Printer Friendly
The Free Library
14,716,498 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Human parainfluenza type 4 infections, Canada.


During the fall/winter season of 2004-05, we found 9 respiratory specimens positive for human parainfluenza virus parainfluenza virus
n.
Any of five types of viruses of the genus Paramyxovirus that are associated with various respiratory infections, especially in children.
 type 4 (HPIV-4) in our laboratory (43% of all HPIVs) from patients with mild to moderate respiratory illnesses. Sequencing studies identified 8 different HPIV-4A strains and 1 HPIV-4B strain.

**********

Human parainfluenza viruses Human parainfluenza viruses (HPIVs) are a group of four distinct serotypes of single-stranded RNA viruses belonging to the paramyxovirus family. They are the second most common cause of lower respiratory tract infection in younger children.  (HPIVs) have been recognized as a cause of respiratory tract infections for many decades. They belong to the Paramyxoviridae family, subfamily subfamily /sub·fam·i·ly/ (sub´fam-i-le) a taxonomic division between a family and a tribe.

sub·fam·i·ly
n.
A taxonomic category ranking between a family and a genus.
 Paramyxovirinae, and are classified into 4 serotypes. Serotype serotype /se·ro·type/ (ser´o-tip) the type of a microorganism determined by its constituent antigens; a taxonomic subdivision based thereon.

se·ro·type
n.
See serovar.

v.
 4 can be further subdivided into 2 antigenic subtypes, HPIV-4A and HPIV-4B (1). Although the epidemiology and clinical manifestations of serotypes HPIV-1 to HPIV-3 are well described, much less is known about HPIV-4, including its seasonality (2).

HPIV-4 has been mostly associated with mild illnesses (3,4). However, some evidence has indicated that it can cause more severe infections in some settings (5-10). We sought to describe the virologic and molecular characteristics as well as the clinical manifestations associated with HPIV-4 infections at our hospital during 2004-05.

The Study

From October 20, 2004, to March 8, 2005, we found 9 respiratory specimens positive for HPIV-4 in our virology virology, study of viruses and their role in disease. Many viruses, such as animal RNA viruses and viruses that infect bacteria, or bacteriophages, have become useful laboratory tools in genetic studies and in work on the cellular metabolic control of gene expression  laboratory. Specimens were collected from patients who were either admitted to a tertiary care hospital, seeking treatment at its emergency room, or attending an outpatient clinic connected to that hospital.

Specimens were placed into 96-well plates seeded with 8 cell lines and onto 2 shell vials (Table 1). Viral cultures were incubated for 21 to 24 days. For LLC-MK2 and MDCK MDCK Madin-Darby Canine Kidney Cells (virus tissue culture)  cells, a hemadsoption test was performed at the end of the incubation period. Cytopathic effects (CPEs) or positive hemadsorption tests were confirmed by using immunofluorescence Immunofluorescence

A technique that uses a fluorochrome to indicate the occurrence of a specific antigen-antibody reaction. The fluorochrome labels either an antigen or an antibody.
 assays performed with monoclonal antibodies against HPIV-4 (Chemicon International, Temecula, CA, USA).

Viral RNA RNA: see nucleic acid.
RNA
 in full ribonucleic acid

One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic
 was extracted from culture supernatants by using the MagaZorb RNA Mini-prep kit (Cortex Biochem, San Leandro, CA, USA) and then tested with RT-PCR RT-PCR

reverse transcriptase-polymerase chain reaction. See PCR1.
 by using the Qiagen one-step RT-PCR kit. Amplicons of the fusion (F; 1631 nt) and hemagglutinin-neuraminidase (HN; 1721 nt) genes were generated by using primers listed in Table 1. Nucleotide sequences of all HPIV-4 strains were determined and entered into a multiple alignment generated by the Clustal W software (version 1.83)(11). Phylogenetic phy·lo·ge·net·ic
adj.
1. Of or relating to phylogeny or phylogenetics.

2. Relating to or based on evolutionary development or history.
 analyses were performed using distance methods with the PAUP PAUP Phylogenetic Analysis Using Parsimony  software (version 4.0b 10; Sinauer Associates, Sunderland, MA, USA).

