Printer Friendly
The Free Library
19,122,084 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Humans as reservoir for enterotoxin gene-carrying Clostridium perfringens type A.


We found a prevalence of 18% for enterotoxin enterotoxin /en·tero·tox·in/ (en´ter-o-tok?sin)
1. a toxin specific for the cells of the intestinal mucosa.

2. a toxin arising in the intestine.

3.
 gene-carrying (cpe+) Clostridium perfringens Clostridium per·frin·gens or Clostridium welchii
n.
Gas bacillus.


Clostridium perfringens Infectious disease An anaerobic gram-positive spore-forming rod, widely distributed in nature and present in the
 in the feces of healthy food handlers by PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
 and isolated the organism from 11 of 23 PCR-positive persons by using hydrophobic grid membrane filter-colony hybridization hybridization /hy·brid·iza·tion/ (hi?brid-i-za´shun)
1. crossbreeding; the act or process of producing hybrids.

2. molecular hybridization

3.
. Several different cpe genotypes were recovered. The prevalence was 3.7% for plasmidial IS 1151-cpe, 2.9% for plasmidial IS 1470-like-cpe, 0.7% for chromosomal IS1470-cpe, and 1.5% for unknown cpe genotype. Lateral spread of cpe between C. perfringens strains was evident because strains from the same person carried IS1470-like cpe but shared no genetic relatedness according to pulsed-field gel electrophoresis analysis. Our findings suggest that healthy humans serve as a rich reservoir for cpe+ C. perfringens type A and may play a role in the etiology of gastrointestinal diseases caused by this organism. The results also indicate that humans should be considered a risk factor for spread of C. perfringens type A food poisoning food poisoning, acute illness following the eating of foods contaminated by bacteria, bacterial toxins, natural poisons, or harmful chemical substances. It was once customary to classify all such illnesses as "ptomaine poisoning," but it was later discovered that  and that they are a possible source of contamination for C. perfringens type A food poisoning.

**********

Clostridium perfringens is classified into 5 types (A-E A-E, AE above-elbow; see under amputation. ) n the basis of its ability to produce [greater than or equal to] 1 of the major lethal toxins [alpha], [beta], [epsilon], and t (1). Enterotoxin (CPE)-producing (cpe+) C. perfringens type A is reported continuously as 1 of the most common food poisoning agents worldwide (2-4). An increasing number of reports also implicate im·pli·cate  
tr.v. im·pli·cat·ed, im·pli·cat·ing, im·pli·cates
1. To involve or connect intimately or incriminatingly: evidence that implicates others in the plot.

2.
 the organism in 5%-15% of antimicrobial drug-associated diarrhea (AAD AAD American Academy of Dermatology.
AAD American Association of Dermatology
) and sporadic diarrhea (SD) cases in humans as well as diarrhea cases in animals (1,5-9). Most food poisoning strains studied to date carry cpe in their chromosomes; isolates from AAD and SD cases bear cpe in a plasmid (10,11). Furthermore, genetic studies have shown that in C. perfringens strains with the chromosomally located cpe, IS1470 sequences are found upstream and downstream of cpe (12,13). However, in strains with cpe in the plasmid, 2 different genetic arrangements (either IS1151 or IS1470-like sequences) have been recognized downstream of cpe (11,14).

Why C. perfringens strains with cpe located on chromosomes or plasmids cause different diseases has not been satisfactorily explained. However, the relatively greater heat resistance of the strains with chromosomally located cpe is a plausible explanation for these strains' survival in cooked food, thus causing instances of food poisonings (15). The presence of C. perfringens strains with chromosomally located cpe in 1.4% of American retail food indicates that these strains have an access to the food chain (16). The sources and routes of contamination are unclear.

An explanation for the strong association between C. perfringens strains with plasmidially located cpe and cases of AAD and SD disease may be in vivo in vivo /in vi·vo/ (ve´vo) [L.] within the living body.

in vi·vo
adj.
Within a living organism.



in vivo adv.
 transfer of the cpe plasmid to C. perfringens strains of the normal intestinal microbiota Microbiota (human)

Microbial flora harbored by normal, healthy individuals. A number of microorganisms have become adapted to a particular site or ecologic niche in or on their host.
 (17). Thus, a small amount of ingested cpe+ C. perfringens would act as an infectious agent infectious agent Pathogen, see there  and transfer the cpe plasmid to cpe- C. perfringens strains of the normal microbiota. This process would result in the persistence of cpe+ C. perfringens in the intestines. Chronic exposure to CPE would explain the severity and long duration of symptoms (17). Conjugative transfer of the cpe plasmid has been demonstrated in vitro in vitro /in vi·tro/ (in ve´tro) [L.] within a glass; observable in a test tube; in an artificial environment.

in vi·tro
adj.
In an artificial environment outside a living organism.
 (18), but currently no data exist on lateral transfer of cpe in vivo, and whether cpe+ strains that cause AAD and SD are resident in the gastrointestinal tract gastrointestinal tract
n.
The part of the digestive system consisting of the stomach, small intestine, and large intestine.


