Printer Friendly
The Free Library
4,488,600 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Human infection with Rickettsia honei, Thailand.


Human spotted fever rickettsiosis was detected molecularly by 2 real-time polymerase chain reaction (PCR) assays performed on DNA extracted from a Thai patient's serum sample. Sequences of PCR amplicons from 5 rickettsial genes used for multilocus sequence typing were 100% identical with those deposited with GenBank for Rickettsia honei TT-118.

**********

The original Thai tick typhus isolate, TT-118, was obtained from a mixed pool of Ixodes Ixodes /Ix·o·des/ (iks-o´dez) a genus of parasitic ticks (family Ixodidae Ixodidae /Ix·od·i·dae/ (iks-od´i-de) a family of ticks (superfamily Ixodoidea), comprising the hard-bodied ticks.

Ix·od·i·dae (k-s
); some species are disease vectors.

Ix·o·des (k-s
 sp. and Rhipicephalus sp. larval ticks from Rattus rattus trapped in Chiangmai Province, Thailand, in 1962 (1) and has recently been determined to be a strain of Rickettsia honei, the etiologic agent of Flinders Island Flinders Island, Australia: see Furneaux Group. spotted fever (2). No isolate has been associated with Thai tick typhus in humans, and TT-118 was found only to be moderately pathogenic for guinea pigs and gerbils gerbil (jûr`bĭl), small desert rodent found throughout the hot arid regions of Africa and Asia. Also known as sand rats, gerbils have large eyes and powerful, elongated hind limbs upon which they can spring. Gerbils are 3 to 5 in. (7.6–12. (1). However, evidence of spotted fever rickettsiosis has been seen in Thailand; this evidence comes from 2 reports of a total of 11 cases, 3 cases from Chiangmai and 8 cases from the Thailand-Burma border. All 11 patients had signs and symptoms characteristic of spotted fever rickettsiosis, and their sera were reactive to spotted fever group (SFG) rickettsial antigens, including those derived from TT-118 (3,4). Additional proof of the presence of spotted fever rickettsiae in Thailand derives from rodent (5) and human (6,7) serosurveys. In addition, spotted fever agents have been demonstrated in Thai ticks by using molecular biology techniques to detect rickettsiae (8-10). Collectively, these reports indicate that SFG rickettsiae and rickettsioses exist within Thailand. However, at the time of this writing, detection of an SFG rickettsia from a human source had not been reported in Thailand.

The Study

We describe the first detection of R. honei TT-118 or a very similar strain from a 36-year-old male freelance photographer living in Bangkok, Thailand, who complained of a febrile illness and was admitted to a nearby hospital on December 21, 2002 (V. Sangkasuwan et al., unpub, data). Blood was collected and submitted to the Armed Forces Research Institute of Medical Sciences, Thailand, where the serum was determined to be positive for antibodies to spotted fever rickettsiae. A portion of this serum sample, without identifiers, was subsequently sent to the Naval Medical Research Center for confirmatory serologic and molecular diagnosis. To confirm the original serologic report, the patient's serum was tested for spotted fever, typhus, and scrub typhus group-specific immunoglobulin (Ig) G by enzyme-linked immunosorbent assay using R. rickettsii R (ATCC VR891), R. typhi Wilmington whole cell antigen, and KpKtGm r56 recombinant antigen, as previously described (11,12). The patient's serum was confirmed to have IgG to SFG rickettsiae (titer >1:6,400) but not to have antibodies to Orientia tsutsugamushi or R. typhi.

To ascertain whether the patient's serum contained molecular evidence of SFG rickettsia, DNA was extracted from 150 [micro]L of the patient's serum (DNeasy Tissue Kit, Qiagen, Valencia, CA, USA). Three micrograms Poly(dA) (Sigma Chemical Co., St. Louis, MO, USA) was added as a DNA carrier. Two real-time polymerase chain reaction (PCR) assays were performed to determine if rickettsial nucleic acid was detectable in the patient's serum sample: 1) the Rickettsia genus-specific real-time PCR assay amplified and detected a 115-bp segment of the 17-kDa antigen gene and 2) the rickettsial SFG-specific real-time PCR amplified and detected a 128-bp segment of the ompB with a SmartCycler (Cepheid, Sunnyvale, CA, USA), as previously described (13). Both assays demonstrated the presence of the target sequences in the serum sample with Ct values of 36.22 and 36.87, respectively.

