Heterogeneity among mycobacterium ulcerans isolates from Africa.Mycobacterium ulcerans Mycobacterium ulcerans (M. Ulcerans) is a slow-growing mycobacterium that classically infects the skin and subcutaneous tissues, giving rise to indolent nonulcerated (nodules, plaques) and ulcerated lesions. causes Buruli ulcer The Buruli ulcer (also known as the Bairnsdale ulcer) is an infectious disease caused by Mycobacterium ulcerans, from the same family of bacteria which causes tuberculosis and leprosy. , an ulcerative ulcerative /ul·cer·a·tive/ (ul´se-ra?tiv) (ul´ser-ah-tiv) pertaining to or characterized by ulceration. ulcerative pertaining to or characterized by ulceration. skin disease in tropical and subtropical sub·trop·i·cal adj. Of, relating to, or being the geographic areas adjacent to the Tropics. subtropical Adjective of the region lying between the tropics and temperate lands areas. Despite restricted genetic diversity, mycobacterial mycobacterial emanating from or pertaining to mycobacterium. mycobacterial granuloma may be caused by Mycobacterium tuberculosis (see cutaneous tuberculosis), M. interspersed repetitive unit-variable-number tandem repeat This is a term from genetics, which describes a pattern that helps determine an individual's inherited traits. Tandem repeats and variable number tandem repeats in DNA occur when a pattern of two or more nucleotides is repeated and the repetitions are directly adjacent to analysis on M. ulcerans revealed 3 genotypes from different African countries. It is the first time this typing method succeeded directly on patient samples. ********** Buruli ulcer (BU), the third most common mycobacterial disease after tuberculosis and leprosy leprosy or Hansen's disease (hăn`sənz), chronic, mildly infectious malady capable of producing, when untreated, various deformities and disfigurements. , is a major health problem in several West and Central African Central African may mean:
Mode(s) of transmission, natural reservoir Natural reservoir or nidus, refers to the long-term host of the pathogen of an infectious disease. It is often the case that hosts do not get the disease carried by the pathogen or it is asymptomatic and non-lethal. (s) and other key aspects of the epidemiology of BU are not fully understood, a situation partly complicated by an apparent lack of genetic diversity of Mycobacterium ulcerans, as shown by several independent genetic markers (3-6). Conventional and molecular data suggest that M. ulcerans is an environmental pathogen because of the selective association of BU-endemic foci with wetlands and overflowed fiver banks and the detection of M. ulcerans-specific sequences in water, mud, aquatic insects, and plants (7-9). Specific reservoirs of the etiologic agent cannot be definitively assigned; however, we have cultivated M. ulcerans from a single aquatic insect from Benin (10). Extensive molecular typing of M. ulcerans isolates recovered from patients in many endemic foci has been undertaken to further the understanding of the epidemiology of BU. A set of robust genotyping methods has already been applied to M. ulcerans: IS2404 restriction fragment length polymorphism restriction fragment length polymorphism n. Abbr. RFLP Intraspecies variations in the length of DNA fragments generated by the action of restriction enzymes and caused by mutations that alter the sites at which these enzymes act, changing (11), amplified fragment length polymorphism Amplified fragment length polymorphism PCR, or "AFLP-PCR" (often AFLP), is a tool used in the study of genetics and in the practice of genetic engineering. Amplified Fragment Length Polymorphism (AFLP analysis (AFLP) (12), multilocus sequence typing