Gastrointestinal tract 
 or acquired before onset of the disease is unknown.

Although the ubiquitous distribution of C. perfringens in nature is well documented, the epidemiology of cpe+ strains has not yet been established. Less than 5% of global C. perfringens isolates are estimated to carry cpe (1), and the prevalence of different cpe genotypes in specific ecologic niches is not known. In this study, healthy persons were screened for fecal carriage of cpe, and cpe+ strains were further isolated by using hydrophobic grid membrane filter-colony hybridization. The cpe genotype and location of cpe were determined from strains by detecting different insertion sequence insertion sequence
n.
Any of several discrete DNA sequences that repeat at various sites on a bacterial chromosome, on certain plasmids, and on bacteriophages and that can move from one site to another on the chromosome, to another plasmid in the same
 (IS) elements attached to cpe (plasmid types IS1151-cpe and IS1470-like-cpe and chromosomal type IS1470-cpe). The genetic relationship between cpe+ and cpe- C. perfringens isolates obtained from cpe carriers was assessed with pulsed-field gel electrophoresis (PFGE PFGE Pulsed-Field Gel Electrophoresis ).

Materials and Methods

Fecal Samples

A total of 136 fecal samples, 102 (75%) from female food handlers and 34 (25%) from male food handlers, were collected from food handlers in southern Finland during summer 2003. These persons reported no gastrointestinal symptoms at the time of sampling. Their ages ranged from 15 to 65 years (mean 30 years, median 24 years). The samples were kept at--70[degrees]C until investigated.

Detection and Isolation

Each fecal sample (1 g) was divided into 2 tubes that contained freshly prepared thioglycollate (40 mL) (Oxoid, Basingstoke, UK). One tube was heated at 75[degrees]C for 20 min; the other was left unheated. After anaerobic anaerobic /an·aer·o·bic/ (an?ah-ro´bik)
1. lacking molecular oxygen.

2. growing, living, or occurring in the absence of molecular oxygen; pertaining to an anaerobe.
 incubation at 37[degrees]C for 20-22 h, the presence of cpe in each tube was determined by nested PCR (19). Persons with a cpe-positive fecal sample are hereafter referred to as cpe carriers.

Hydrophobic grid membrane filter-colony hybridization (HGMF-CH) (20) was used to isolate cpe+ C. perfringens from cpe carriers. In addition to probe-positive colonies, those showing no hybridization signals but having a typical color for C. perfringens colonies (usually black, occasionally gray or grayish yellow) were isolated from each sample to obtain a collection of both cpe+ and cpe- C. perfringens from a single sample and to further study the genetic relatedness of these isolates by PFGE (see below).

The isolates were subjected to PCR to determine the toxinotype (A-E) and the presence of cpe (21). C. perfringens strains NCTC NCTC National Conservation Training Center
NCTC National Counterterrorism Center (9/11 Commission Report)
NCTC National Cable Television Cooperative
NCTC National Collection of Type Cultures (UK laboratory) 
 8239, ATCC ATCC American Type Culture Collection, see there  3626, CCUG CCUG Culture Collection, University of Göteborg (Sweden)  2036, CCUG 2037, and CCUG 44727 were used as positive controls.

Molecular Typing

C. perfringens isolates that possessed cpe were further studied by PCR to determine the cpe genotype of the strain. Total DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 was isolated by using Advamax beads (Edge Biosystems, Gaithersburg, MD, USA) according to the manufacturer's instructions. IS elements downstream of cpe that determine the cpe genotype (IS1151-cpe, IS1470-like-cpe, or IS1470-cpe) of each isolate were characterized by using primers and protocols described in Table 1. The location of cpe (plasmid or chromosome) was concluded according to the genotyping results (Table 1).

C. perfringens isolates were then typed by PFGE with ApaI and SmaI (New England Biolabs New England Biolabs (NEB) produces and supplies reagents for the life science industry. NEB offers a large selection of recombinant and native enzymes for genomic research. It also offers products in the areas related to proteomics and drug discovery. , Beverly, MA, USA) to study the genetic relationships between isolates (25). PFGE profiles were analyzed visually and with a computer software program (Bionumerics, version 4.5; Applied Maths, Kortrijk, Belgium). The similarities between macrorestriction patterns (MRP (Material Requirements Planning) An information system that determines what assemblies must be built and what materials must be procured in order to build a unit of equipment by a certain date. ) were expressed by Dice coefficient correlation, and clustering by the unweighted pair-group method with arithmetic averages was used to construct a dendrogram A dendrogram is a tree diagram frequently used to illustrate the arrangement of the clusters produced by a clustering algorithm (see cluster analysis). Dendrograms are often used in computational biology to illustrate the clustering of genes. .