To identify which SFG rickettsia was responsible for the patient's febrile illness, segments of 5 rickettsial genes were amplified by PCR, and the amplicons produced were sequenced and compared to reported sequences of other SFG rickettsiae. New oligonucleotide primers were selected from the conserved regions of ompB, ompA, and sca4 after alignment of at least 19 rickettsial sequences: RompB11F (ACCATAGTAGCMAGTTTTGCAG), Rak1452R (SGTTAACTTKACCGYTTATAACTGT), RhoA1F (GAATAACATTACAAGCTGGAGGAA), RR657R (TATTTGCATCAATCSYATAAGWA), RhoA4336F (AGTTCAGG AACGACCGTA), RrD749F (TGGTAGCATTAAAAGCTGATGG), RrD2685R (TTCAGTAGAAGATTTAGTACCAAAT), RrD 1826R (TCTAAATKCTGCTGMATCAAT), and RrD1275R (TGTTAAACCTGYATTTACATAAT). All other primers used have been previously described (2,14,15).

To produce the amplicons used for sequencing, 2 [micro]L or 4 [micro]L of the sample DNA preparation was added to either a 25- or 50-[micro]L reaction mixture, respectively, containing 0.5 [micro]mol/L (for ompA and ompB), or 0.3 [micro]mol/L (for 17-kDa gene, gltA and sca4) of forward and reverse primers, and PCR SuperMix High Fidelity (Invitrogen, Carlsbad, CA, USA). Two microliters of PCR products was used as template in the nested PCRs. Each PCR was performed on a TGradient Thermocycler (Whatman Biometra, Gottingen, Germany) and incubated at 94[degrees]C for 1 min followed by 40 cycles of denaturation denaturation /de·na·tur·a·tion/ (de-na?cher-a´shun) destruction of the usual nature of a substance, as by the addition of methanol or acetone to alcohol to render it unfit for drinking, or the change in the physical properties of a substance, as a protein or nucleic acid, caused by heat or certain chemicals that alter tertiary structure. at 94[degrees]C for 30 s; annealing at 48[degrees]C (gltA), 50[degrees]C (ompA and ompB), 52[degrees]C (sca4), or 58[degrees]C (17-kDa gene) for 1 min; and elongation at 70[degrees]C for 7 min. After the amplification steps were completed, the reaction mixtures were exposed to a final elongation step at 72[degrees]C for 7 min, and PCR products were visualized with ethidium bromide (GIBCO GIBCO - Grand Island Biological Company (tissue culture media enterprise) BRL Life Technologies, Inc., Gaithersburg, MD, USA) on 1.5% agarose gels after electrophoresis. Each mastermix for PCR was prepared in a clean room separated from where the DNA templates were added; no research with R. honei TT-118 had been conducted in our laboratory. A positive control DNA (R. parkeri genomic DNA) and a negative control (molecular biology grade water, GIBCO) were run at the same time under the same condition as the sample. The negative control consistently produced no detectable product. A 1,328-bp PCR product of ompB from the positive control DNA was sequenced and showed 100% identity with the published R. parkeri ompB sequence. The sample PCR products from the 17-kDa gene and the nested PCR products of gltA, ompA, ompB, and sca4 were purified by using a QIAquick PCR purification kit (Qiagen). The BigDye Terminator v 3.0 Ready Reaction Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) was used in subsequent sequencing reactions, according to manufacturer's instructions. Sequencing products were purified by using Performa Gel Filtration Cartridges (EdgeBioSystems, Gaithersburg, MD, USA), and sequencing was performed on an ABI Prism 3100 Genetic Analyzer (Applied Biosystems). The primers used for PCR amplification were the same as those used for the sequencing reactions. At least 2 sequencing reactions were performed for each strand of DNA. Sequences were assembled with Sequencher 4.0 (Gene Codes Corporation Inc., Ann Arbor MI, USA), and basic local alignment search tool (BLAST) searches were managed on the NCBI NCBI - National Center for Biotechnology Information (NIH)
NCBI - National Coalition Building Institute
NCBI - National Crimes Bureau of India
NCBI - Norwegian Confederation of Business and Industry
 Web site (http://www.ncbi.nlm.nih.gov/blast/).