Multilocus sequence typing (MLST) is a technique in molecular biology for the typing of multiple loci. The procedure characterizes isolates of bacterial species using the DNA sequences of internal fragments of multiple (usually seven) housekeeping genes. (13), variable-number tandem repeat (VNTR VNTR Variable Number of Tandem Repeat(s) ) (3), mycobacterial interspersed repetitive unit (MIRU MIRU Move In Rig Up MIRU Magnetohydrodynamic Inertial Reference Unit MIRU Mycobacterium Interspersed Repetitive Units )-VNTR (6), IS2426 polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is (PCR PCR polymerase chain reaction. PCR abbr. polymerase chain reaction Polymerase chain reaction (PCR) ) (5), and IS2404-Mtb2 PCR (4). All methods, except AFLP, resulted in geographically related genotypes for China, Japan, Mexico, Suriname, French Guiana, Malaysia, Papua New Guinea Papua New Guinea (păp`  ə, –y II and Papua New Guinea III,
Australia Victoria, Australia Queensland, and Africa. Current typing
methods have established a striking geographic and temporal homogeneity
in African isolates from Angola, Benin, Democratic Republic of Congo
(DRC DRC Democratic Republic of CongoDRC Down (Stage) Right Center DRC Director(ate) of Reserve Components DRC Disability Rights Commission (United Kingdom) ), Ghana, Cote d'Ivoire, and Togo (3-6). Even M. ulcerans cultured from the insect collected in Benin showed an identical African genotype (6). Recently, however, Hilty et al., using a VNTR typing method and sequence analysis, described 3 genotypes in Ghana (14). The development of more discriminating typing methods may unravel the source and mode of transmission of M. ulcerans and other epidemiologic aspects of BU. Improved understanding of the molecular biology molecular biology, scientific study of the molecular basis of life processes, including cellular respiration, excretion, and reproduction. The term molecular biology was coined in 1938 by Warren Weaver, then director of the natural sciences program at the Rockefeller of M. ulcerans will likely help elucidate observed differences in clinical manifestations. Reported disease recurrence rates vary from 6% to >20% (15). To what degree this recurrence is attributable to exogenous reinfection reinfection /re·in·fec·tion/ (-in-fek´shun) a second infection by the same agent or a second infection of an organ with a different agent. re·in·fec·tion n. or dissemination of the pathogen from previous lesions is unknown. The relative contribution of variations in pathogen and host factors to progression and severity of disease likewise remains obscure. We report the first evidence of genetic diversity in M. ulcerans samples from 3 African countries: DRC, Sudan, and Uganda. Previously, we identified tandem repeat loci loci [L.] plural of locus. loci Plural of locus, see there , MIRUs (6), and VNTRs (3) in the genome of M. ulcerans. A selection of these MIRUs and VNTRs were used in this study to analyze M. ulcerans extracts from tissue specimens from Benin, Togo, Gabon, Uganda, and Sudan, and from previous isolates from patients from Cameroon, DRC, Uganda, and Congo-Brazzaville (Table 1). Results were compared with those of a geographically diverse collection (n = 39) that were typed in our previous study (6). The Study To investigate the MIRU polymorphism polymorphism, of minerals, property of crystallizing in two or more distinct forms. Calcium carbonate is dimorphous (two forms), crystallizing as calcite or aragonite. Titanium dioxide is trimorphous; its three forms are brookite, anatase (or octahedrite), and rutile. , whole genomic DNA was prepared from bacterial cultures or clinical specimens. The specimens were tissue fragments from