Cytotoxicity Test on Vero Cells

To test the capability of cpe+ strains to produce CPE, 1-3 cpe+ isolates representing each MRP were sporulated (26). The final culture in modified Duncan-Strong medium (Sigma-Aldrich Chemie, Steinheim, Switzerland) was examined by phase-contrast microscopy to confirm the sporulation sporulation /spor·u·la·tion/ (spor?u-la´shun) formation of spores.

spor·u·la·tion
n.
The production or release of spores.



sporulation

formation of spores or sporozoites.
 of the strain. The culture was then sonicated until >95% of the spores were free, as determined by phase-contrast microscopy. The culture was centrifuged at 1,500x g for 25 min at 4[degrees]C, and cytotoxicity of the supernatant supernatant /su·per·na·tant/ (-na´tant) the liquid lying above a layer of precipitated insoluble material.

supernatant

the liquid lying above a layer of precipitated insoluble material.
 was tested with a Vero cell assay according to Sandvig and Olsnes (27). The assay monitors the inhibition of protein synthesis in Vero cells after addition of toxic proteins, including CPE. The Vero cells were grown in a minimal essential medium (Gibco BRL BRL

In currencies, this is the abbreviation for the Brazilian Real.

Notes:
The currency market, also known as the Foreign Exchange market, is the largest financial market in the world, with a daily average volume of over US $1 trillion.
, Paisley, UK) supplemented with 10% fetal calf serum.

The supernatant was precipitated in 80% saturated ammonium sulfate and kept at 4[degrees]C before the Vero cell assay. The strain was defined as producing CPE when the inhibition of protein synthesis of Vero cells was >20%.

Results

Detection and Isolation

The gene encoding for cpe was detected in the feces of 25 food handlers (18%). For 23 samples (92%), the heated tube showed the positive result, and for 3 of them the unheated tube also yielded a positive PCR result. For 2 samples, only the unheated tube showed a positive PCR result. No association between gender or age and carrier status of cpe was found (Table 2).

The HGMF-CH method was used to determine whether cpe+ C. perfringens was present in 23 persons; isolation was successful from 11 persons. The average number of cpe+ C. perfringens isolates carried by these persons was 2.5 x [10.sup.2] CFU/g. In 10 of these persons, cpe- C. perfringens was also recovered; the average number was 1.8 x [10.sup.4] CFU/g. In each of these 10 case-patients, cpe- C. perfringens formed a 10- to 1,000-fold majority of the C. perfringens population. In 1 person, only cpe+ C. perfringens isolates were recovered. A total of 77 C. perfringens isolates (average of 7 isolates per person) were recovered; all possessed the gene encoding for the [alpha] toxin only, which signified that they belonged to type A (online Appendix Table, available from http://www.cdc.gov/ncidod/ EID/vol12 no 11/06-0478_appT.htm). Of these, 36 isolates were positive for cpe (Appendix Table).

Molecular Typing

When the relative prevalence of different cpe genotypes was determined with PCR, strains representing the IS1151-cpe type were found in 5 persons (3.7%) and strains representing the IS1470-like-cpe type were found in 4 persons (2.9%), findings that indicated that all of these persons carried C. perfringens strains with plasmidially located cpe. A strain with chromosomally located cpe, representing the IS1470-cpe type, was detected in 1 person (0.7%). Furthermore, cpe+ C. perfringens strains representing none of the aforementioned types, referred to as cpe+ strains with an unknown genetic arrangement downstream of cpe, were observed in 2 persons (1.5%) (Appendix Table) (Figure 1).

[FIGURE 1 OMITTED]

In PFGE analysis, all isolates were typeable with SmaI restriction enzyme restriction enzyme

Protein (more specifically, an endonuclease) produced by bacteria that cleaves DNA at specific sites along its length. Thousands have been found, from many different bacteria; each recognizes a specific nucleotide sequence.
, and all but 2 isolates were typeable with ApaI. The discriminatory power was equal with both enzymes used, which showed a high genetic diversity among C. perfringens. PFGE analysis showed 1-5 different MRPs in each person, with cpe+ and cpe- isolates generally being unrelated to each other. However, in 1 case, 2 isolates (CPI 57-1 and CPI 57-2) from the same person showed identical MRPs with both restriction enzymes, the former being cpe+ and the latter cpe- (Appendix Table; Figure 2). In 8 of 11 persons, cpe+ isolates with similar MRPs were identified, whereas 3 persons carried cpe+ isolates with 2 different MRPs. In 2 of these persons (numbers 18 and 57), both MRPs represented the same cpe genotype (IS1470-like-cpe); the third person (number 75) had MRPs with different cpe genotypes (IS1470-like-cpe and IS1151-cpe) (Appendix Table).