A 434-bp fragment from the 17-kD antigen gene was amplified by standard PCR, and the sequence between bases 67 and 458 of the open reading frame (ORF) was determined to be 100% identical with the published sequences of R. honei strain TT-118 and R. honei strain RB, and 99.7% identical with R. honei strain "south Texas A. [Amblyomma] cajennense SFG rickettsia." Two PCR fragments were produced for gltA by nested PCR that included bp 82 to 1178 of the ORF. A 1,069-bp sequence was obtained after assembling the sequences of the 2 fragments. BLAST search showed this sequence to be 100% identical with that of R. honei TT-118 and 99.9% with R. honei strain RB. A 741-bp ompB fragment was amplified by nested PCR. Sequence of this fragment was found to have 100% identity with R. honei TT- 118 and 99.8% with R. honei RB. The 1,403-bp ompA amplicon sequence had 100% identity with R. honei TT-118 and R. honei RB ompA published sequences. The 1,090-bp sequence determined for sca4 was 100% identical with that published for R. honei TT-118.

Conclusions

Molecular detection of R. honei TT-118 in a clinical specimen from a patient suspected of having spotted fever rickettsiosis was achieved after clinical diagnosis and serologic analysis. To determine the identity of SFG agent, standard PCR and nested PCR procedures were conducted to produce amplicons from 5 rickettsial genes for multilocus sequence typing (MLST MLST - Medical Logistics Support Team
MLST - Multi Locus Sequence Typing
) (10,15). The 17-kDa antigen gene, a highly conserved gene among members of the genus Rickettsia, was used to confirm the relationship of the unknown agent to known rickettsiae. Similarly, DNA encoding gltA was used to ascertain the relationship of the unknown agent to other agents within the genus Rickettsia. The sequences of the other 3 gene segments (ompB, ompA, and sca4) used in the MLST scheme are much more variable among the rickettsiae and, therefore, they provided more information regarding the identity of the unknown agent.

BLAST searches against the determined sequences of segments amplified from the 17-kDa antigen, citrate synthase, OmpB, OmpA, and Sca4 genes of the unknown agent showed 100% identity with those sequences deposited within GenBank for R. honei TT-118. The closest other neighbors to the unknown agent included R. honei RB (the type strain of R. honei) and R. honei "south Texas A. cajennense SFG rickettsia." Thus, the patient at the time of his illness was infected with R. honei TT-118 or a very similar strain of SFG rickettsiae.

The work reported herein was supported by the Department of Defense Global Emerging Infections System program (work unit number 0000188M.0931.001.A0074).

Dr. Jiang has been developing and performing immunologic and molecular biologic assays in the Rickettsial Diseases Department of the Naval Medical Research Center, Silver Spring, Maryland, for >5 years. Her research interests include rickettsial epidemiology, study of the host immune response to rickettsial infection, and rapid diagnostic assay and vaccine development.

References

(1.) Robertson RG, Wisseman CL Jr. Tick-borne rickettsiae of the spotted fever group in West Pakistan. II. Serological classification of isolates from West Pakistan and Thailand: evidence for two new species. Am J Epidemiol. 1973;97:55-64.

(2.) Stenos J, Roux V, Walker D, Raoult D. Rickettsia honei sp. nov., the etiological agent of Flinders Island spotted fever in Australia. Int J Syst Bacteriol. 1998;48:1399-404.

(3.) Sirisanthana T, Pinyopompanit V, Sirisanthana V, Strickman D, Kelly D J, Dasch GA. First cases of spotted fever group rickettsiosis in Thailand. Am J Trop Med Hyg. 1994;50:682-6.

(4.) Parola P, Miller RS, McDaniel P, Telford SR, Rolain J-M, Wongsrichanalai C, et al. Emerging rickettsioses of the Thai-Myanmar border. Emerg Infect Dis. 2003;9:592-5.

(5.) Okabayashi T, Tsutiya K, Muramatsu Y, Ueno H, Morita C. Serological survey of spotted fever group rickettsia in wild rats in Thailand in the 1970s. Microbiol Immunol. 1996;40:895-8.

(6.) Takada N, Fujita H, Yano Y, Huang W-H, Khamboonruang C. Serosurveys of spotted fever and murine typhus in local residents of Taiwan and Thailand compared with Japan. Southeast Asian J Trop Med Public Health. 1993;24:354-6.

(7.) Strickman D, Tanskul P, Eamsila C, Kelly DJ. Prevalence of antibodies to rickettsiae in the human population of suburban Bangkok. Am J Trop Med Hyg. 1994;51:149-53.

(8.) Kollars TM Jr, Tippayachai B, Bodhidatta D. Short report: Thai tick typhus, Rickettsia honei, and a unique rickettsia detected in Ixodes granulatus (Ixodidae: Acari) from Thailand. Am J Trop Med Hyg. 2001;65:535-7.

(9.) Hirunkanokpun S, Kittayapong P, Cornet J-P, Gonzalez J-P. Molecular evidence for novel tick-associated spotted fever group rickettsiae from Thailand. J Med Entomol. 2003;40:230-7.