Positive HPIV-4 samples consisted of 7 nasopharyngeal nasopharyngeal

pertaining to the nasal and pharyngeal cavities.


nasopharyngeal meatus
see nasopharyngeal meatus.

nasopharyngeal spasm
see reverse sneeze.
 aspirates and 2 nasopharyngeal or throat swab specimens. The 9 viruses grew only in LLC-MK2 cells with all but one demonstrating CPEs from 12 to 21 days post-inoculation (mean: 19 days). The CPEs consisted of large and round swollen cells that progressed to destruction of the monolayer mon·o·lay·er
n.
1. A film or layer one molecule thick formed at the interface between water and either oil or air by a substance such as a partially esterified fatty acid that contains both hydrophobic and hydrophilic groups in the same
, without syncytium syncytium /syn·cy·ti·um/ (sin-sish´e-um) a multinucleate mass of protoplasm produced by the merging of cells.

syn·cy·ti·um
n. pl.
 formation. The hemadsorption test result was positive for all isolates with subsequent confirmation by immunofluorescence staining. No other virus grew on the other cell lines. Bacterial cultures were done for 4 patients, and 1 culture was positive for Streptococcus pneumoniae.

Between October 20, 2004, and March 8, 2005, 1,424 respiratory specimens were submitted to our virology laboratory for viral culture. Of these, 371 (26%) were positive for a virus. HPIV-4 was the most frequent HPIV HPIV Holographic Particle Image Velocimetry  with 9 isolates, representing 43% of all HPIVs and 2.4% of all positive cultures. During the same period of 2003-04, we isolated only 1 HPIV-4 (2% of all HPIVs and 0.3% overall). In 2002-03, eleven HPIV-4 were recovered (23% of all HPIVs and 7.0% overall). Finally during the 2001-02 season, we found 3 HPIV-4 (15% of all HPIVs and 0.8% overall) (Figure 1).

[FIGURE 1 OMITTED]

The 9 HPIV-4 positive patients consisted of 6 children (5 <6 months of age) and 3 adults (Table 2). Among the pediatric patients, 3 had bronchiolitis Bronchiolitis Definition

Bronchiolitis is an acute viral infection of the small air passages of the lungs called the bronchioles.
Description

Bronchiolitis is extremely common.
, and the youngest (1.5 months) required a stay in the intensive care unit because of apnea. Two of the 3 patients with bronchiolitis had paroxysmal paroxysmal (per´ksiz´ml),
adj recurring in paroxysms.
 cough, and pertussis pertussis: see whooping cough.  was suspected. The other 3 patients had upper respiratory tract illnesses. Among those 6 patients, 2 received antimicrobial drugs, and all recovered.

Among the 3 adults, 1 was 25 years of age, and 2 were >80 years of age. The former had pharyngitis pharyngitis

Inflammation and infection (usually bacterial or viral) of the pharynx. Symptoms include pain (sore throat, worse on swallowing), redness, swollen lymph nodes, and fever.
 and buccal buc·cal
adj.
1. Of, relating to, adjacent to, or in the direction of the cheek.

2. Of or relating to the mouth cavity.


buccal
 ulcerative ulcerative /ul·cer·a·tive/ (ul´se-ra?tiv) (ul´ser-ah-tiv) pertaining to or characterized by ulceration.

ulcerative

pertaining to or characterized by ulceration.
 lesions. No other viral or bacterial pathogen was found. An 84-year-old woman was admitted to the hospital for severe bronchospasm bronchospasm /bron·cho·spasm/ (brong´ko-spazm) bronchial spasm; spasmodic contraction of the smooth muscle of the bronchi, as in asthma.

bron·cho·spasm
n.
 and suspected pulmonary edema. In addition, a 90-year-old woman had a flulike illness but antigenic test results were negative for influenza. The 3 patients had no complications and survived. Overall, 4 of the 9 patients were hospitalized with a mean length of stay of 8 days (range 2-14 days). Six (66%) of the patients had an underlying disease.

Phylogenetic trees of the F and HN genes were similar. Eight different HPIV-4 isolates clustered with the HPIV4A reference strain, whereas the remaining one clustered with the HPIV-4B reference strain (Figure 2). The percentages of nucleotide (nt)/amino acid (aa) identity for the 8 HPIV-4A strains were 97%/100% (F gene) and 97%/99% (HN gene). In contrast, the percentages of nt/aa identity between the HPIV-4A strains and the HPIV-4B isolate were 89%/92% (F gene) and 86%/87% (HN gene).

[FIGURE 2 OMITTED]

Conclusions

HPIV-4 is considered a rare pathogen because it has been isolated only occasionally from respiratory tract specimens, although seroprevalence seroprevalence Immunology The proportion of a population that is seropositive–ie, has been exposed to a particular pathogen or immunogen; the seropositivity of a population is calculated as the number of individuals who produce a particular antibody divided  studies have shown that 70%-90% of young adults have specific antibodies against it (12,13). Lately, a few reports have shown that HPIV-4 might be more frequent than previously thought when sensitive RT-PCR methods are used (5,8,10,14). Using viral cultures, we found that HPIV-4 accounted for 43% of all HPIVs isolated in our laboratory during the 2004-05 fall and winter seasons. Direct testing of clinical specimens with RT-PCR would have likely resulted in higher detection rates.