[FIGURE 2 OMITTED]

Cytotoxicity Test on Vero Cells

Successful sporulation was achieved with isolates representing 9 different MRPs. In 8 (89%) of these MRPs, [greater than or equal to] 20% inhibition of protein synthesis was detected in Vero cells, which suggested CPE production of the strain (Table 3).

Discussion

We report the first in-depth study of the fecal carriage of cpe+ C. perfringens by healthy humans, which showed that the organism is widely distributed in this ecologic niche. By using the novel HGMF-CH method, we demonstrated that low numbers of cpe+ C. perfringens strains are frequently present among the dominant cpe- C. perfringens. HGMF-CH proved invaluable in the isolation of cpe+ C. perfringens; in all instances, when both cpe+ and cpe- C. perfringens were isolated, the former existed as a minority and thus would have been missed by conventional isolation methods.

Healthy persons are a rich reservoir for cpe+ C. perfringens; type A strains representing several different cpe genotypes (strains with plasmidially located IS1470-like--cpe or IS1151-cpe and chromosomally located IS1470-cpe) as well as type A strains with unrecognized genetic arrangement attached to cpe were present. That IS1151-cpe was the most prevalent and IS1470-cpe represented the minority of the cpe genotypes are findings in line with a previous study that suggested that cpe+ C. perfringens strains with plasmidially located cpe are more common in nature than cpe+ C. perfringens strains with chromosomally located cpe (28). The presence of strains with unrecognized genetic arrangement attached to cpe reflects the wide genetic variety of cpe+ strains. Because production of CPE was demonstrated in 1 of these cpe+ strains with an unknown cpe genotype, the gene was apparently intact and functional.

The presence of cpe+ C. perfringens type A strain with chromosomally located cpe and a full capacity to produce CPE in the feces of healthy food handlers indicates that human handling of food should be considered a risk factor for contamination. C. perfringens type A food poisoning typically follows from the ingestion ingestion /in·ges·tion/ (-chun) the taking of food, drugs, etc., into the body by mouth.

in·ges·tion
n.
1. The act of taking food and drink into the body by the mouth.

2.
 of cpe+ C. perfringens vegetative vegetative /veg·e·ta·tive/ (vej?e-ta?tiv)
1. of, pertaining to, or characteristic of plants.

2. concerned with growth and nutrition, as opposed to reproduction.

3.
 cells formed in food during storage and serving (29). The low numbers of cpe+ C. perfringens spores present in the feces of the person handling the food may be transferred to the food. Under favorable conditions, cpe+ strains with chromosomally located cpe will easily survive and multiply during food processing and cause food poisoning because they survive broader temperature ranges during growth and maintenance phases than other C. perfringens strains (15,30).

Evidence of in vivo horizontal transfer of cpe between C. perfringens strains was obtained in the PFGE analysis. First, in 2 persons (numbers 18 and 57), IS1470-1ike-cpe was observed in strains with no genetic relatedness, which indicated lateral spread of IS1470-1ike-cpe (Appendix Table). In vitro conjugative transfer of the cpe plasmid has been demonstrated with strain F4969 carrying IS1470-like-cpe (18,24), which supports our findings. Second, the evidence of in vivo horizontal transfer of cpe was further strengthened by observing a loss or acquisition of IS1470-like-cpe in 1 strain (MRP 15) (Appendix Table). In this case, the isolate CPI 57-1 carried IS1470-like-cpe, whereas CPI 57-2 was lacking in the same element; these strains were nevertheless isolated from the same person and shared an identical MRP. A potential donor or recipient strain (MRP 13 and 13b) was demonstrated from the same sample, which carried IS1470-like-cpe but shared no genetic relatedness to CPI 57-1 (Appendix Table) (Figure 2). All ISll51-cpe isolates from the same persons shared identical MRPs; thus, no evidence for in vivo lateral transfer of ISll51-cpe was observed.