patients with nonulcerated (plaques and edematous e·dem·a·tous adj. Marked by edema. forms) or ulcerated Ulcerated Damaged so that the surface tissue is lost and/or necrotic (dead). Mentioned in: Adenoid Hyperplasia forms. DNA extraction from pure cultures was performed by heating the colonies in Tris-EDTA at 95[degrees]C for 10 minutes. Clinical specimens from laboratory confirmed cases of BU were decontaminated by using the reversed Petroff method, and mycobacterial DNA DNA: see nucleic acid. DNA or deoxyribonucleic acid One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes. was extracted from the decontaminated solution as previously described (6). Smears of the suspensions were stained by the Ziehl-Neelsen method. PCR was run as previously described (6). The Agilent 2100 Bioanalyzer system (Agilent Technologies, Waldbronn, Germany) was used to separate 1 [micro]L of PCR product electrophoretically. Comparison of MIRU-VNTR copy numbers using 4 loci showed 11 different profiles. M. ulcerans isolates from DRC and Uganda and tissue extracts from patients from Sudan (Nzara) and Uganda (Nakasongola) showed distinct profiles (Central Africa: 1222 and East Africa: 4111), different from the originally homogeneous African genotype (Atlantic Africa: 3113; Table 1). In DRC, 3 different genotypes exist, corresponding to 3 different provinces: Bas-Congo, Maniema (Kasongo), and Orientale (Bunia). The isolate from Orientale was from near the Ugandan border (Lake Albert). Isolates from Gabon, Congo-Brazzaville, and Cameroon had the typical African genotype, now designated the Atlantic African genotype. Identical MIRU-VNTR profiles were observed by using DNA extracted from tissues or cultures from patients residing in the same area. The specificity of the MIRU-VNTR method was tested on 14 different Mycobacterium mycobacterium Any of the rod-shaped bacteria that make up the genus Mycobacterium. The two most important species cause tuberculosis and leprosy in humans; another species causes tuberculosis in both cattle and humans. spp. Only M. marinum, M. shottsii, and M. liflandii tested positive, but they were distinguished from M. ulcerans by exhibiting different profiles (data not shown). Sequencing of the concerned loci showed the conserved MIRU sequence at locus 1 and 9 in M. ulcerans. Locus 6 (3) and locus 33 contain respectively a 56-bp and a 58-bp tandem repeat (Table 2). Conclusions Although M. ulcerans isolates from Africa are relatively homogeneous, this study demonstrates more heterogeneity between strains than previously reported. All isolates from West Africa (Cote d'Ivoire, Ghana, Togo, Benin) and Central Africa (Cameroon; Gabon; Congo-Brazzaville; DRC Bas-Congo; Angola) have the identical MIRU-VNTR profile, and all originate from regions (i.e., Bas-Congo) or countries that border the Atlantic Ocean. The isolates that come from regions or countries in the Nile River basin (i.e., Orientale in DRC, Sudan, and Uganda) or the Congo River basin (i.e., Maniema) have distinct profiles. These results demonstrate for the first time heterogeneity among M. ulcerans from different African countries. The 3 African profiles are the Atlantic African profile, the Central African Congo River basin profile, and the East African Nile River basin profile. This is also the first detection of MIRUs and VNTRs in clinical specimens, even in smear-negative specimens. These data show that MIRUs and VNTRs are helpful tools in genotyping M. ulcerans. Further detailed differentiation of this etiologic agent will lead to an understanding of the epidemiology of BU. As in tuberculosis, better discriminatory typing methods help assess the efficacy of antimycobacterial treatment of BU