227   ref|XP_001199159.1|   PREDICTED: similar to KIAA0445
                                  protein, partial
                                  (Strongylocentrotus
                                  purpuratus)

RUCV228   ref|NP_001009557.1|   solute carrier family 6
                                  (neurotransmitter transporter,
                                  glycine),member 5 (Danio
                                  rerio)

RUCV230   dbj|BAE80701.I        cytoplasmic actin (Pinctada
                                  fucata)

RUCV235   gb|ABS57447.1|        heat shock protein hsp21.4
                                  (Heliconius erato)

RUCV243   ref|XP_001658956.1|   ribosomal RNA
                                  methyltransferase (Aedes
                                  aegypti).

RUCV256   ref|XP001192377.1|    PREDICTED: similar to
                                  dihydropyrimidinase, partial
                                  (Strongylocentrotus
                                  purpuratus)

RUCV263   ref|NP_001038592.1|   hypothetical protein LOC567
                                  109 (Danio rerio).

Locus     E-value

RUCV102   7.00E-15

RUCV113   3.00E-45

RUCV116   3.00E-73

RUCV119   3.00E-48

RUCV121   2.00E-19

RUCV122   4.00E-70

RUCV131   4.00E-27

RUCV135   2.00E-11

RUCV150   2.00E-30

RUCV172   1.00E-18

RUCV173   4.00E-29

RUCV176   3.00E-36

RUCV185   1.00E-140

RUCV186   2.00E-18

RUCV210   3.00E-47

RUCV216   2.00E-63

RUCV220   1.00E-12

RUCV221   1.00E-15

RUCV226   2.00E-61

RUCV227   8.00E-58

RUCV228   5.00E-81

RUCV230   4.00E-154

RUCV235   4.00E-10

RUCV243   2.00E-33

RUCV256   1.00E-104

RUCV263   6.00E-13
COPYRIGHT 2009 National Shellfisheries Association, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2009 Gale, Cengage Learning. All rights reserved.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Author:Wang, Yongping; Shi, Yaohua; Guo, Ximing
Publication:Journal of Shellfish Research
Article Type:Report
Geographic Code:1CANA
Date:Apr 1, 2009
Words:5998
Previous Article:Consumption of Scrippsiella lachrymosa resting cysts by the eastern oyster (Crassostrea virginica).
Next Article:A bioeconomic analysis of management plans for the public oyster grounds of the Rappahannock River.
Topics:



Related Articles
Identification of Crassostrea ariakensis and related oysters by multiplex species-specific PCR.
Its length polymorphism in oysters and its use in species identification.
Characteristics of crassostrea ariakensis (Fujita 1913) and Crassostrea virginica (Gmelin 1791) in the discharge area of a nuclear power plant in...
Assessment of genetic diversity of the eastern oyster Crassostrea virginica in Veracruz, Mexico using microsatellite markers.
Discrimination of nine Crassostrea oyster species based upon restriction fragment-length polymorphism analysis of nuclear and mitochondrial DNA...
Assessing in situ tolerances of eastern oysters (Crassostrea virginica) under moderate hypoxic regimes: implications for restoration.
Seasonal variation of physiological parameters in the eastern oyster Crassostrea virginica from a tropical region of the Gulf of Mexico.
Bacterial community profiling of the eastern oyster (Crassostrea virginica): comparison of culture-dependent and culture-independent outcomes.
Heat shock protein 70 expression in juvenile Eastern oysters, Crassostrea virginica (Gmelin, 1791), exposed to anoxic conditions.
Population genetics of the Eastern oyster Crassostrea virginica (Gmelin, 1791) in the Gulf of Mexico.

Terms of use | Copyright © 2013 Farlex, Inc. | Feedback | For webmasters | Submit articles