Finally, our study provides a new insight into the pathogenesis of AAD and SD caused by cpe+ C. perfringens type A. These diseases have been speculated to result from the ingestion of small numbers of cpe+ strains, which transfer the cpe plasmid to cpe- C. perfringens strains present in the normal intestinal microbiota (17). Our results support this theory because we found small numbers of cpe+ C. perfringens type A with plasmidially located cpe in the human gastrointestinal tract as well as evidence for the lateral spread of cpe. Our findings therefore indicate that AAD or SD caused by cpe+ C. perfringens type A may occur as an endogenous infection endogenous infection
n.
An infection caused by an infectious agent that is already present in the body, but has previously been inapparent or dormant.
, present in the gastrointestinal tract and causing the disease after exposure to antimicrobial drugs or other predisposing factors. However, the capacity of these cpe+ strains to persist in the gastrointestinal tract remains unknown; as does how these strains find their way to the gastrointestinal tract. Nevertheless, because they are apparently common in human feces, cpe+ strains are presumably pre·sum·a·ble  
adj.
That can be presumed or taken for granted; reasonable as a supposition: presumable causes of the disaster.
 acquired from the environment. The question then arises whether these cpe+ strains are ingested with food, which would indicate that AAD and SD caused by cpe+ C. perfringens type A are foodborne.

In conclusion, healthy humans serve as a rich reservoir for cpe+ C. perfringens type A strains and may play an important role in gastrointestinal diseases caused by this pathogen. Humans should therefore be considered a risk factor for spread of C. perfringens type A food poisoning. Future studies to determine the presence of different cpe genotypes in other ecologic niches are warranted to elucidate the epidemiology of this major pathogen.

Acknowledgments

We thank Sonja Helander, Kirsi Ristkari, Anu Seppanen, and Tina O'Sullivan for excellent technical assistance.

Financial support was obtained from the Research Training Programme of the University of Helsinki The University of Helsinki is not to be confused with the Helsinki University of Technology.

The University of Helsinki (Finnish: Helsingin yliopisto, Swedish: Helsingfors universitet 
, Finnish Veterinary Foundation, Walter Ehrstom Foundation, and European Union European Union (EU), name given since the ratification (Nov., 1993) of the Treaty of European Union, or Maastricht Treaty, to the

European Community
 (the concerted action QLK2-CT2001-01267).

References

(1.) Smedley JG III, Fisher DJ, Sayeed S, Chakrabarti G, McClane BA. The enteric enteric /en·ter·ic/ (en-ter´ik) within or pertaining to the small intestine.

en·ter·ic
adj.
1. Of, relating to, or within the intestine.

2.
 toxins of Clostridium perfringens. Rev Physiol Biochem Pharmacol. 2004;152:183-204.

(2.) Adak GK, Long SM, O'Brien SJ. Trends in indigenous foodborne disease and deaths, England and Wales England and Wales are both constituent countries of the United Kingdom, that together share a single legal system: English law. Legislatively, England and Wales are treated as a single unit (see State (law)) for the conflict of laws. : 1992 to 2000. Gut. 2002;51:832-41.

(3.) Lukinmaa S, Takkunen E, Siitonen A. Molecular epidemiology molecular epidemiology Molecular medicine An evolving field that combines the tools of standard epidemiology–case studies, questionnaires and monitoring of exposure to external factors with the tools of molecular biology–eg, restriction endonucleases,  of Clostridium perfringens related to food-borne outbreaks of disease in Finland from 1984 to 1999. Appl Environ Microbiol. 2002;68: 3744-9.

(4.) Mead PS, Slutsker L, Dietz V, McCaig LF, Bresee JS, Shapiro C, et al. Food-related illness and death in the United States. Emerg Infect Dis. 1999;5:607-25.

(5.) Abrahao C, Carman Car´man

n. 1. A man whose employment is to drive, or to convey goods in, a car or car.
 RJ, Hahn H, Liesenfeld O. Similar frequency of detection of Clostridium perfringens enterotoxin and Clostridium difficile Clostridium difficile A common cause of bacterial colitis; it is the causative agent in 99% of pseudomembranous colitis, and 20-30% of antibiotic-associated diarrhea  toxins in patients with antibiotic-associated diarrhea antibiotic-associated diarrhea Antibiotic-associated colits, gastroenteritis Diarrhea caused by Clostridium difficile, most often seen in a Pt taking antibiotics; many persons infected with C difficile are asymptomatic; in others, a C difficile . Eur J Clin Microbiol Infect Dis. 2001;20:676-7.

(6.) Asha NJ, Wilcox MH. Laboratory diagnosis of Clostridium perfringens antibiotic-associated diarrhoea. J Med Microbiol. 2002;51:891-4.

(7.) Borriello SP, Larson HE, Welch AR, Barclay F, Stringer MF, Bartholomew BA. Enterotoxigenic en·ter·o·tox·i·gen·ic
adj.
Of or being an organism containing or producing an enterotoxin.