patients by differentiating reactivation reactivation to become active after a period of quiescence or, as in bacterial and viral infections, latency. cross reactivation from reinfection. Although M. ulcerans appears to be quite monomorphic monomorphic /mono·mor·phic/ (-mor´fik) existing in only one form; maintaining the same form throughout all developmental stages. mon·o·mor·phic or mon·o·mor·phous adj. 1. , full sequencing of this organism will permit detection of genes specific for M. ulcerans, and more discriminatory VNTR should become available. Acknowledgments We thank J. Noeske for providing M. ulcerans isolates from Cameroon and K. Fissette and E. Keijmel for maintaining cultures. This work was partly supported by the Directorate-General for the Development Cooperation (Brussels, Belgium) Project: Lutte contre la tuberculose et l'ulcere de Buruli au Benin); by the Damien Foundation (Brussels, Belgium), and by the European Commission, project no. INCO-CT-2005-051476-BURULICO "Buruli ulcer: multidisciplinary research for improvement of control in Africa." Mr Stragier is a doctoral student at the Mycobacteriology Unit, Institute of Tropical Medicine tropical medicine, study, diagnosis, treatment, and prevention of certain diseases prevalent in the tropics. The warmth and humidity of the tropics and the often unsanitary conditions under which so many people in those areas live contribute to the development and in Antwerp, Belgium. His research focuses on molecular microbiology and epidemiologic and environmental aspects of M ulcerans. He is currently engaged in the Burulico project of the European Union European Union (EU), name given since the ratification (Nov., 1993) of the Treaty of European Union, or Maastricht Treaty, to the European Community to improve control of BU in Africa. References (1.) Portaels F. Epidemiology of mycobacterial diseases. In: Schuster M, editor. Mycobacterial diseases of the skin. Clinics in dermatology. New York New York, state, United States New York, Middle Atlantic state of the United States. It is bordered by Vermont, Massachusetts, Connecticut, and the Atlantic Ocean (E), New Jersey and Pennsylvania (S), Lakes Erie and Ontario and the Canadian province of : Elsevier Science Inc.; 1995. p. 207-22. (2.) Debacker M, Aguiar J, Steunou C, Zinsou C, Meyers WM, Guedenon A, et al. Mycobacterium ulcerans disease (Buruli ulcer) in rural hospital, southern Benin, 1997-2001. Emerg Infect Dis. 2004;10: 1391 8. (3.) Ablordey A, Swings J, Hubans C, Chemlal K, Locht C, Portaels F, et al. Multilocus variable-number tandem repeat typing of Mycobacterium ulcerans. J Clin Microbiol. 2005;43:1546-51. (4.) Ablordey A, Kotlowski R, Swings J, Portaels F. PCR amplification with primers based on IS2404 and GC-rich repeated sequence reveals polymorphism in Mycobacterium ulcerans. J Clin Microbiol. 2005;43:448-51. (5.) Stinear T, Davies JK, Jenkin GA, Hayman JA, Portaels F, Ross BC, et al. A simple PCR method for rapid genotype analysis of Mycobacterium ulcerans. J Clin Microbiol. 2000;38:1482-7. (6.) Stragier P, Ablordey A, Meyers WM, Portaels F. Genotyping Mycobacterium ulcerans and At marinum by using mycobacterial interspersed repetitive units. J Bacteriol. 2005; 187:1639-47. (7.) Marsollier L, Stinear T, Aubry J, Andre JPS JPS Jewish Publication Society JPS John Peter Smith (Hospital; Texas) JPS Justice & Public Safety JPS Jean Piaget Society JPS Juvenile Polyposis Syndrome JPS Joint Planning Staff , Robert R, Legras P, et al. Aquatic plants stimulate the growth of and biofilm Biofilm An adhesive substance, the glycocalyx, and the bacterial community which it envelops at the interface of a liquid and a surface. When a liquid is in contact with an inert surface, any bacteria within the liquid are attracted to the surface and adhere formation by Myeobacterium ulcerans in axenic axenic /axen·ic/ (a-zen´ik) not contaminated by or associated with any foreign organisms; used in reference to pure cultures of microorganisms or to germ-free animals. Cf. gnotobiotic. culture and harbor these bacteria in the environment. Appl Environ Microbiol. 