(10.) Parola P, Cornet J-P, Sanogo YO, Miller RS, Thien HV, Gonzalez JP, et al. Detection of Ehrlichia Ehrlichia /Ehr·lich·ia/ (ar-lik´e-ah) a genus of the tribe Ehrlichieae transmitted by ticks and causing disease in dogs, cattle, sheep, horses, and humans, including the species E. ca´nis, E. chaffeen´sis, E. e´qui, and E. sennet´su.

Ehr·lich·i·a 
 spp., Rickettsia spp., and other eubacteria in ticks from the Thai-Myanmar border and Vietnam. J Clin Microbiol. 2003 ;41:1600-8.

(11.) Jiang J, Marienau KJ, May LA, Beecham HJ, Wilkinson R, Ching WM, et al. Laboratory diagnosis of two scrub typhus outbreaks at Camp Fuji, Japan in 2000 and 2001 by enzyme-linked immunosorbent assay, rapid flow assay, and Western blot assay using outer membrane 56 kDa recombinant proteins. Am J Trop Med Hyg. 2003;69:60-6.

(12.) Richards AL, Soeatmandji DW, Widodo MA, Sardjono TW, Yanuwiadi B, Hernowati TE, et al. Seroepidemiological evidence for murine and scrub typhus in Malang, Indonesia. Am J Trop Med Hyg. 1997;57:91-5.

(13.) Blair PJ, Jiang J, Schoeler GB, Moron C, Anaya E, Cespedes M, et al. Characterization of spotted fever group rickettsiae in flea and tick specimens from northern Peru. J Clin Microbiol. 2004;42:4961-7.

(14.) Webb L, Carl M, Malloy DC, Dasch GA, Azad AF. Detection of murine typhus infection in fleas by using the polymerase chain reaction. J Clin Microbiol. 1990;28:530-4.

(15.) Fournier P-E, Dumler JS, Greub G, Zhang J, Wu Y, Raoult D. Gene sequence-based criteria for identification of new Rickettsia isolates and description of Rickettsia heilongjiangensis sp. nov. J Clin Microbiol. 2003;41:5456-65.

Ju Jiang, * Vichai Sangkasuwan, ([dagger]) Kriangkrai Lerdthusnee, ([double dagger]) Suchitra Sukwit, ([dagger]) Thippawan Chuenchitra, ([dagger]) Patrick J. Rozmajzl, * Chirapa Eamsila, ([dagger]) James W. Jones, ([double dagger]) and Allen L. Richards *

* Naval Medical Research Center, Silver Spring, Maryland, USA; ([dagger]) Armed Forces Research Institute of Medical Sciences, Royal Thai Army, Bangkok, Thailand; and ([double dagger]) US Army Component, Armed Forces Research Institute of Medical Sciences, Bangkok, Thailand

Address for correspondence: Allen L. Richards, Rickettsial Diseases Department, Naval Medical Research Center, 503 Robert Grant Ave, Silver Spring, MD 20910-7500 USA; fax: 301-319-7460; email: RichardsA@nmrc.navy.mil
COPYRIGHT 2005 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2005, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:DISPATCHES
Author:Richards, Allen L.
Publication:Emerging Infectious Diseases
Geographic Code:9THAI
Date:Sep 1, 2005
Words:2202
Previous Article:Characterizing vancomycin-resistant enterococci in neonatal intensive care.(DISPATCHES)
Next Article:Streptococcus pneumoniae and Haemophilus influenzae type b Carriage, Central Asia.(DISPATCHES)
Topics:



Related Articles
A Flea-Associated Rickettsia Pathogenic for Humans.
Geographic association of Rickettsia felis-infected opossums with human murine typhus, Texas. (Research).
Rickettsia mongolotimonae infection in South Africa.(Dispatches)
Rickettsia felis, Bartonella henselae, and B. clarridgeiae, New Zealand.(Letters)
Spotted-fever group Rickettsia in Dermacentor variabilis, Maryland.(Dispatches)
Rickettsia parkeri in Amblyomma triste from Uruguay.(Dispatches)
Rickettsia massiliae human isolation.(LETTERS)
Rickettsia prowazekii and real-time polymerase chain reaction.(RESEARCH)
Rickettsia felis in fleas, Western Australia.
Rickettsia sibirica isolation from a patient and detection in ticks, Portugal.(RESEARCH)

Terms of use | Copyright © 2008 Farlex, Inc. | Feedback | For webmasters | Submit articles