Enterotoxigenic 
 Clostridium perfringens: a possible cause of antibiotic-associated diarrhoea. Lancet. 1984;1:305-7.

(8.) Brett MM, Rodhouse JC, Donovan TJ, Tebbutt GM, Hutchinson DN. Detection of Clostridium perfringens and its enterotoxin in cases of sporadic diarrhoea. J Clin Pathol. 1992;45:609-11.

(9.) Mpamugo O, Donovan T, Brett MM. Enterotoxigenic Clostridium perfringens as a cause of sporadic cases of diarrhoea. J Med Microbiol. 1995;43:442-5.

(10.) Collie collie, breed of large, agile working dog developed in Scotland during the 17th and 18th cent. It stands from 22 to 26 in. (55.9–66 cm) high at the shoulder and weighs from 50 to 75 lb (22.7–34 kg).  RE, McClane BA. Evidence that the enterotoxin gene can be episomal in Clostridium perfringens isolates associated with nonfood-borne human gastrointestinal diseases. J Clin Microbiol. 1998;36:30-6.

(11.) Cornillot E, Saint-Joanis B, Daube For other uses of "Daub(e)", see Daub.
Daube is a classic French stew made with cubed beef braised in wine, vegetables, garlic, and herbes de provence. Although most modern recipes call for red wine, a minority call for white wine, and the earliest recorded daube recipes call
 G, Katayama S, Granum granum

[L.] grain; very small particles.
 PE, Canard ca·nard  
n.
1. An unfounded or false, deliberately misleading story.

2.
a. A short winglike control surface projecting from the fuselage of an aircraft, such as a space shuttle, mounted forward of the main wing and
 B, et al. The enterotoxin gene (cpe) of Clostridium perfringens can be chromosomal or plasmid-borne. Mol Microbiol. 1995;15:639-47.

(12.) Brynestad S, Synstad B, Granum PE. The Clostridium perfringens enterotoxin gene is on a transposable transposable /trans·pos·a·ble/ (trans-poz´ah-b'l) capable of being interchanged or put in a different place or order.  element in type A human food poisoning strains. Microbiology. 1997;143:2109-15.

(13.) Brynestad S, Granum PE. Evidence that Tn5565, which includes the enterotoxin gene in Clostridium perfringens, can have a circular form which may be a transposition transposition /trans·po·si·tion/ (trans?po-zish´un)
1. displacement of a viscus to the opposite side.

2.
 intermediate. FEMS Microbiol Lett. 1999;170:281-6.

(14.) Miyamoto K, Chakrabarti G, Morino Y, McClane BA. Organization of the plasmid cpe locus in Clostridium perfringens type A isolates. Infect Immun. 2002;70:4261-72.

(15.) Sarker MR, Shivers RP, Sparks SG, Juneja VK, McClane BA. Comparative experiments to examine the effects of heating on vegetative cells and spores of Clostridium perfringens isolates carrying plasmid genes versus chromosomal enterotoxin genes. Appl Environ Microbiol. 2000;66:3234-40.

(16.) Wen Q, McClane BA. Detection of enterotoxigenic Clostridium perfringens type A isolates in American retail foods. Appl Environ Microbiol. 2004;70:2685-91.

(17.) Sparks SG, Carman RJ, Sarker MR, McClane BA. Genotyping of enterotoxigenic Clostridium perfringens fecal isolates associated with antibiotic-associated diarrhea and food poisoning in North America. J Clin Microbiol. 2001;39:883-8.

(18.) Brynestad S, Sarker MR, McClane BA, Granum PE, Rood rood (rd), crucifix mounted above the entrance to the chancel and flanked by large figures of the Virgin and St.  JI. Enterotoxin plasmid from Clostridium perfringens is conjugative. Infect Immun. 2001;69:3483-7.

(19.) Miwa N, Nishina T, Kubo S, Fujikura K. Nested polymerase chain reaction Nested polymerase chain reaction is a modification of polymerase chain reaction intended to reduce the contaminations in products due to the amplification of unexpected primer binding sites.  for detection of low levels of enterotoxigenic Clostridium perfringens in animal feces and meat. J Vet Med Sci. 1996;58:197-203.

(20.) Heikinheimo A, Lindstrom M, Korkeala H. Enumeration 1. (mathematics) enumeration - A bijection with the natural numbers; a counted set.

Compare well-ordered.
2. (programming) enumeration - enumerated type.
 and isolation of cpe-positive Clostridium perfringens spores from feces. J Clin Microbiol. 2004;42:3992-7.