2004;70:1097-103. (8.) Portaels F, Elsen P, Guimaraes-Peres A, Fonteyne PA, Meyers MW. Insects in the transmission of Mycobacterium ulcerans infection. Lancet. 1999;353:986. (9.) Portaels F, Chemlal K, Elsen P, Johnson PDR PDR A trademark for Physicians' Desk Reference, a group of reference books containing drug listings, especially one for prescription drugs. PDR , Hayman JA, Kirkwood R, et al. Mycobacterium ulcerans in wild animals WILD ANIMALS. Animals in a state of nature; animals ferae naturae. Vide Animals; Ferae naturae. . In: Collins MT, Manning B. Mycobacterial infections in domestic and wild animals. Paris: Office International des Epizooties; 2001. p. 252-64. (10.) Chemlal K, Huys G, Laval F, Vincent V, Savage C, Gutierrez C, et al. Characterization of an unusual Mycobacterium: a possible missing link between Mycobacterium marinum Mycobacterium ma·ri·num n. A bacterium that causes swimming pool granuloma. Mycobacterium marinum Infectious disease A mycobacterium that lives in fresh or salt water, causing chronic ulcerating granulomatous lesions. and Mycobacterium ulcerans. J Clin Microbiol. 2002;40:2370-80. (11.) Chemlal K, De Ridder K, Fonteyne PA, Meyers WM, Swings J, Portaels F. The use of IS2404 restriction fragment length polymorphisms suggests the diversity of Mycobacterium ulcerans from different geographical areas. Am J Trop Med Hyg. 2001;64:27-3. (12.) Huys G, Rigouts L, Chemlal K, Portaels F, Swings J. Evaluation of amplified fragment length polymorphism analysis for inter- and intraspecific in·tra·spe·cif·ic also in·tra·spe·cies adj. Arising or occurring within a species: intraspecific competition. differentiation of Mycobacterium bovis Mycobacterium bovis A mycobacterium that causes a TB-like infection in cows; before pasteurization was common, M bovis spread to humans via contaminated milk , M. tuberculosis M. tuberculosis, n the bacterium responsible for tuberculosis, generally a respiratory infection in man; nonrespiratory tuberculosis is considered an indicator disease for AIDS. See also tuberculosis. , and At ulcerans. J Clin Microbiol. 2000;38:3675-80. (13.) Stinear T, Jenkin GA, Johnson PD, Davies JK. Comparative genetic analysis of Mycobacterium ulcerans and Mycobacterium marinum reveals evidence of recent divergence. J Bacteriol. 2000; 182:6322-30. (14.) Hilty M, Yeboah-Manu D, Boakye D, Mensah-Quainoo E, Rondini S, Schelling E, et al. Genetic diversity in Mycobacterium ulcerans isolates from Ghana revealed by a newly identified locus containing a variable number of tandem repeats. J Bacteriol. 2006; 188:1462-5. (15.) Debacker M, Aguiar J, Steunou C, Zinsou C, Meyers WM, Portaels F. Buruli ulcer recurrence, Benin. Emerg Infect Dis. 2005;11:584-9. Pieter Stragier, * Anthony Ablordey, * L. Manou Bayonne, ([dagger]) Yatta L. Lugor, ([double dagger]) Ireneaus S. Sindani, ([section]) Patrick Suykerbuyk, * Henry Wabinga, ([paragraph]) Wayne M. Meyers, # and Fran(;oise Portaels * * Institute of Tropical Medicine, Antwerp, Belgium; ([dagger]) Centre Hospitalier de Libreville, Libreville, Gabon; ([double dagger]) Yambio Hospital, Eldoret, Kenya; ([section]) World Health Organization South Sudan Office, Gigiri, Nairobi, Kenya; ([paragraph]) Makerere University, Kampala, Uganda; and # Armed Forces Institute of Pathology Armed Forces Institute of Pathology A section of the US military which provides consultations, reference atlases and educational programs for pathologists , Washington, DC, USA Address for correspondence: Francoise Portaels, Department of Microbiology, Mycobacteriology Unit, Institute of Tropical Medicine, Nationalestraat 155, 2000 Antwerpen, Belgium; email: portaels@itg.be