Possible explanations for the rarity of HPIV-4 are in part related to its slow growth in LLC-MK2 cells, a cell line not used in most virology laboratories. Also, CPEs are not always present (may take 2-3 weeks to appear), and the hemadsorption reaction is occasionally weak (1). Finally, symptoms associated with HPIV-4 are generally mild and do not elicit requests for a cell culture.

To our knowledge, no seasonality has been described for HPIV-4. In our area, HPIV-4 was isolated every year during the last 4 years with peaks of activity occurring every other year, similar to HPIV-1 and 2 (15). The biennial pattern of HPIV-4 would require confirmation in larger studies from other countries. In temperate countries, the virus is usually recovered during the late fall and winter seasons (2,13,14). In fact, over the last 4 years, only 4 HPIV-4 isolates were recovered outside our study period, 3 in April and 1 in May.

The retrospective aspect of our study and the small number of viral isolates limit definitive conclusions on the clinical manifestations of HPIV-4 infections. We note that young children were preferentially affected as previously reported (2,5-7,14) although they also constitute the most likely population for whom viral cultures would be obtained. In children, clinical conditions included upper respiratory tract infections, bronchiolitis, and pertussis-like clinical syndromes (7). Infected adults had various clinical presentations, i.e., pharyngitis, bronchospasm, and flulike illnesses, although further work is required to describe the full clinical spectrum of HPIV-4 infections.

Our 9 HPIV-4 isolates could be further subdivided into 8 different HPIV-4A and 1 HPIV-4B strains, according to sequences obtained from the 2 glycoproteins F and HN. Reports of HPIV-4B infection have been infrequent in the last 2 decades, similar to our findings (9).

In summary, HPIV-4 infections can be relatively common during the fall and winter seasons of some years and are probably underdiagnosed due to their fastidious fas·tid·i·ous
adj.
1. Possessing or displaying careful, meticulous attention to detail.

2. Difficult to please; exacting.

3. Having complex nutritional requirements. Used of microorganisms.
 growth. Detection of this respiratory pathogen needs to be improved through rapid molecular assays.

This study was supported by grants from the Canadian Institutes of Health Research Canadian Institutes of Health Research (CIHR) is the major federal agency responsible for funding health research in Canada. It is the successor to the Medical Research Council of Canada.  to G.B. and Genome Canada/Genome Quebec to M.G.B.

References

(1.) Canchola J, Vargosko AJ, Kim HW. Antigenic variation among newly isolated strains of parainfluenza parainfluenza Infectious disease A virus that causes URIs–up to 50% of croup and 10–15% of bronchiolitis, bronchitis, pneumonias in toddlers Clinical Rhinorrhea, cold-like Sx Risk factors Preschool children; by school age most children have been exposed  type 4 virus. Am J Hyg. 1964;79:357-4.

(2.) Laurichesse H, Dedman D, Watson JM, Zambon MC. Epidemiological features of parainfluenza virus infections: laboratory surveillance in England and Wales England and Wales are both constituent countries of the United Kingdom, that together share a single legal system: English law. Legislatively, England and Wales are treated as a single unit (see State (law)) for the conflict of laws. . Eur J Epidemiol. 1999;15:475-84.

(3.) Killgore GE, Dowdle WR. Antigenic characterization of parainfluenza 4A and 4B by the hemagglutination-inhibition test and distribution of HI antibody in human sera. Am J Epidemiol. 1970;91:308-16.

(4.) Collins PL, Chanock RM, Mclntosh K. Parainfluenza viruses. In: Fields BN, Knipe DM, Howley PM, editors. Fields virology, 3rd ed. Philadelphia: Lippincott-Raven; 1996. p. 1205-10.

(5.) Lindquist SW, Darnule A, lstas A, Demmler GJ. Parainfluenza virus type 4 infections in pediatric patients. Pediatr Infect Dis J. 1997;16:34-8.

(6.) Slavin KA, Passaro DJ, Hacker JK, Hendry RM, Kohl S. Parainfluenza virus type 4: case report and review of the literature. Pediatr Infect Dis J. 2000;19:893-6.

(7.) Rubin EE, Quennec P, McDonald JC. Infections due to parainfluenza virus type 4 in children. Clin Infect Dis. 1993;17:998-1002.