(21.) Heikinheimo A, Korkeala H. Multiplex PCR assay for toxinotyping Clostridium perfringens isolates obtained from Finnish broiler broiler

a young (about 8 weeks old) male or female chicken weighing 3 to 3.5 lb.
 chickens. Lett Appl Microbiol. 2005;40:407-11.

(22.) Brynestad S. Genetic studies on Clostridium perfringens enterotoxin [doctoral thesis]. Oslo: Norwegian College of Veterinary Medicine veterinary medicine, diagnosis and treatment of diseases of animals. An early interest in animal diseases is found in ancient Greek writings on medicine. Veterinary medicine began to achieve the stature of a science with the organization of the first school in the ; 1997.

(23.) Daube G, Simon P, Kaeckenbeeck A. ISI ISI International Sensitivity Index, see there 151, an IS-like element of Clostridium perfringens. Nucleic Acids Nucleic acids
The cellular molecules DNA and RNA that act as coded instructions for the production of proteins and are copied for transmission of inherited traits.
 Res. 1993;21:352.

(24.) Miyamoto K, Wen Q, McClane BA. Multiplex PCR genotyping assay that distinguishes between isolates of Clostridium perfringens type A carrying a chromosomal enterotoxin gene (cpe) locus, a plasmid cpe locus with an IS1470-like sequence, or a plasmid cpe locus with an ISll51 sequence. J Clin Microbiol. 2004;42:1552-8.

(25.) Ridell J, Bjorkroth J, Eisgruber H, Schalch B, Stolle A, Korkeala H. Prevalence of the enterotoxin gene and clonality of Clostridium perfringens strains associated with food-poisoning outbreaks. J Food Prot. 1998;61:240-3.

(26.) Miwa N, Masuda T, Kwamura A, Terai This article is about the regions of India and Nepal. For specific Terai/Tarai region of Nepal, see Madhesh. For the former town in Ishikawa Prefecture, Japan, see Terai, Ishikawa.  K, Akiyama M. Survival and growth of enterotoxin-positive and enterotoxin-negative Clostridium perfringens in laboratory media. Int J Food Microbiol. 2002;72:233-8.

(27.) Sandvig K, Olsnes S. Entry of the toxic proteins abrin abrin

toxalbumin in the seeds of Abrus precatorius. Causes purging and paralysis.
, modeccin, ricin ricin /ri·cin/ (ri´sin) a phytotoxin in the seeds of the castor oil plant (Ricinus communis), used in the synthesis of immunotoxins.

ri·cin
n.
, and diphtheria toxin into cells. II. Effect of pH, metabolic inhibitors, and ionophores and evidence for toxin penetration from endocytotic vesicles. J Biol Chem. 1982;257:7504-13.

(28.) Katayama S, Dupuy B, Daube G, China B, Cole ST. Genome mapping of Clostridium perfringens strains with I-ceul shows many virulence genes to be plasmid-borne. Mol Gen Genet genet: see civet. . 1996;251:720-6.

(29.) McClane BA. Clostridium perfringens. In: Doyle MP, Beuchat LR, Montville TJ, editors. Food microbiology: fundamentals and frontiers. Washington: ASM (1) (Association for Systems Management) An international membership organization based in Cleveland, Ohio. Founded in 1947 and disbanded in 1996, it sponsored conferences in all phases of administrative systems and management.  Press; 2001. p. 351-72.

(30.) Li J, McClane BA. Further comparison of temperature effects on growth and survival of Clostridium perfringens type A isolates carrying a chromosomal or plasmid-borne enterotoxin gene. Appl Environ Microbiol. 2006;72:4561-8.

Annamari Heikinheimo, * Miia Lindstrom, * Per Einar Granum, [dagger] and Hannu Korkeala *

* University of Helsinki, Helsinki, Finland; and [dagger] Norwegian School of Veterinary Science Norwegian School of Veterinary Science (Norwegian: Norges Veterinærhøgskole) or NVH is a public university located in Oslo, Norway that educates veterinaries and animal nurses as well as research within aquatic medicine, food , Oslo, Norway

Address for correspondence: Annamari Heikinheimo, P.O. Box 66, FI-00014, University of Helsinki, Helsinki, Finland, email: annamari. heikinheimo@helsinki.fi

Dr Heikinheimo is a PhD student in the Department of Food and Environmental Hygiene, University of Helsinki, Finland. Her research focuses on the molecular epidemiology of cpe+ Clostridium perfringens.
Table 1. Primers and PCR protocols for determining the genotype
and location of cpe *

                                               Sequence ref,
                                     Primer       GenBank
Primer       Sequence (5' to 3')     target    accession no.

CPEmmF      CAAGTCAAATTCTTAATCCT       cpe      (22), Y16009
1151 R      CATGGCCGTCAACCTAAGAAG    IS1151     (23), X60694
CPEmmF      CAAGTCAAATTCTTAATCCT       cpe      (22), Y16009
1470mR      TGAAAACCGTGAAGAATTTGG    IS1470     (12), X71844
cpe4F      TTAGAACAGTCCTTAGGTGATGG     cpe     (14), AF511071
                     AG
IS1470-    CTTTGTGTACACAGCTTCGCCAA   IS1470-   (24), AF416450
likeR1.6            TGTC              like

                             cpe
Primer     Ref    Size      genotype     cpe location

CPEmmF     -12   1.2 kb    IS1151-cpe      Plasmid
1151 R
CPEmmF     -12   2.4 kb   IS 1470-cpe     Chromosome
1470mR
cpe4F      -24   1.6 kb   IS1470-like-     Plasmid
                              cpe
IS1470-
IikeR1.6

* Ref, reference.

Table 2. Association of sex and age with cpe in feces
of healthy humans

                    cpe detected by PCR/
Characteristic   total no. fecal samples (%)

Sex
  Female                19/102 (18.6)
  Male                   6/34 (17.6)
  Total                 25/136 (18.4)
Age, y
  <20                    6/40 (15.0)
  20-50                 16/79 (20.3)
  >50                    3/17 (17.6)
  Total                 25/136 (18.4)

Table 3. Cytotoxicity test on Vero cells to determine the production
of CPE by cpe+ C. perfringens strains obtained from healthy persons

Isolate                                   MRP *            CPE
                                                        ([dagger])

CPI 18-3                                    1               +
CPI 18-2                                    2               NS
CPI 26K-R3p                                 5               +
CPI 39-1b, CPI 39K-7                        6               +
CPI 44K-R3, CPI 44K-R7                     10               NS
CPI 53K-R3                                 11               NS
CPI 57K-1                                  13               +
CPI 57-1                                   15               NS
CPI 63K-R5                                 19               NS
CPI 75-3a, CPI 75-3b, CPI 75-5b            21               -
CPI 75-4                                   22               +
CPI 76K-4, CPI 76K-5                       24               +
CPI 101-4                                  25               +
CPI 103K-3, CPI 103K-5, CPI 103K-6         29               +

Isolate                               cpe genotype     cpe location

CPI 18-3                             IS1470-like-cpe     Plasmid
CPI 18-2                             IS1470-like-cpe     Plasmid
CPI 26K-R3p                            IS1151-cpe        Plasmid
CPI 39-1 b, CPI 39K-7                IS1470-like-cpe     Plasmid
CPI 44K-R3, CPI 44K-R7                 Untypeable       Not known
CPI 53K-R3                             IS1151-cpe        Plasmid
CPI 57K-1                            IS1470-like-cpe     Plasmid
CPI 57-1                             IS1470-like-cpe     Plasmid
CPI 63K-R5                             IS1151-cpe        Plasmid
CPI 75-3a, CPI 75-3b, CPI 75-5b        IS1151-cpe        Plasmid
CPI 75-4                             IS1470-like-cpe     Plasmid
CPI 76K-4, CPI 76K-5                   IS1470-cpe       Chromosome
CPI 101-4                              Untypeable       Not known
CPI 103K-3, CPI 103K-5, CPI 103K-6     IS1151-cpe        Plasmid

* MRP, macro restriction pattern.

([dagger]) +, present; -, absent, NS, not sporulated and thus
cytotoxicity test on Vero cells not performed.
COPYRIGHT 2006 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2006, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:RESEARCH
Author:Korkeala, Hannu
Publication:Emerging Infectious Diseases
Date:Nov 1, 2006
Words:3949
Previous Article:Staphylococcus aureus--associated skin and soft tissue infections in ambulatory care.
Next Article:Clostridium difficile PCR ribotypes in calves, Canada.



Related Articles
Persistence and antibiotic immunity of bacteria from a wetland used as a medical waste landfill.
Foodborne Diseases.
Bacterial Toxins: Friends or Foes?
Waterborne outbreak of Norwalk-like virus gastroenteritis at a tourist resort, Italy. (Research).
Oregano and organic acids impede growth of C. perfringens.
Liver metastasis presenting as pneumoperitoneum.
Community acquired methicillin-resistant Staphylococcus aureus in children, Taiwan.
Clostridium difficile PCR ribotypes in calves, Canada.
Clostridium difficile in retail ground meat, Canada.

Terms of use | Copyright © 2012 Farlex, Inc. | Feedback | For webmasters | Submit articles