Table 1. MIRU-VNTR profiles of Mycobacterium ulcerans and origin of
specimens (BK no.) or culture isolates *
ITM no./loci l ([double 6 ([double 9 ([double 33 ([double
([dagger]) dagger]) dagger]) dagger]) dagger])
5142 1 1 1 2
9540 1 1 1 3
98-0912, 8756 1 2 1 3
BK03-0621 2 1 1 3
BK02-2487 2 1 1 1
BK04-0296 2 1 1 1
84 NA 1 2 1
7922 2 2 2 1
5114 1 2 2 1
5116 1 2 2 2
9099 1 2 2 2
5150 3 1 1 3
94-0662 3 1 1 3
96-0658 3 1 1 3
97-0483 3 1 1 3
BK04-0875 3 1 1 3
BK04-1396 3 1 1 3
02-0280 3 1 1 3
02-1081 3 1 1 3
05-0303 3 1 1 3
05-0304 3 1 1 3
BK05-0027 3 1 1 3
BK04-1591 4 1 1 1
BK04-1601 4 1 1 1
05-0861 4 1 1 1
05-1459 4 1 1 1
BK04-0513 4 1 1 1
BK05-0614 4 1 1 1
ITM no./loci
([dagger]) Genotype Origin
5142 Victoria Victoria, Australia
9540 Southeast Asia Queensland,
Australia, PNG;
Malaysia
98-0912, 8756 Asia China, Japan
BK03-0621 PNGII PNG
BK02-2487 PNGIII PNG
BK04-0296 PNG
84 Suriname Suriname
7922 French Guiana French Guiana
5114 Mexico Mexico
5116 Central African Maniema, DRC
Congo River Basin
9099 Maniema, DRC
5150 Atlantic Africa Bas-Congo, DRC
94-0662 Cote d'Ivoire
96-0658 Angola
97-0483 Ghana
BK04-0875 Togo
BK04-1396 Benin
02-0280 Cameroon
02-1081 Cameroon
05-0303 Congo-Brazzaville
05-0304 Congo-Brazzaville
BK05-0027 Gabon
BK04-1591 East African Sudan
Nile River
BK04-1601 Basin Sudan
05-0861 Orientale, DRC
05-1459 Uganda
(NCTC no. 10445)
BK04-0513 Uganda
BK05-0614 Uganda
ITM no./loci Ziehl-Neelsen
([dagger]) staining ([section]) Year ([paragraph])
5142 1967
9540 1978
98-0912, 8756 1998
BK03-0621 3+ 2003
BK02-2487 1+ 2002
BK04-0296 1+ 2004
84 1984
7922 1990
5114 1953
5116 1962
9099 1964
5150 1962
94-0662 1994
96-0658 1996
97-0483 1997
BK04-0875 4+ 2004
BK04-1396 -- 2004
02-0280 2002
02-1081 2002
05-0303 1979
05-0304 1979
BK05-0027 1+ 2005
BK04-1591 4+ 2004
BK04-1601 -- 2004
05-0861 1959
05-1459 1964
BK04-0513 1+ 2004
BK05-0614 4+ 2005
* MIRU, mycobacterial interspersed repetitive unit; VNTR,
variable-number tandem repeat; PNG, Papua New Guinea; DRC, Democratic
Republic of Congo; NA, no amplification; NCTC, National Collection of
Type Cultures. Shaded fields represent results from our previous study
(6).
([dagger]) ITM numbers (Institute of Tropical Medicine). These numbers
are representative members for the genotype each belongs to (6).
([double dagger]) Numbers in columns 2 through 5 represent the number
of repeats at the specific locus. These numbers form a pattern that
divides M. ulcerans into genotypes.
([section]) Scale of the American Thoracic Society. Ziehl-Neelsen
staining has not been done on culture isolates, since identifying
acid-fast bacilli in a culture is an obsolete practice.
([paragraph]) The date represents the year of isolation.
Table 2. Primer sequence and location in Mycobacterium ulcerans and
amplicon length at loci 1, 6, 9, and 33, resulting from a polymorphism
in tandem repeat copy numbers
Primer sequence
Locus Forward primer (5'-3') Reverse primer (5'-3') Location
1 GCTGGTTCATGCGTGGAAG GCCCTCGGGAATGTGGTT mu0115C04F
6 GACCGTCATGTCGTTCGATCC GACATCGAAGAGGTGTGCC mu0019B07G
TAGT GTCT
9 GCCGAAGCCTTGTTGGACG GGTTTCCCGCAGCATCTCG mu0113D07F
33 CAAGACTCCCACCGACAGGC CGGATCGGCACGGTTCA mu043E11R
Amplicon length
Locus 1 copy 2 copies 3 copies 4 copies
1 380 433 486 539
6 500 556 -- --
9 435 488 -- --
33 720 778 836 --
|
|
||||||||||||||||||
Printer friendly
Cite/link
Email
Feedback
Reader Opinion