(8.) Garcia Garcia ML, Aguilar Ruiz J, Echeverria Mayo JE, Calvo Rey C, Pinto Fuentes I, Ordobas Gabin M, et al. [Parainfluenza virus type 4 infections]. An Esp Pediatr. 2002;57:116-20.

(9.) Miall F, Rye A, Fraser M, Hunter A, Snowden JA. Human parainfluenza type 4 infections: a case report highlighting pathogenicity and difficulties in rapid diagnosis in the post-transplant setting. Bone Marrow Transplant bone marrow transplant: see bone marrow. . 2002;29:541-2.

(10.) Aguilar JC, Perez-Brena MP, Garcia ML, Cruz N, Erdman DD, Echevarria JE. Detection and identification of human parainfluenza viruses 1, 2, 3, and 4 in clinical samples of pediatric patients by multiplex reverse transcription-PCR. J Clin Microbiol. 2000;38:1191-5.

(11.) Thompson JD, Higgins DG. Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment A multiple sequence alignment (MSA) is a sequence alignment of three or more biological sequences, generally protein, DNA, or RNA. In general, the input set of query sequences are assumed to have an evolutionary relationship by which they share a lineage and are descended from a  through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994;22:4673-80.

(12.) Gardner SD The isolation of parainfluenza 4 subtypes A and B in England and serological serological

pertaining to or emanating from serology.


serological test
one involving examination of blood serum usually for antibody.
 studies of their prevalence. J Hyg (Lond). 1969;67:545-50.

(13.) Lau SKP SKP Suomen Kommunistinen Puolue (Communist Party of Finland)
SKP Sveriges Kommunistiska Parti (Communist Party of Sweden)
SKP Sisemajanduse Koguproduktist (Estonian) 
, To W, Tse PWT PWT Posterior Wall Thickness (cardiology)
PWT Plain White T's (band)
PWT Pennyweight
PWT Personal Wireless Telecommunications
PWT Poor White Trash
PWT Bremerton, WA, USA - Municipal
, Chan AKH, Woo PCY PCY Per Calendar Year
PCY Powel Crosley, Jr. YMCA (Cincinnati, Ohio)
PCY Pounds per Cubic Yard
PCY Paradise Canyon Elementary School (La Canada, CA)
PCY Pittsburgh, Chartiers, & Youghiogheny Railway Company
, Tsoi H, et al. Human parainfluenza virus 4 outbreak and the role of diagnostic tests. J Clin Microbiol. 2005;43:4515-2l.

(14.) Billaud G. Morfin F, Vabret A, Boucher A, Gillet Y, Crassard N, et al. Human parainfluenza virus type 4 infections: a report of 20 cases from 1998 to 2002. J Clin Virol. 2005;34:48-51.

(15.) Hall CB. Respiratory syncytial virus respiratory syncytial virus (sĭnsĭsh`əl): see cold, common.  and parainfluenza virus. N Engl J Med. 2001;344:1917-28.

Address for correspondence: Guy Boivin, CHUQ-CHUL, Room RC-709, 2705 Bird Laurier, Sainte-Foy, Quebec, Canada, G1V 4G2; email: Guy.Boivin@crchul.ulaval.ca

Marie-Louise Vachon,* ([dagger]) Natasha Dionne,* ([dagger]) Eric Leblanc,* ([dagger]) Danielle Moisan, ([double dagger]) Michel G. Bergeron, * ([dagger]) and Guy Boivin * ([dagger])

* Research Center in Infectious Diseases of the Centre Hospitalier Universitaire de Quebec, Quebec City, Quebec, Canada; ([dagger])Laval University, Quebec City, Quebec, Canada; and ([double dagger]) Centre Hospitalier Regional du Grand-Portage, Riviere-du-Loup, Quebec, Canada

Dr Vachon is a resident in the program of microbiology and infectious diseases at Laval University, Quebec City, Canada. Her main research interest concerns the epidemiology and clinical manifestations of paramyxovirus Paramyxovirus

A subgroup of myxoviruses that includes the viruses of mumps, measles, parainfluenza, respiratory syncytial (RS) disease, and Newcastle disease.
 infections.
Table 1. Cell lines used for viral culture and primers used for HPIV-4
PCR testing

                                             Oligonucleotide
Cell lines                                  sequences (5'-3')

Mink lung                                 ATGGGTGTCAAAGGTTTATC
Human foreskin fibroblast                       (forward)
Human lung carcinoma (A-549)
Vero                                     AATTATGCAGATTGTAACTGTC
Hep-2                                           (reverse)
Human rhabdomyosarcoma (RD)               ATGGTGAAAAGAACATGGAG
Transformed human kidney 293                    (forward)
Human colon adenocarcinoma (HT-29)        TGGAGTATCCAGCAGTAAGA
Madin-Darby canine kidney (MDCK)                (reverse)
Tertiary monkey kidney (LLC-MK2)

Cell lines                                    Target genes

Mink lung                                        Fusion
Human foreskin fibroblast
Human lung carcinoma (A-549)
Vero
Hep-2
Human rhabdomyosarcoma (RD)            Hemagglutinin-neuraminidase
Transformed human kidney 293
Human colon adenocarcinoma (HT-29)
Madin-Darby canine kidney (MDCK)
Tertiary monkey kidney (LLC-MK2)

Table 2. Clinical data of 9 patients with HPIV-4 infections in
Quebec City, Canada

              Sample type
Patient   (date of collection)           Age/sex

1           NPA (2004 Dec 5)             1.5 mo/M

2          NPA (2004 Oct 20)             2.5 mo/M

3           NPA (2004 Nov 2)              3 mo/M
4           NPA (2005 Jan 4)              5 mo/M
5          NPA (2005 Jan 19)              6 mo/F

6          NPA (2004 Nov 18)             2.7 y/F

7           TS (2005 Mar 8)               25 y/M

8          NPA (2005 Jan 25)              84 y/F

9          NPS (2005 Jan 21)              90 y/F

Patient    Underlying Illness       Symptoms and signs

1                  --            Cough, apnea, fever, low
                                      [O.sub.2] sat.
2          Premature (32 wk),       Cough, apnea, low
                POF, PPS              [O.sub.2] sat.
3                  --               Cough, apnea, BOM
4          Premature (33 wk)           Cough, fever
5          Premature (26 wk),      Rhinorrhea, wheezing
                   PD
6                Asthma             Rhinorrhea, cough,
                                         wheezing
7                  --              Fever, right tonsil
                                    ulcerative lesions
8              CHD, COPD          Dyspnea, low [O.sub.2]
                                      sat., cyanosis

9             AF, dementia         Fever, muscle aches

               Hospital-
Patient       ization (d)            Final diagnosis

1             Yes, ICU (3)            Bronchiolitis

2               Yes (14)              Bronchiolitis

3               Yes (2)                URTI and BOM
4                  No                      URTI
5                  No                 Bronchiolitis

6                  No                 Sinusitis and
                                       bronchospasm
7                  No               Viral pharyngitis

8               Yes (14)               PE, MI, and
                                        persisting
                                       bronchospasm
9                  No                Flulike syndrome

* HPIV-4, human parainfluenza virus type 4; NPA, nasopharyngeal
aspirate; [O.sub.2] sat., oxygen saturation; ICU, intensive care unit;
POF, permeable oval foramen; PPS, peripheral pulmonary stenosis; BOM,
bilateral otitis media; URTI, upper respiratory tract infection; PD,
pulmonary dysplasia; TS, throat swab; CHID, coronary heart disease;
COPD, chronic obstructive pulmonary disease; PE, pulmonary edema; MI,
myocardial infarction; NIPS, nasopharyngeal swab; AF, atrial
fibrillation.
COPYRIGHT 2006 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2006, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:DISPATCHES
Author:Boivin, Guy
Publication:Emerging Infectious Diseases
Geographic Code:1CANA
Date:Nov 1, 2006
Words:2225
Previous Article:Genotype III Saint Louis Encephalitis virus outbreak, Argentina, 2005.(DISPATCHES)
Next Article:Methicillin-resistant staphylococcus aureus at canoe camp.(DISPATCHES)



Related Articles
Uncovering the Viral Mechanics of Croup.
Respiratory tract reinfections by the new human metapneumovirus in an immunocompromised child. (Dispatches).
Human metapneumovirus and community-acquired respiratory illness in children. (Letters).
Respiratory picornaviruses and respiratory syncytial virus as causative agents of acute expiratory wheezing in children.(Research)
SARS and common viral infections.(Dispatches)
Managing febrile respiratory illnesses during a hypothetical SARS outbreak.(Perspective)(severe acute respiratory syndrome)
Human bocavirus in French children.(DISPATCHES)
Human metapneumovirus, Australia, 2001-2004.(DISPATCHES)
ICD-9 codes for identifying influenza hospitalizations in children.(Letter to the editor)
Human bocavirus, a respiratory and enteric virus.(DISPATCHES)

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles